Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Brief Summary

The army ant Eciton burchellii (treated for years as Eciton burchelli, although originally described as Eciton burchellii) is a keystone predator in the leaf litter of many Neotropical forests (keystone species are species whose ecological importance is disproportionately great relative to their biomass). There are many species of army ants (not all related) in both the New World and Old World (mainly, though not only, in the tropics), but the most extensively studied species is E. burchellii, with much of the work on this species undertaken over many decades on Barro Colorado Island in Panama. (O'Donnell et al. 2007 and references therein).

Eciton burchellii live in colonies that can exceed half a million individuals. In the course of a day, a single colony may capture some 30,000 prey items. Their activity also flushes out larger arthropods, some of which are quickly devoured by ant-following birds (in some regions, there are bird species that depend on following army ants for nearly all their food). Eciton burchellii colonies typically exhibit a 35-day activity cycle. For 20 days, a colony resides in a fixed bivouac (a temporary nest, see below) from which raids emerge nearly every other day. During this phase, the colony's single queen may lay as many as 100,000 eggs. At the end of the 20-day period, these eggs hatch into larvae and with the increased demand for food the raiding becomes more frequent and intense. The colony now enters the nomadic phase, during which a new bivouac is formed at the end of each day's raiding. This behaviour lasts for about 15 days, until the larvae pupate, when a new statary (i.e., non-nomadic) phase begins. At the end of each statary phase, the pupae become new callow (i.e., newly emerged) workers. Such 35-day cycles continue throughout the year. Colonies may go extinct when the queen dies or the colony becomes too small. The largest colonies reproduce by rearing a sexual brood (males and a small number of queens) and then splitting. The daughter colonies are then headed either by the existing queen or by one of the new queens reared prior to the fission of the original colony. (Boswell et al. 1998 and references therein)

Eciton burchellii do not build nests like most other ants. Instead, they form temporary above-ground nests known as "bivouacs". Most of the cover in these partly sheltered locations is provided by the bodies of the workers themselves, which link their legs and bodies together with strong hooked claws at the tips of their feet. Together the workers--perhaps a half million, with a mass of about a kilogram-- form a solid cylidrical or ellipsoidal mass around a meter across. Toward the center of the mass are thousands of larvae and the single queen. (Holldöbler and Wilson 1994) For a broad and detailed overview of army ant biology (and ant biology in general) see the extraordinary volume by Holldöbler and Wilson, The Ants (1990), as well as early publications they cite by T.C. Schneirla and later ones by C.W. Rettenmeyer, both of whom were pioneers in understanding the biology of army ants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

burchellii (Westwood HNS 1842).

Amambay, Canindeyú , Guairá , “Paraguay” (s. loc.) (ALWC, BMNH, INBP, IFML, LACM, MCSN, MZSP, NHMB, NHMW). Literature records: “Paraguay” (s. loc.) (Borgmeier 1955, Santschi 1920a).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 25-25, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

4 subspecies

Labidus burchellii Westwood, 1842 PDF: 74, pl. 20, fig. 1 (m.) BRAZIL. AntCat AntWiki

Taxonomic history

Emery, 1896g PDF: 39 (s.w.); Wheeler, 1921d PDF: 304 (q.); Emery, 1899f: 6 (l.).
Combination in Eciton: Emery, 1890c PDF: 39.
Current subspecies: nominal plus Eciton burchellii cupiens, Eciton burchellii foreli, Eciton burchellii parvispinum, Eciton burchellii urichi.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eciton burchellii is found in the tropical regions of Central and South America.

Biogeographic Regions: neotropical (Native )

  • Holldobler, B., E. Wilson. 1990. The Ants. United States of America: Harvard University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paraguay: Amambay, Canindeyú, Guairá
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eciton burchelli has a very broad geographic distribution in the Neotropics, being found in lowland forests more or less continuously from southern Mexico to southern Peru and Brazil (Watkins 1976, cited in Brumfield et al. 2007).

Eciton burchellii is among the most conspicuous ants in wet tropical lowland forests from Mexico south to Brazil and Peru or Paraguay (Holldöbler and Wilson 1990,1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eciton burchellii are polymorphic, worker sizes range from 3mm to 12mm. They have long, pointed, falcate (hook-shaped) mandibles. Their long legs on an elongated body make them appear almost spider-like. On their feet are tarsal hooks, which they use to grip each other as they form bridges and bivouacs. They range from a deep golden color to a dull brown. Workers have single faceted, compound eyes, double segmented waists, and a well-developed sting.

Range length: 3 to 12 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic ; venomous

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Taxonomic Treatment

Wild, A. L., 2007:
  Amambay, Canindeyú , Guairá , “Paraguay” (s. loc.) (ALWC, BMNH, INBP, IFML, LACM, MCSN, MZSP, NHMB, NHMW). Literature records: “Paraguay” (s. loc.) (Borgmeier 1955, Santschi 1920a).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Segundo mostrei em 1936 (Arq. Inst. Biol. Veg. 3, p. 53), deve ser considerada como burchelli s. str. aquella forma cujos operários menores têm o gaster escuro; nos soldados, o 1.° articulo funicular ultrapassa um pouco o bordo do escapo, quando forma um angulo recto com este. São synonymos: as variedades parvispina For . e infumatum Wheeler .

 

Distribuição geographica: Sta. Catharina até o Mexico. Possuo material de S. Paulo, S. Catharina, Rio de Janeiro, Espirito Santo e Costa Rica.

 

Fêmea . - Comprimento 24 mm. Coloração pardovermelha escura, cabeça ennegrecida, mais escura do que o dorso do thorax. Cornos epinotaes ligeiramente mais compridos que em foreli Mayr ; também os cornos peciolares um pouco mais compridos e mais uniformemente attenuados. No mais como a descripção de Wheeler (1921). Um exemplar adulto, San José , Costa Rica, H. Schmidt leg.

 

Localidade do typo (macho descripto por Westwood): Santos (S. Paulo, Brasil).

