Overview

Comprehensive Description

Taxonomic History

2 subspecies

Dorylus emeryi Mayr, 1896 PDF: 225 (w.) CAMEROUN. AntCat AntWiki

Taxonomic history

Combination in Dorylus (Anomma): Emery, 1910b PDF: 11; in Anomma: Menozzi, 1942a PDF: 165.
Current subspecies: nominal plus Dorylus emeryi opacus, Dorylus emeryi pulsi.
See also: Raignier & Boven, 1955: 83.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1909:
  — [[ male ]]? ( Stanleyin. sp. ?). — Je rapporte avec doute au D. Emeryi un [[ male ]] qui differe comme suit du nigricans :
  Long. 28 a 30 mill. Tete large de 4,8, thorax de 6,6, abdomen de 6,4 mill, (chez le nigricans , tete large de 5, thorax de 6, abdomen de 5,6 mill.). Vertex presque plat, a peine convexe devant d'un oe il a l'autre. Aretes frontales moins proeminentes; l'espace qui les separe moins concave; toute la tete plus deprimee; les yeux distinctement plus petits. Face basale de l'epinotum (1) plus longue, surtout au milieu. N oe ud du pedicule plus large. L'abdomen est un peu elargi (renfle) vers son tiers posterieur, mais moins que chez les Rhogmus . Pattes bien plus courtes que chez le nigricans . Ailes brunes, bien plus fonces que chez le nigricans . La pubescence du thorax est moins appliquee, moins soyeuse et plus laineuse que chez le nigricans , ce qui lui donne un aspect de chapeau de feutre brun gris. Du reste comme le nigricans .
  Katanga (Lemaire); Mawambi. — Ce male plus. massif semble devoir correspondre a l´ Emeryi dont l'ouvriere est aussi plus massive, a les pattes plus courtes et habite les memes parages. Pour eviter neanmoins les imbroglios qui resultent d'identifications presumees, consacrant souvent ensuite des erreurs, je lui donne provisoirement le nom de Stanleyin. sp.
 

Santschi, F., 1923:
 L'examen comparatif du [[ soldier ]] type du Cameroun (Conrad) avec les exemplaires d'Abury, me fait constater que ces derniers doivent etre rapportes a la variete Pulsi Forel.
  [[ soldier ]] (Non decrit). Long: 11 a 11,5 mm, Sculpture et couleur comme chez emeryi , les parties lisses de la tete aussi etendues, l'abdomen un peu plus mat et plus pileux, Les angles posterieurs de la tete presque aussi prolonges. Les mandibules sont un peu etroites et n'ont presque pas trace de dent preapicale alors qu'elle est encore presente chez le [[ soldier ]]. de emeryi plus grand. Articles du funicule plus minces. Le petiole est nettement plus etroit que chez emeryi ainsi que l'abdomen.
 [[ worker ]] ' et [[ worker ]] ". Les [[ worker ]] de 3 mm. sont encore souvent d'un brun roussatre.
 La [[ worker ]] " ne depasse pas 2,2 mm. Elle est jaune roussatre, luisante, ses antennes ont 11 articles.
 Cote d'Or: Abury (Silvestri). Le type decrit par Forel est aussi de l'Afrique occidentale.
 

Bernard, F., 1953:
 Fourmi relativement rare dans les collections, mais citee du Congo a la Cote de l'Or. Au Nimba, elle ne remonte pas tres haut et parait assez abondante aux stations suivantes: G'ba, Yanle, N'Zo (nombreuses ouvrieres (LaMOTTE), foret primaire vers 700 m., en colonne (VILLIERS). Zouepo 1.215 m., foret (LAMOTTE). Toutes appartiennent a la forme typique decrite du Cameroun.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

— [[ male ]]? ( Stanleyin. sp. ?). — Je rapporte avec doute au D. Emeryi un [[ male ]] qui differe comme suit du nigricans :

 

Long. 28 a 30 mill. Tete large de 4,8, thorax de 6,6, abdomen de 6,4 mill, (chez le nigricans , tete large de 5, thorax de 6, abdomen de 5,6 mill.). Vertex presque plat, a peine convexe devant d'un oe il a l'autre. Aretes frontales moins proeminentes; l'espace qui les separe moins concave; toute la tete plus deprimee; les yeux distinctement plus petits. Face basale de l'epinotum (1) plus longue, surtout au milieu. N oe ud du pedicule plus large. L'abdomen est un peu elargi (renfle) vers son tiers posterieur, mais moins que chez les Rhogmus . Pattes bien plus courtes que chez le nigricans . Ailes brunes, bien plus fonces que chez le nigricans . La pubescence du thorax est moins appliquee, moins soyeuse et plus laineuse que chez le nigricans , ce qui lui donne un aspect de chapeau de feutre brun gris. Du reste comme le nigricans .

 

Katanga (Lemaire); Mawambi. — Ce male plus. massif semble devoir correspondre a l´ Emeryi dont l'ouvriere est aussi plus massive, a les pattes plus courtes et habite les memes parages. Pour eviter neanmoins les imbroglios qui resultent d'identifications presumees, consacrant souvent ensuite des erreurs, je lui donne provisoirement le nom de Stanleyin. sp.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fourmi relativement rare dans les collections, mais citee du Congo a la Cote de l'Or. Au Nimba, elle ne remonte pas tres haut et parait assez abondante aux stations suivantes: G'ba, Yanle, N'Zo (nombreuses ouvrieres (LaMOTTE), foret primaire vers 700 m., en colonne (VILLIERS). Zouepo 1.215 m., foret (LAMOTTE). Toutes appartiennent a la forme typique decrite du Cameroun.

License not applicable

Bernard, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Dorylus emeryi Forel
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Year Collected: 1807
Locality: Bas Congo; Salon; (estomac dun Pangolin), Unknown, Congo
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus emeryi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCAGGTATTTTAGGATCTTCAATAAGAATAATTATCCGTTTAGAGCTTGGAACTTGTGGAACAATAATTTTTAAT---GATCAAGTTTTTAATGCTATCGTTACTAGACACGCATTCATTATAATTTTTTTTATAGTTATGCCTTTTATAATTGGGGGATTTGGAAATTTTATCGCACCTTTAATAATTGGGGCCCCCGATATAGCATACCCTCGTATAAATAATATAAGATTTTGATTACTGCCACCTTCAATTACTTTAATGATTATAAGAAATTTTATTAGTAGAGGGCCAGGAACTGGGTGAACTGTTTACCCTCCATTAGCTTCAAGTATTTATCATAATGGACCCTCAATTGATTTAACTATTTTTTCATTACATATTGCAGGTATATCATCTATTTTAGGAGCAATTAATTTTATCTCTACTATTATTAATATACATCATAAAAATCTAACTATAGATAAAACTCCATTATTTGTTTGATCAATTTTAATTACAGCTATTCTTTTATTACTCTCCCTACCAGTTTTAGCAGGTGCAATTACTATACTATTAACTGACCGTAATATTAATACTTCATTTTTTGATCCTTCAGGAGGCGGTGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus emeryi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!