Overview

Brief Summary

The yellow crazy ant Anoplolepis gracilipes, also known as the long-legged ant or the Maldive ant, is one of the five species of “tramp ant” species, known for invasive behavior and devastating ecological effects. The Invasive Species Specialist Group (ISSG) considers it among the top 100 of the world’s worst invaders. Its native origin is not certain, but thought to be either in West Africa or Asia; it has been introduced across the world’s tropical and sub-tropical areas, including many Pacific Islands, Northern Australia, the Carribean, and some Indian Ocean islands. Perhaps its most notorious devastation is on Christmas Island, where it caused an “Invasional meltdown” (O’Dowd et al 2003), decimating red land crab (Gecarcoidea natalis) populations, a keystone species whose demise has significantly altered the islands ecology and negatively effected endemic species. There is grave concern about spread of A. gracilipes in northern and north-eastern Australia, where a huge eradication campaign is underway. Several features of the yellow crazy ant contribute to its destructive ecological impacts:

• It has a generalist diet and is a competitive forager, making huge colonies (in some cases “supercolonies” containing multiple queens) with enormous nutritional needs. It preys on or interferes with the survival of a large variety of rainforest arthropods, reptiles, birds and mammals.

• It forms tight mutualisms with sap-sucking scale insects, boosting scale populations and consequentially boosting sooty mold growth, both which negatively impact rainforest health.

• It colonizes agricultural areas making it easily carried to new regions by humans in boats, road vehicles, and farm equipment.



• It has a very rapid colony spread rate, in one instance on Christmas Island colony expansion was measured at 3 m/day.

The yellow crazy ant is so called for its erratic, fast movements, especially when disturbed. For an invasive ant, this ant is large in size. It is yellow-orange in color and has long legs and antennae.

(O'Dowd 2003, 2009; PiaKey; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Taxonomic History

Formica gracilipes Smith, 1857a PDF: 55 (w.) SINGAPORE. AntCat AntWiki

Taxonomic history

Mayr, 1867a PDF: 73 (q.).
Senior synonym of Anoplolepis trifasciata: Mayr, 1867a PDF: 73.
Junior synonym of Anoplolepis longipes Jerdon: Emery, 1887a PDF: 247.
hence first available replacement name for Formica longipes Jerdon, 1851 PDF: 122, designated by Bolton, 1995b: 67.
[Junior primary homonym of Formice longipes Latreille, 1802a: 233 (now in Pheidole).].
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Eli Sarnat

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

According to the IUCN/SSC Invasive Species Specialist Group A. gracilipes is among the 100 most pervasive and destructive invasive species in the world (Lowe, et al., 2000), and is most notably implicated in the 'ecological meltdown' of Christmas Island (O'Dowd, et al., 2001;2003). Introduced populations of Anoplolepis gracilipes can exhibit unicolonial behavior by forming multiple, populous high-density supercolonies. On Christmas Island, A. gracilipes was recorded to achieve the highest density of foraging ants ever recorded (Abbott, 2005). Colonies are polydomous and polygynous and disperse by budding. Nests occasionally hosting hundreds of queens and thousands of workers. The species has generalized foraging and nesting habits, and often achieve high densities in agricultural landscapes. Part of the species invasion success has been attributed to its strong mutualisms with nectar and honeydew producing insects like scales and aphids.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Eli Sarnat

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Anoplolepis gracilipes is a large, slender, brownish yellow species most easily identified by it extraordinarily long limbs. The antennal scapes are greater than 1.5x the head length, and the full antennae are longer than the entire body from the apical tip of the mandibles to the distal tip of the gaster. The head is ovoid and distinctly longer than broad. The antennae are 11-segmented and the mandibles have 8 teeth. The eyes are large and bulge well beyond the outline of the head in full face view. The mesosoma is long and slender. The pronotum in particular, is extended anteriorly giving the appearance of a long 'neck'. The mesonotal dorsum slopes downward towards the propodeum. The propodeum is gently rounded and convex, with approximately equal posterior and dorsal faces. The petiolar node is thick and upright with a longer posterior face than anterior face. The gaster is armed with an acidopore and tends to be darker than the rest of the body.    

Among introduced ants, Anoplolepis gracilipes might be mistaken for Paratrechina longicornis (the Black Crazy Ant), which also has very long antennae and legs and eyes that break the outline of the head in full face view. In addition to the difference in color, A. gracilipes can also be distinguished by the lack of erect hairs on the mesosoma, petiole and gaster. Anoplolepis gracilipes can also be mistaken for species of Leptomyrmex and Oecophylla because of their similar sizes and very long limbs. Anoplolepis can be distinguished from Leptomyrmex by the presence of an acidopore. Anoplolepis can be distinguished from Oecophylla by the more compact petiole.

