Overview

Comprehensive Description

Taxonomic History

1 subspecies

Dorylus (Alaopone) conradti Emery, 1895l PDF: 734, pl. 16, figs. 1-4; pl. 17, figs. 7-10 (w.q.) TOGO. AntCat AntWiki

Taxonomic history

Current subspecies: nominal plus Dorylus conradti berlandi.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Reference for Kenya if not type: Kakamega Forest
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Santschi, F., 1926:
 Differe du type (d'apres sa description) par sa couleur plus foncee, d'un jaune brunatre, ou brun jaunatre. Tete plus allongee, son bord posterieur plus profondement echancre. Le sillon frontal est large- ment interrompu. La dent sous petiolaire spiniforme. Pilosite du gastre extremement courte. Le dessus du mesoepinotum est aussi sculpte et submat que le pronotum chez les grandes ouvrieres de 7,5 mm. avec l'intervalle des points lisse vers les sutures. Pour le reste comme chez le type.
  Cote d'Ivoire Bingerville (L. Berland) Recue melangee a Dorylus spininodis Em. avec cette mention: Nuisible au semis d'Alaea guineensis.
 

Wheeler, W. M., 1922:
 Five soldiers and ten smaller workers from Niangara (Lang and Chapin), taken from the stomach of a frog (Hemisus marmoratum), agree perfectly with Emery's description and figures of the types from Togo, except that the largest workers measure only 4.5 to 5 mm., whereas Emery's specimens attained a length of (3.5 mm. The soldier is easily recognized by the coarsely punctate thorax and the very elongate head, which, with the closed mandibles, is nearly twice as long as broad.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Five soldiers and ten smaller workers from Niangara (Lang and Chapin), taken from the stomach of a frog (Hemisus marmoratum), agree perfectly with Emery's description and figures of the types from Togo, except that the largest workers measure only 4.5 to 5 mm., whereas Emery's specimens attained a length of (3.5 mm. The soldier is easily recognized by the coarsely punctate thorax and the very elongate head, which, with the closed mandibles, is nearly twice as long as broad.

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus conradti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGAATCTTAGGTTCTTCAATAAGGATAATTATTCGTTTAGAATTAGGTACTTGTGGCACAATAATTTTTAAT---GATCAAGTTTTTAATGCTATCATTACAAGACATGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGTAATTTTATTGCCCCCCTAATAATTGGAGCTCCTGATATAGCATACCCACGAATAAACAATATAAGATTTTGACTATTACCACCATCTATTACATTAATAATTTGTAGAAATTTTATAAACAATGGGCCAGGAACAGGATGAACAGTTTACCCCCCTTTAGCTTCTAATATTTATCATAGAGGACCATCAATTGATTTAACAATCTTTTCATTACATATTGCAGGTATATCCTCAATTCTTGGAGCTATCAATTTTATTTCAACAATCATTAACATACATCATAAAAATTTAACTATAGATAAAACACCTTTATTTGTTTGATCAATCTTAATTACAGCAATTTTATTACTTCTATCTTTACCTGTTCTAGCAGGAGCAATTACTATACTTTTAACTGATCGAAACATTAATACCTCATTTTTTGACCCCTCCGGAGGTGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus conradti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!