License not applicable

Borgmeier, T.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amambay, Canindeyú , Guairá , “Paraguay” (s. loc.) (ALWC, BMNH, INBP, IFML, LACM, MCSN, MZSP, NHMB, NHMW). Literature records: “Paraguay” (s. loc.) (Borgmeier 1955, Santschi 1920a).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Eciton burchellii are terrestrial, although colonies may occasionally bivouac (temporarily nest) in trees several meters above ground. Army ants need very humid, warm climates. Although they may venture out to forage in open or agricultural areas, they prefer heavily forested environments.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: agricultural

  • Akre, D. 1968. The Behavior of Euxenister and Pulvinister Histerid Beetles Associated with Army Ants. PanPacific Entomologist, 44: 87-101.
  • Franks, N. 1982. Ecology and Population Regulation in the Army Ant Eciton burchellii . Pp. 389-403 in The Ecology of a Tropical Forest. United States of America: The Smithsonian Institute.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Army ants work together to catch, subdue, and carry their prey back to the bivouac. They subdue prey with powerful stings, while also pulling off legs and antennae using mandibles made for pinching and gripping. Their sharp pointed mandibles do not have a good cutting edge, so anything too big to be carried back that cannot be easily pulled apart is left behind.  Foraging direction during the stationary periods shifts 123 degrees per raid, while foraging during the nomadic phase tends to be in the same direction everyday.

Although insect types comprising the Eciton burchellii diet vary slightly between wet and dry seasons, it is consistently diverse and high in fat. Franks (1987) found that during the wet season the majority of food items brought back to the nest are wasp and ant broods, while cockroaches and crickets predominate in the dry season. Schneirla (1956) observed significantly more variation year round, with tarantulas, scorpions, beetles, roaches, grasshoppers, as well as other hymenopteran adults and broods, and other insects, making up their diet. He also witnessed snakes, lizards, and nestling birds being attacked, although there are no accounts of vertebrate prey being carried back to the bivouac. Other arthropods escape through excitatory secretions, repellent chemicals, or tonic immobility.

Animal Foods: eggs; body fluids; insects; terrestrial non-insect arthropods

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Many Eciton colonies have been observed to contain “ecitophiles”, beetles and other arthropods that rely on these ants (Schneirla 1956). Eciton burchellii is specifically known to have relationships with Euxenister beetles which live in the nest, travel with the bivouac, groom adult workers, and indiscriminately feed off booty and broods (Akre 1968). Several species of mite also call the army ant bivouac home, while thousands of small vertebrates and invertebrates alike are gobbled up by ant birds (including Formicariidae and Thamnophilidae) while escaping the attacking ant swarm. Ant birds are birds from at least four different families that depend heavily upon the swarming army ants to disturb small animals that are then gobbled up. These birds are commonly found following ant foraging trails.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the New World tropics, Eciton burchellii and related army ants have complex relationships with the suite of animals (notably, the community of specialist birds) that obtain much or most of their food by capturing arthropods and small vertebrates attempting to escape from ant swarms. Ant-following birds and parasitoid flies regularly attend only the few army ants in the Ecitoninae tribe that develop swarm raids when foraging (other species have less conspicuous foraging behavior and either lack attendants or attract them only sporadically). Colonies of the predominant swarm raider, E. burchellii, can reach enormous sizes and may scour more than a thousand square meters of forest floor each day. Wrege et al. (2005) used exclusion experiments to investigate the impact of ant-following birds on the ants and found that ant-following birds are parasites on E. burchellii, significantly reducing the ants' success rate in capturing prey. An average nomadic colony in central Panama consumes ~22 g of leaf-litter arthropods each day, plus ~24 g of social insect brood, in raids that cover 700 square meters of forest floor (Franks 1982, cited in Wrege et al. 2005). Based on these numbers, Wrege et al. estimated that ant-following birds remove prey biomass (which would otherwise be available to the foraging ants) amounting to around 15% of a migrating colony's daily food requirement. (Wrege et al. 2005 and references therein)

Although large assemblages of army ant-following birds in the Neotropics are typically composed of no more than 20 to 30 individuals (smaller than the larger assemblages often associated with African Dorylus driver ants; Chaves-Campos 2005 and references therein), in the Caribbean foothills of Costa Rica Chaves-Campos (2005) observed a large swarm of E. burchellii attended by at least 20 Ocellated Antbirds (Phaenostictus mcleannani), 10 Bicolored Antbirds (Gymnopithys leucaspis), 10 Spotted Antbirds (Hylophylax naevioides), and 10 Plain-brown Woodcreepers (Dendrocincla fuliginosa), along with several Northern Barred Woodcreepers (Dendrocolaptes sanctithomae), Rufous Motmots (Baryphthengus martii), and White-fronted Nunbirds (Monasa morphoeus). In addition to the overall numbers of birds, the simultaneous presence of 10 or more obligate ant-following birds of the same species at the same swarm was also extraordinary. (Chaves-Campos 2005 and references therein)

Berghoff et al. (2009) studied the mite fauna living on several thousand Eciton burchellii workers from 20 colonies in Panama. Only 5% of the workers had mites (although this percentage is low, extrapolating this result to an average E. burchellii colony of about 500,000 workers, which may or may not not be a valid exercise, implies an average of 20,000 mites associated with each colony). Of those infected, just a single worker had more than one species and the one relatively common parasitic mite (Rettenmeyerius carli) was limited to only two individuals per ant. Only 14 workers had more than one mite and of these just two workers had more than two mites (three and six). Mite diversity was high, with 31 taxa recorded (18 of these were identified to species). Accumulation curves suggest that the authors were able to sample most of the mite taxa present in the population. Most of the symbiotic mites found on E. burchellii workers are probably relatively harmless guests (the two likely exceptions being Planodiscus burchelli and R. carli).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Dispersal in Eciton burchellii is strongly sex-biased since males are winged and queens are permanently wingless. Berghoff et al. (2008) used microsatellite and mitochondrial genetic markers to study the population structure of this species on Barro Colorado Island in Panama (microsatellite markers are normally nuclear DNA markers inherited from both parents whereas in most animals mitochondria--and hence mitochondrial DNA--are maternally inherited). Nuclear markers showed little differentiation between subpopulations, whereas mitochondrial differentiation was high, suggesting that although female dispersal was very low, male dispersal may be sufficient to effectively homogenize the studied populations.