Diagnosis among introduced and commonly intercepted ants.
Antenna 11-segmented. Antennal club indistinct. Antennal scape length greater than 1.5x head length. Eyes large; break outline of head. Antennal sockets and posterior clypeal margin separated by a distance equal to or greater than the minimum width of antennal  scape. Dorsum of mesosoma with metanotal impression, but never with a deep and broad concavity. Metapleuron with a distinct gland orifice. Propodeum and petiolar node both lacking a pair of short teeth. Propodeum lacking posteriorly projecting protrusion. Propodeal declivity less than twice length of propodeal dorsum. Waist 1-segmented. Petiole upright and not appearing flattened. Gaster armed with acidopore. Distinct constriction not visible between abdominal segments 3+4. Hairs not long thick and produced in pairs. Yellowish-brown to reddish-brown. Monomorphic.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Eli Sarnat

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anoplolepis gracilipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAGTTTGGGCCGGAATAATTGGATCTTCTATAAGAATAATTATTCGTTTAGAACTAGGGTCATCTAATGCACTAATTAATAAT---GATCAAATTTATAATTCAATAGTTACTAGGCATGCATTTATTATAATTTTCTTTATAGTTATGCCATTTATAATTGGAGGGTTCGGAAATTTTCTTGTTCCTTTAATACTTGGTTCTCCAGATATAGCCTATCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCCTCACTCTCTTTACTTTTATTAAGTAATTTTATTAATGATGGAACTGGAACTGGNTGAACAGTCTACCCTCCCTTAGCCTCTAATATATTTCATAATGGCCCTTCAGTAGACCTAACAATTTTTTCTCTTCATATTGCCGGAATATCTTCTATTCTAGGGGCTATTAATTTTATTTCTACAATCTTAAACATACATCACAAATTTCTTTCAATTGATAAAATACCCCTCTTAGTTTGATCAATTTTCATTACAGCAATTCTCCTCCTTCTGTCTCTCCCAGTTTTAGCCGGAGCAATNACAATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCATCAGGNGGGGGCGATCCCATTCTTTATCAACATTTATTTTGGTTTTTTGGTCACCCCGAAGTTTATATTCTTATTCTTCCAGGATTTGGGCTAATTTCCCACATTATCATAAATGAAAGAGGAAAAAAAGAAACTTTTGGTGCTTTAGGAATAATCTATGCNCTAATAGCAATTGGATTCTTAGGCTTTATTGTTTGGGCTCATCACATATTTACTATTGGATTAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anoplolepis gracilipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow crazy ant

There is also a different genus of ant called "crazy ants", Paratrechina.

The yellow crazy ant (Anoplolepis gracilipes) is a species of ant, introduced accidentally to northern Australia and Christmas Island in the Indian Ocean, that has wreaked ecological damage in both locations. It is colloquially called "crazy" because of its erratic movements when disturbed, with its long legs and antennae making it one of the largest invasive ant species in the world.[2][1]

Along with the red imported fire ant (Solenopsis invicta), the big-headed ant (Pheidole megacephala), the little fire ant (Wasmannia auropunctata), and the Argentine ant (Linepithema humile), the yellow crazy ant is one of the five species of tramp ants, known for invasive behavior and devastating ecological effects.[1] Also known as the long-legged or Maldive ant, it is listed among the 100 most devastating invaders of the world. It has invaded ecosystems from Hawaii to Seychelles, and formed supercolonies on Christmas Island in the Indian Ocean.

Contents

Physiology

Anoplolepis gracilipes, known most commonly as the yellow crazy ant (YCA), is a relatively large, yellow to orange colored ant with long legs, large eyes and extremely long antennal scapes.

Although A. gracilipes is the only invasive species in the genus Anoplolepis, there are several other genera that it can be mistaken for. Both Leptomyrmex and Oecophylla, can be confused with Anoplolepis because of their similar sizes and very long limbs. Anoplolepis can be distinguished from Leptomyrmex by the presence of an acidopore. Anoplolepis can be distinguished from Oecophylla by the more compact petiole. Although both of these genera occur in the Pacific, neither contain any invasive species and are not treated in the PIAkey. Images of all three genera can be compared at Antweb.