Jaffé et al. (2009) used microsatellite genetic markers to study gene flow in a population of E. burchellii in Mexico. Because queens of this species are wingless, long-distance gene flow is virtually all via males (although during their monthly migrations, Eciton colonies are able to cover up to 1.6 km, so queens also contribute, to dispersal, although to a far lesser degree). Jaffé et al. found a high level of heterozygosity, weak population differentiation, and no evidence for inbreeding. They also found that through extreme multiple mating, the queens are able to sample the genes of males from up to ten different colonies, usually located within a radius of around 1 km. Thus, E. burchellii seems to maintain high gene flow via male dispersal.

Vidal-Riggs and Chaves-Campos (2008) describe and assess a method of estimating colony densities of E. burchellii based on raid crossings on trails.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Army ants, like all ants, have a variety of ways to communicate with one another. Most important are chemical signals. Chemicals called pheromones can be released into the air to signal alarm, food, or used for recognition of a nest mate. Workers also use chemicals to mark foraging trails by wiping their abdomens on the ground as they walk. Chemicals can additionally be used to communicate needs for assistance, food, tropholaxis (the exchange of oral or anal fluid), control of reproduction within the colony, and sexual communication.  In addition to chemical signals, army ants communicate with vibrations and touch. Army ants do not rely on visual communication as they are almost completely blind.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: polarized light ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

All Eciton species live primarily above ground, which is unusual for army ants, and they all prey on other ants. However, some species are strict ant specialists, whereas others also take non-ant prey. The diet of E. burchellii is unique because although around half their diet consists of ants, the other half consists of large arthropods (katydids, spiders, etc.) that they capture and dismember. No other Eciton species is known to prey on arthropods that are not social insects. Worker morphology varies considerably within and among Eciton species. One important difference among species is the presence or absence of a distinct "submajor" caste. Powell and Franks (2005) argue that the task of transporting novel prey selected for this exaggerated transport caste (which is significantly more exaggerated in E. burchellii than in any other species known to have this caste). Submajors clearly play an important role in the colony, although they constitute only 3% of the workers in an E. burchellii colony. (Powell and Franks 2005 and references therein)

Unlike most other army ants, E. burchellii armies do not run in narrow columns but rather spread out into flat, fan-shaped masses with broad fronts (Holldöbler and Wilson 1994). The spectacular group raids of E. burchellii, which can contain up to 200,000 workers, always remain connected to the nest by a "principal trail" of forager traffic. Swarming E. burchellii exhibit a remarkable behavior, referred to as "plugging behavior", in which some workers use their bodies to plug "potholes" in the natural surfaces over which the principal trail travels, providing a partly living surface for their nestmates to use. Investigations by Powell and Franks (2007) found that this behavior results in a significant improvement in the performance of prey-laden foragers, and that this improvement results in a net benefit for the colony. Although all Eciton species live in colonies with many tens of thousands of workers, raid and emigrate on the surface, and have similar cyclic patterns of nomadism, the swarm density of E. burchellii and the strength of the associated trail traffic are exceptional within the genus, a factor Powell and Franks suggest is key in their interesting discussion of the evolution of this unusual behavior. (Powell and Franks 2007 and references therein)

Lalor and Hughes (2011) studied the alarm response of Eciton burchellii and E. hamatum and discuss their similarities and differences in the context of the behavioral ecology of these two species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Eggs are laid by the queen and are then taken away and arranged throughout the center part of the bivouac. At the same time, the larvae from the previous cycle begin to pupate, spinning silken cocoons for themselves. Once enclosed in their cocoons, they are placed on the outer edges of the bivouac to metamorphose. After metamorphosis is complete, new adults need help from other colony members to eclose (emerge from their cocoons). As they begin to move within the cocoon, workers notice the vibrations and assist the callow (new) workers to emerge. As callows eclose, the new eggs begin to hatch into larvae. An active larval brood stimulates the workers of the colony chemotactually, energizing the colony to a “high pitch” during the larval development, and the nomadic condition is begun and maintained. As the larvae of Eciton burchellii pass through five larval instars before pupating, nightly migrations of the bivouac are necessary in order to provide the high fat diet needed for the brood to develop.

Development - Life Cycle: metamorphosis

  • Schneirla, T. 1949. Problems in the Environmental Adaptation of Some New-World Species of Doryline Ants.. Anales del Instituto de Biologia., Tomo XX, Nos. 1 & 2.
  • Schneirla, T., R. Brown, F. Brown. 1954. The Bivouac or Temporary Nest as an Adaptive Factor in Vertain Terrestrial Species of Army Ants. Ecological Monographs, 24: 269-296.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Workers live for several months while queens may live for several years. Little information is known about the exact lifetimes as this species is very difficult to keep in captivity, and its nomadic behavior makes individuals very difficult to track over long periods of time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The queen is able to store sperm in order to fertilize all of her eggs after mating only once. It has been suggested that queens of this species may mate up to five times over their lifetimes, although more research is needed in this area.  Eciton queens are unusual in that they do not have wings. A queen will mate when a winged male is discovered by foraging workers and brought back to the bivouac. A male army ant will only mate with one queen in his lifetime. After a short period, usually less than 48 hours, he will die.

On the queens propodium and petiole are horns pointed behind her. Males have been observed to grasp these horns with their mandibles while mating.

Mating System: polyandrous ; eusocial

The stationary condition occurs when the larvae begin to pupate and the physogastric (swollen with eggs) queen lays eggs. Nomadic nights begin again when callow (new) workers emerge from the pupae and many thousands of eggs hatch into a new generation of larvae.

New colonies are formed when new queens emerge from their cocoons. Since army ant queens are wingless, workers bond to the queen through chemical scents as they care for her while still in the parent colony. Eventually, the group of workers that has bonded with the new queen will leave the parent colony and begin a satelite colony with their young, new queen. For the first several days workers often go back and forth between the satelite and parent colonies. After this new (virgin) queen has mated and the new colony begins to increase in numbers, it becomes its own full fledged colony, and workers from each colony no longer recognize each other and will fight members of the other as if they had never been related.

Breeding interval: The queen lays a new cycle of eggs aproximately every three weeks.

Breeding season: Internally fertilized eggs are layed in three week cycles year round. Mating must take place only once (although it may happen up to five times) in the life of each queen.

Key Reproductive Features: iteroparous ; year-round breeding ; sexual ; fertilization (Internal ); oviparous ; sperm-storing ; delayed fertilization

Ants provide for their developing brood with care. Although the queens only job is to lay eggs, the workers care diligently for every egg, larva, and pupa. Primary caretakers of broods are called minims, and tend to be smaller sized ants. As temperature and humidity change throughout the day, minims will move broods around within the colony so that abiotic conditions are always as favorable as possible for development within the colony. In addition to moving broods around within the bivouac, the bivouac itself changes shape in response to changing abiotic factors outside in order to keep conditions constant within the colony walls.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Holldobler, B., E. Wilson. 1990. The Ants. United States of America: Harvard University Press.
  • Gotwald, W. 1995. Army Ants: The Biology of Social Predation. Ithica, NY, USA: Cornell University Press.
  • Schneirla, T. 1947. A Study of Army-Ant Life and Behavior Under Dry-Season Conditions with Special Reference to Reproductive Functions.. American Museum Novitates, 1336.
  • Akre, D. 1968. The Behavior of Euxenister and Pulvinister Histerid Beetles Associated with Army Ants. PanPacific Entomologist, 44: 87-101.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eciton burchellii colonies normally have a single queen and may have up to half a million polymorphic workers. On average, E. burchellii colonies studied on Barro Colorado Island (BCI) in Panama rear a synchronized cohort of around 50,000 new workers every 35 days. If colonies are sufficiently large at the start of the annual dry season, they may begin to produce a reproductive brood of about 4,000 males and a small number of new queens. When the males and new queens emerge from their pupal cases, the old parental colony undergoes a process of binary fission, splitting into two daughter colonies of approximately equal size and composition of individuals. Approximately one third of the 50 colonies on BCI reproduce each year. Thus colonies may take several years to grow from a daughter colony into a reproductive one. The mother queen may be retained by one of the daughter colonies or, alternatively, both daughter colonies may get a new queen. If a mother queen is retained in a colony, it is likely that she will be rejected at the next fission. Queens and males are very large and robust, but while males are winged and strong fliers, queens are never winged. Males are therefore the dispersing sex, and workers of foreign colonies allow them to enter, to mate with their queen. An important consequence of this unusual mating system is that queens may have the opportunity to mate several times each year of their lives. Males can only mate with the queen of the first colony they attempt to enter, because they immediately lose their wings, preventing further dispersal. (Franks 1985, cited in Denny et al. 2004; Denny et al. 2004 and references therein).

Although colonies of social insects typically have singly mated queens, there are many exceptions to this general rule and, as just noted, Eciton burchellii is a striking one. Denny et al. (2004) used microsatellite markers to investigate mating frequency in E. burchellii and estimated a mating frequency among the highest known for social insects. However, later work involving some of the same authors (Kronauer et al. 2006) showed that mating frequencies, although very high, were somewhat lower than initially believed (in line, in fact, with estimates for other army ant species), with the newer analyses finding mean observed and effective queen mating frequencies of 12.9 each (and, in contrast to earlier data, no evidence that queens are inseminated repeatedly throughout their lives, which would be exceptional for eusocial Hymenoptera; see also Kronauer and Boomsma 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Groups move efficiently: army ants
 

Army ants move efficiently in large numbers by maintaining three lanes of traffic; two outer lanes travel opposite the inner lane and are governed by behavioral differences related to possession of food.

   
  "By forming three lanes of traffic during hunting expeditions, army ants in Panama come close to achieving the maximum possible rate of traffic flow. Given that army ants are blind, and that a hunting party might consist of 200,000 ants marching in opposite directions, it is surprising that they are able to maintain such efficiency. The answer lies in the behavioral differences between ants with food and ants without. Ants returning from a successful hunt are less likely to deviate when bumped. Weighed down by their prize, they simply continue to march in a line, guided by the pheromone trail of the ants in front of them. Ants traveling away from the nest carry no food, and are more likely to get out of the way. The result is a middle lane of food-toting ants moving in one direction, and two outer lanes of unburdened ants moving in the opposite direction. Using a computer model, researchers from Princeton University and the University of Bristol learned that, as behavioral differences decrease, traffic efficiency goes down. If burdened and unburdened ants behaved in roughly the same way, the three-lane system would deteriorate." (Courtesy of the Biomimicry Guild)

Watch video
  Learn more about this functional adaptation.
  • Couzin, I.D.; Franks, N.R. 2003. Self-organized lane formation and optimized traffic flow in army ants. Proceedings of the Royal Society of London, Series B. 270: 139-146.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Meisel (2006) studied the thermal ecology of Eciton burchellii. He found that these ants are extremely sensitive to temperatures above 43°C, that they live in an environment in which they routinely encounter potentially lethal temperatures, and that as a consequence they have developed a range of individual and colony-level responses to both limit such encounters and minimize their risks. These responses constrain the mobility and foraging effectiveness of E. burchellii colonies, particularly in fragmented or disturbed landscapes, and affect their behavior within continuous forest. These ants retreat from warm edges, steer around hot patches in continuous primary forest, and appear in many ways to be living near the upper limit of their temperature tolerance.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

For studies of intra-colony relatedness and other purposes, Nigel et al. (2004) developed eight highly polymorphic microsatellite markers for Eciton burchellii.

Jaffé et al. (2007) found that genetic effects contribute significantly to the development of different worker castes in Eciton burchellii. However, as in other social Hymenoptera with a demonstrated genetic component for caste determination, the genetic role in E. burchellii is limited. Most males were able to sire daughters of all worker castes and the additive genetic variance accounted for only 15% of the total observed polymorphism, with the remaining 85% presumably being due to environmental and maternal effects. (Jaffé et al. 2007 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Eciton burchelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATAATTGGAGGATTTGGAAATTTCTTAGTTCCATTAATACTTGGGACTCCAGATATGGCATACCCTCGAATAAACAATATAAGATTTTGACTTCTGCCCCCCTCATTAATATTACTAATTATAGGAAGTTACGTAGGAACAGGGGCAGGGACAGGATGAACAGTATACCCCCCATTAGCTGCTAATACCTACCATAATGGCCCTTCTATTGATTTAACTATTTTTTCCTTACATATCGCAGGGATATCATCAATTTTAGGAGCAATTAATTTTATCTCTACGATTCTTAATATACACCATAAAAAAATTTCTTTAGACAAAATACCTCTATTAGTTTGAGCTATTTTAGTTACTGCTATTCTTCTATTAACCTCCCTCCCAGTTTTAGCAGGAGCTATCACTATACTTTTAACAGATCGTAACTTAAACACCACATTCTTTGATCCTGCTGGAGGAGGAGACCCCATTTTATACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTATATATTCTAATCATCCCAGGATTTGGAATAATTTCACACATTATTACATGTGAAAGTGGAAAAAAAGAAACTTTCGGAGCCATTGGTATAATTTATGCTATTTTATCAATTGGTTTATTAGGATTTATTGTTTGAGCCCATCATATATTTACTGTAGGAATAGATGTTGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eciton burchelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

There is no special status for these ants.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Although E. burchellii has a painful sting and will aggressively protect the bivouac and fellow workers, this species does not frequently come into contact with people.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eciton burchellii can be very beneficial in terms of removing agricultural and household insect pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eciton burchellii

Eciton burchellii is a species of New World army ant in the genus Eciton. This species, one of the most extensively studied ant species, consists of expansive, organized swarm raids that give it the informal name, Eciton army ant [2] This species displays polymorphic caste features, with the soldier ants having much larger heads and mandibles. The colony lives in bivouacs, which are routinely moved as the foraging paths change. Eciton burchellii colonies cycle between stationary and more active nomadic phases. The colony raids are maintained by the use of pheromones, can be 200 metres (660 ft) long, and employ up to 200,000 ants. Colony members have been observed to fill "potholes" in the foraging trail, allowing for the faster and easier movement of captured prey back to the nest. Numerous antbirds parasitize the Eciton burchellii by using their raids as a source of food. In terms of geographical distribution, this species is found in the Amazon jungle and Central America.

Description[edit]

Head view of a soldier with characteristically shaped mandibles

Like most ant species, Eciton burchellii is polymorphic, meaning that features amongst smaller groups within the colony vary in size: a colony contains workers ranging from 3 mm to 12 mm, with each specific "caste" suited to specialized tasks. At least four castes of workers exist in its social system. Like other species of Eciton, Eciton burchellii features a highly modified soldier caste bearing long, pointed, characteristically falcate (sickle-shaped) mandibles.[3] These features are much larger than the "porter caste," the caste directly below that of the major "soldiers."[4] Their long legs and elongated body lend them a spider-like appearance. Color varies from deep golden to dark brown. Workers possess single-faceted compound eyes, double-segmented waists, a well-developed sting, and specialized tarsal hooks on their feet with which they cling to one another to form bridges and bivouacs.

Range[edit]

Overhead view of the Amazon forest

Eciton burchellii ants are found in the tropical jungles of Central and South America, from Mexico to Paraguay.[3] This species dwells in damp and well-shaded areas, avoiding direct sunlight and high elevations.

Taxonomy[edit]

The species was referred to as Eciton burchellii in the original publication. The double i was subsequently deemed unnecessary in the later 1800s by taxonomists, and hence the name became Eciton burchelli. Recent taxonomic rules, however, adhere more strictly to the original form;[5] the name Eciton burchelli is now largely regarded as invalid.[6]

Colony structure[edit]

Size differences between the major workers and minors

Colonies may be quite large, accommodating as many as 100,000 to 2,000,000 adult individuals. Each colony consists of a single queen, a brood of developing young, and many adult workers. The adult workers make up the majority of the population. There are four distinct physical worker castes. The queen usually copulates with 10–20 males, which leads to a colony with a large number of worker patrilines, which are full-sibling families with the same father and mother.[7] When a colony's size reaches a maximum, it can result in a split in the colony, with the old queen heading one resultant swarm and a daughter heading the other.[8]

Caste determination[edit]

The diet and physical upbringing vary among the colony's larvae and is known to determine the physical characteristics of the adult insect. However, caste system determination has also been shown to be influenced by genetic differences. In a study of Eciton burchellii by Jaffé et al. (2007), each individual patriline in 5 colonies was examined. The researchers saw that each patriline had a significantly skewed proclivity for a certain caste, showing that there is considerable evidence for a genetic based caste determination amongst each patriline. These genetic components have been shown not only in Eciton burchellii, but across numerous other ant species—where queens mate with many males, known as polyandry, or where several queens lead a single colony, known as polygyny.[7]

Nesting[edit]

Unlike other Hymenoptera species, ants cannot actively thermoregulate through processes such as evaporation, fanning, or incubation. Therefore, they must rely on the location and architecture of their nests in order to regulate their temperature. For species of ants that migrate frequently, such as the Eciton burchellii, the location of the nest may be the most important thermoregulation tool. However, Eciton burchellii does not construct a physical nest. Instead, it builds a living nest out of the individual colony members (called a bivouac). Thermoregulation within these bivouacs is accomplished through the opening or sealing of airways. The colony members can also manipulate the bivouac to avoid rainfall or direct sunlight. Bivouacs are often found in hollow logs, animal burrows in the ground, and hanging in trees. During each nomadic phase, a new nesting site must be found.[9] On average, it takes a colony six to eight hours to move their bivouac. This occurs primarily during the night.[10]

Foraging practices[edit]

Besides being group predators, members of an Eciton burchellii colony cycle between nomadic and stationary (or "statary") phases. During the twenty-day stationary phase, the pupae and newly laid eggs develop, and the colony goes on raids about every other day. During the fifteen-day nomadic phase, initiated after the eggs hatch and the pupae eclose, the colony goes on raids once every day.[11] Each raid requires approximately one third of the colony, employing up to 200,000 members. The raids can be up to 20 meters in width and 200 meters in length.[12] The raids never occupy the same area twice, so the trail to each new location is always changing.[13] Eciton burchellii colonies avoid locations where they and other colonies have already foraged. This way, they ensure that there are available resources in their foraging area and they avoid any aggressive conspecific encounters.[14] The inbound ants on the trail deliver prey that was captured by the outbound swarming ants.

A trail of foraging Eciton burchellii

Eciton burchellii raids move as a loose swarm over the leaf litter. This allows for smaller prey to take shelter in the crevices of the leaf litter to hide from the oncoming ants. Since numerous insects and other small prey can escape the swarm, the frequent raids of the ants do not desecrate an area's prey reserves. This chronic predation by the colonies will evolutionary favor insects and other prey that possess adaptions to counteract the ants, such as chemical weaponry for defense or those that sexually mature at a smaller size. Since the larger Eciton burchellii ants require more prey for energy than other smaller ant colonies. Therefore, only high biomass patches of prey will provide them with enough food. If the prey density in an area is too small, the colony may be forced to abandon the area and move on.[15]

Eciton burchellii ant colonies use pheromones to maintain a straight foraging pathway. The ants can detect the pheromones with their antennae and can tell the difference in concentration gradients of the pheromones as they move away from the center of the trail. Also, individuals who are outbound turn to avoid the inbound ants more frequently, giving the prey-burdened ants the right-of-way on the trail.[8]

Members of the species have been observed to use their bodies to fill potholes in the pathway between the nest and prey. By filling these obstacles, the ants greatly increase the overall prey-laden traffic back to the nest. Each ant will walk to a hole and measure itself to see if it fits, and if does it will lie across the hole motionless to allow other members of the colony to cross at a higher speed. If it does not fit, it will continue past the hole and allow another ant to check. Ants will also cooperate, with multiple ants forming a plug, if one ant is too small for the hole. Once in place in a hole, the ant(s) can stay there for many hours or until it is dark and the traffic flow has diminished greatly, at which point they will return to the nest.[16] This behavior most likely formed among members of the Eciton burchelli species because of its evolutionary advantage. An increase in trail speed and efficiency leads to a larger daily prey intake by the colony. This raises the colony's collective fitness, allowing for faster reproduction.[13]

Abiotic factors influencing foraging[edit]

Ants, in general, are excellent organisms to study differences in thermal ecology for a number of reasons: they are ectothermic, can be collected easily, their environmental temperatures can be manipulated, and they can be held in captivity for extended periods of time. Eciton burchellii colonies have been found to inhabit areas with no direct sunlight, regulate their bivouac's temperature and airflow, and prefer the closed-canopy forest environment over a fragmented one. Temperature has been found to be the largest contributing factor to whether or not a swarm will cross into the open from a forest edge. When the ants meet an excessively hot patch, they will accelerate their movement, "shuttling" to minimize their exposure to the heat. If the temperature is too hot (>43 degrees Celsius), the ants will abandon that path and look for a new, cooler one. If need be, the ants retreat to the cool, humid bare soil or huddle beneath stones and logs in order to recover from the endurance of high temperatures. This "cooling off" behavior has been observed to last upwards of 30 minutes in some colonies.[17]

Effects of forest clearing[edit]

Fires and Deforestation on the Amazon Frontier, Rondonia, Brazil - 12 August 2007

Tropical forest clearing efforts by humans has detrimented the survival of Eciton burchellii colonies. Since they are above-ground foragers, they are extremely sensitive to forest clearing and habitat destruction.[18] These habitats have more variable ground-level temperatures, exposure to direct sunlight, and increased visibility. Insects, in general, are very vulnerable to the effects of dehydration because of their large surface area to volume ratio. Survival in the exposed conditions brought about by forest clearing is physiologically difficult.[19]

The male Eciton burchellii colony males are extremely affected by a fragmented forest habitat. Even though the males can fly, their dispersal is limited by the predation of nocturnal insectivores that can easily spot their larger bodies in the cleared forest patches. Also, the males seem to have no defenses, which contrasts greatly with the queen's hoards of stinging protectors. With the fragmented forest hindering the males' dispersal, gene flow is reduced among the Eciton burchellii populations.[20]

Higher elevations were found to help alleviate some of the effects of the cleared forests because of the decreased temperature and increased cloud cover.[9] However, the amount of above-ground raids were shown to decrease with an increase in elevation.[19] No Eciton burchellii colonies were found above 23.8 degrees North.[21]

Effects of pheromones and weather[edit]

In general, Eciton burchellii colonies do not follow the compass bearing of the previous day's raids based on pheromone trails. Rainfall has been shown to delay the colony's bivouac movement, sometimes for many days. Heavy rains have been observed to alter the foraging trails and movement patterns.[10]

Alarm behavior[edit]

Social animals need an alarm system to alert others to defend against potential threats or to recruit others to attack prey. In Eciton burchellii, along with other large-colony ant species, the alarm pheromone is produced in mandible glands. This is evolutionary advantageous because the mandible has a large surface area for pheromone's evaporation, the pheromone is released whenever the mandible is opened for biting, and the pheromone is rapidly released when the ant's head is crushed. The specific pheromone used by the Eciton burchellii species is 4-methyl-3-heptanone, which produces an intense, but short-lived, behavioral response by others in the colony.[22]

Antbirds and kleptoparasitism[edit]

There are many species of birds that use the foraging practices of the Eciton burchellii as a source of food. When the ant colony swarms the forest leaf litter, arthropods flee, which are then eaten by the birds, lizards, insects, and even some mammals that attend the raids.[23] However, this source of food can be unpredictable, as the Eciton burchellii colonies' raiding zones are always shifting. It has been shown that the obligate army ant-following antbird Phaenostictus mcleannani uses a network of individuals to locate swarms. Each mated pair of birds holds a single dominance zone that they control, which is part of a larger non-exclusive feeding zone occupied by other mated pairs. Consequently, a single mated pair may track several colonies a day by drawing on the collective knowledge of this larger network. Departure calls can be used as cues to tell the other mate where the location of the raid is.[24] However, it has been shown that there is little opportunity for kin selection to influence group feeding in the antbirds.[25]

Phaenostictus mcleannani, an obligate army ant-following antbird

There are twenty-one species of antbirds who participate in "bivouac checking", which is a specialized behavior allowing for the antbirds to assess the Eciton burchellii colony's foraging activity and current location. This allows the antbirds to reduce the time spent tracking a colony who is not foraging. Through bivouac checking, the antbirds might be remembering the correct location of colonies and returning to them at the appropriate time in the colony's foraging cycle.[26]

The antbirds have a parasitic relationship with Eciton burchellii which inflicts a cost that is proportional to the number of birds in the flock. This imposes a selective pressure on the colonies, as the arthropods collected from these raids represent nearly half of the food consumed by the ants. To counter-act the antbird's kleptoparasitism, large prey items have been observed to be dragged under the leaf litter before being processed. Also, food caches arise along the foraging trail, protected by the colony's soldiers.[23]

Gene flow[edit]

The eusocial Hymenoptera order has a constrained effective population size compared to other orders. This is because each colony has only one or a small number of reproductive queens per colony (known as haplodiploidy) compared to other species that have a greater number of reproductive individuals per unit area. The effective population size of Eciton burchellii is further constrained because of flightless queen ants and colony fission. This causes not only high colony population viscosity, but also restricted maternal gene flow among the colonies.

One inevitable consequence of colony fission is that male sex ratios are favored, which increases the chance for genetic drift among colonies and allows the species to become susceptible to inbreeding practices. However, this was not found to be true in Eciton burchellii populations. Research shows that these populations were capable of maintaining a high rate of gene flow because of the male individuals. High heterozygosity was also found, but no cases of inbreeding.[18] This is accomplished by the males flying at least one kilometer away from their home population to mate with a neighboring colony's queen, thereby minimizing the chances of procreating with a related queen. Also, the monthly migrations of these ant populations help spur enhanced gene flow and eliminate the harmful effects of small breeding population sizes.[27]

Associated species[edit]

A total of 557 different species of animal have been found to associate in some way with E. burchellii, the greatest number known for any individual species. An even larger number of species have been recorded living with the ants, but have not yet been identified. Although some of the associations are likely to be opportunistic, around 300 of the species are thought to be reliant on E. burchellii in some form to survive.[28] The species is commonly attended by "ant following" birds such as antbirds and woodcreepers. Insects and other arthropods attempting to escape from E. burchellii are flushed into the attending flocks, and a number of species have evolved behavior to obtain most of their food by following swarms.[29] Butterflies are then attracted to the droppings of the birds following the ants, which they drink from. Stylogaster and Calodexia flies are abundant around raiding parties, laying eggs (or injecting larvae) on fleeing cockroaches; of the cockroaches that escape the ants, 50–90% are parasitised by the flies. Beetles, which mimic the ants, can be found in the bivouac and in columns.[28]

Many mites live in the bivouacs and ant columns. On Barro Colorado Island, Panama, 5% of the 3156 worker ants examined had mites on them, with the Scutacaridae and Pygmephoridae families being the most abundant. The mites are mainly thought to be harmless to the ants, being symbionts rather than parasites. They most likely were present to exploit the hosts for mechanical transportation or to use their waste deposits.[30]

References[edit]

  1. ^ "Eciton burchellii". Integrated Taxonomic Information System. Retrieved 25 April 2007. 
  2. ^ Moffett, Mark W. (2010). Adventures among Ants a Global Safari with a Cast of Trillions. Berkeley: University of California Press. ISBN 0-520-94541-7. 
  3. ^ a b Cardé, editors, Vincent H. Resh, Ring T. (2003). Encyclopedia of insects. Amsterdam: Academic Press. ISBN 0-08-054605-6. 
  4. ^ Hölldobler, Bert; Wilson, Edward O. (1990). The Ants. Cambridge, Mass.: Belknap Press of Harvard University Press. ISBN 0-674-04075-9. 
  5. ^ Longino, John T. (16 July 2005). "Formicidae: Eciton parvispinum". The Evergreen State College. Retrieved 10 February 2007. 
  6. ^ Agosti, D., and N. F. Johnson. Editors. 2005. Antbase. World Wide Web electronic publication. antbase.org, version (05/2005). Hymenoptera Name Server – Results for the species Eciton Burchelli Antbase Accessed February 2007
  7. ^ a b Jaffé, Rodolfo; Kronauer, Daniel J.C.; Kraus, F. Bernhard; Boomsma, Jacobus J.; Moritz, Robin F.A. (2007). "Worker caste determination in the army ant Eciton burchellii". Biology Letters 3 (5): 513–516. doi:10.1098/rsbl.2007.0257. 
  8. ^ a b West, Nicholas B. Davies, John R. Krebs, Stuart A. An introduction to behavioural ecology (4th ed. ed.). Oxford: Wiley-Blackwell. ISBN 978-1-4051-1416-5. 
  9. ^ a b Soare, T. W.; Tully, S. I.; Willson, S. K.; Kronauer, D. J. C.; O'Donnell, S. (2010). "Choice of nest site protects army ant colonies from environmental extremes in tropical montane forest". Insectes Sociaux 58 (3): 299–308. doi:10.1007/s00040-010-0134-x. 
  10. ^ a b Califano, D.; Chaves-Campos, J. (2010). "Effect of trail pheromones and weather on the moving behaviour of the army ant Eciton burchellii". Insectes Sociaux 58 (3): 309–315. doi:10.1007/s00040-010-0140-z. 
  11. ^ Rettenmeyer, C. W.; Rettenmeyer, M. E.; Joseph, J.; Berghoff, S. M. (2010). "The largest animal association centered on one species: the army ant Eciton burchellii and its more than 300 associates". Insectes Sociaux 58 (3): 281–292. doi:10.1007/s00040-010-0128-8. 
  12. ^ Gadau, edited by Jürgen; Wilson, Jennifer Fewell ; with a foreword by Edward O. (2009). Organization of insect societies : from genome to sociocomplexity. Cambridge, Mass.: Harvard University Press. ISBN 0-674-03125-3. 
  13. ^ a b Powell, S; Franks, N (2007). "How a few help all: living pothole plugs speed prey delivery in the army ant Eciton burchellii". Animal Behaviour 73 (6): 1067–1076. doi:10.1016/j.anbehav.2006.11.005. 
  14. ^ Willson, S. K.; Sharp, R.; Ramler, I. P.; Sen, A. (2011). "Spatial movement optimization in Amazonian Eciton burchellii army ants". Insectes Sociaux 58 (3): 325–334. doi:10.1007/s00040-011-0171-0. 
  15. ^ Kaspari, Michael; Powell, Scott; Lattke, John; O'Donnell, Sean (2011). "Predation and patchiness in the tropical litter: do swarm-raiding army ants skim the cream or drain the bottle?". Journal of Animal Ecology 80 (4): 818–823. doi:10.1111/j.1365-2656.2011.01826.x. 
  16. ^ "'Living Plugs' Smooth Ant Journey". BBC News. 26 May 2007. Retrieved 27 May 2007. 
  17. ^ Meisel, JE (2006). "Thermal ecology of the neotropical army ant Eciton burchellii.". Ecological applications : a publication of the Ecological Society of America 16 (3): 913–22. doi:10.1890/1051-0761(2006)016[0913:teotna]2.0.co;2. PMID 16826991. 
  18. ^ a b Berghoff, S. M.; Kronauer, D. J. C.; Edwards, K. J.; Franks, N. R. (2008). "Dispersal and population structure of a New World predator, the army ant". Journal of Evolutionary Biology 21 (4): 1125–1132. doi:10.1111/j.1420-9101.2008.01531.x. 
  19. ^ a b Kumar, Anjali; O'Donnell, Sean (2009). "Elevation and forest clearing effects on foraging differ between surface – and subterranean – foraging army ants (Formicidae: Ecitoninae)". Journal of Animal Ecology 78 (1): 91–97. doi:10.1111/j.1365-2656.2008.01483.x. 
  20. ^ Pérez-Espona, S.; McLeod, J. E.; Franks, N. R. (2012). "Landscape genetics of a top neotropical predator". Molecular Ecology 21 (24): 5969–5985. doi:10.1111/mec.12088. 
  21. ^ O'Donnell, S.; Kaspari, M.; Kumar, A.; Lattke, J.; Powell, S. (2010). "Elevational and geographic variation in army ant swarm raid rates". Insectes Sociaux 58 (3): 293–298. doi:10.1007/s00040-010-0129-7. 
  22. ^ Lalor, Pablo F.; Hughes, William O. H. (2011). "Alarm behaviour in Eciton army ants". Physiological Entomology 36 (1): 1–7. doi:10.1111/j.1365-3032.2010.00749.x. 
  23. ^ a b Wrege, Peter H.; Martin Wikelski; James T. Mandel; Thomas Rassweiler; Ian D. Couzin (2005). "Antbirds parasitizing foraging army ants". Ecology 86 (3): 555–559. doi:10.1890/04-1133. 
  24. ^ Chaves-Campos, Johel (2010). "Ant colony tracking in the obligate army ant-following antbird Phaenostictus mcleannani". Journal of Ornithology 152 (2): 497–504. doi:10.1007/s10336-010-0607-8. 
  25. ^ Chaves-Campos, Johel; DeWoody, J. Andrew (2008). "The spatial distribution of avian relatives: do obligate army-ant-following birds roost and feed near family members?". Molecular Ecology 17 (12): 2963–2974. doi:10.1111/j.1365-294X.2008.03811.x. 
  26. ^ Logan, C. J.; O'Donnell, S.; Clayton, N. S. (2011). "A case of mental time travel in ant-following birds?". Behavioral Ecology 22 (6): 1149–1153. doi:10.1093/beheco/arr104. 
  27. ^ Jaffé, Rodolfo; Moritz, Robin F. A.; Kraus, F. Bernhard (2009). "Gene flow is maintained by polyandry and male dispersal in the army ant Eciton burchellii". Population Ecology 51 (2): 227–236. doi:10.1007/s10144-008-0133-1. 
  28. ^ a b Rettenmeyer, C. W.; Rettenmeyer, M. E.; Joseph, J.; Berghoff, S. M. (2010). "The largest animal association centered on one species: The army ant Eciton burchellii and its more than 300 associates". Insectes Sociaux 58 (3): 281. doi:10.1007/s00040-010-0128-8.  edit
  29. ^ Willis, E. O.; Oniki, Y. (1978). "Birds and Army Ants". Annual Review of Ecology and Systematics 9: 243–263. doi:10.1146/annurev.es.09.110178.001331. JSTOR 2096750.  edit
  30. ^ Berghoff, S. M.; Wurst, E.; Ebermann, E.; Sendova-Franks, A. A. B.; Rettenmeyer, C. W.; Franks, N. R. (2009). "Symbionts of societies that fission: Mites as guests or parasites of army ants". Ecological Entomology 34 (6): 684. doi:10.1111/j.1365-2311.2009.01125.x.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!