Several species of invasive ants belonging to the genera Camponotus and Paratrechina can appear similar to A. gracilipes, and characters used to distinguish them are illustrated in the PIAkey and the comparison charts. Although several invasive species of Pheidole can also be slender bodied with long legs and long antennal scapes, they can be separated from A. gracilipes by their two-segmented waist. Considered by the IUCN/SSC Invasive Species Specialist Group (ISSG) to be among the 100 worst invasive species in the world, A. gracilipes is widespread across the tropics, and populations are especially dense in the Pacific region. The species is most infamous for causing the "ecological meltdown" of Christmas Island (O'Dowd et al. 2003). Although widespread across the Pacific, Anoplolepis gracilipes can cause significant damage to native biological diversity, and strong quarantine measures are encouraged to keep it from spreading to new localities.

Geographical range and dispersal

A dead lizard being dragged away by Yellow Crazy Ants in Kerala, India

The yellow crazy ant’s natural habitat is not known, but it has been speculated that the species originated in West Africa. It has been introduced into a wide range of tropical and subtropical environments including Caribbean islands, some Indian Ocean islands (Seychelles, Madagascar, Mauritius, Reunion, the Cocos Islands and the Christmas Islands) and some Pacific islands (New Caledonia, Hawaii, French Polynesia, Okinawa, Vanuatu, Micronesia and the Galapagos archipelago)[3][4] The species has been known to occupy agricultural systems such as cinnamon, citrus, coffee and coconut plantations. Because the ant has generalized nesting habits, they are able to disperse via trucks, boats and other forms of human transport.[1]

Crazy ant colonies naturally disperse through “budding”, i.e. when mated queens and workers leave the nest to establish a new one, and only rarely through flight via female winged reproductive forms. Generally, colonies that disperse through “budding” have a lower rate of dispersal and need human intervention to reach distant areas. It has been recorded that A. gracilipes moves at about 37–400 meters a year in Seychelles.[3] A survey on Christmas Island, however, yielded an average spreading speed of three meters a day, the equivalent of one kilometre a year.[5]

Diet

A. gracilipes has been described as a “scavenging predator” and has a broad diet, a characteristic of many invasive species. It consumes a wide variety of foods including grains, seeds, arthropods, and decaying matter, including vertebrate corpses. They have been reported to attack and dismember invertebrates such as small isopods, myriapods, molluscs, arachnids, land crabs, earthworms and insects.[5]

Like all ants, A. gracilipes requires a protein-rich food source for the queen to lay eggs and carbohydrates as energy for the workers. They get their carbohydrates from plant nectar and honeydew producing insects, especially scale insects, aphids, and other Sternorrhyncha. Studies indicate that crazy ants rely so much on the scale insects that scarcity of them can actually limit ant population growth.[3]

Mutualism

Mutualistic associations with several species of honeydew-producing scale insects allows the ants to obtain energy-rich carbohydrates. The ants protect the insects by ‘nannying’ the mobile crawler stages and protecting them against their natural enemies.[6] Recent experiments have shown that this connection is so strong that, in environments where A. gracilipes was removed, the density of scale insects dropped by 67% within 11 weeks, and to zero after 12 months.[7]

Impact on Christmas Island

The crazy ant has a significant destructive impact on the island's ecosystem, killing and displacing crabs on the forest floor. The super-colonies also devastate crab numbers migrating to the coast. This has seen a rapid depletion of land crab numbers which are vital to Christmas Island's biodiversity. They are a keystone species in the forest ecology by digging burrows, turning over the soil, and fertilising it with their droppings. Seedlings that were previously eaten by crabs started to grow, and as a result, changed the structure of the forest. Weeds also spread into the rainforest because there are no crabs to control them. One of the most noticeable changes in the forest is the increased numbers of stinging tree Dendrocnide peltata, which now flourish along many of the walking tracks and other areas that people frequently visit around the island. Robber crabs, red crabs, and blue crabs are completely wiped out from infested areas. Populations of other ground and canopy dwelling animals, such as reptiles and other leaf litter fauna have also decreased. During crab migrations many crabs move through areas infested with ants and are killed. Studies show the ant has displaced an estimated 15-20 million crabs by occupying their burrows, killing and eating resident crabs, and using their burrows as nest sites. Although crazy ants do not bite or sting, they spray formic acid as a defence mechanism and to subdue their prey. In areas of high ant density, the movement of a land crab disturbs the ants and as a result the ants instinctively spray formic acid as a form of defence. The high levels of formic acid at ground level eventually overwhelms the crabs, and they are usually blinded then eventually killed. As the dead crabs decay, a bonus source of protein becomes available to the ants. Ants in general require two main types of food: carbohydrate to provide energy for the foraging workers, and protein to enable the queens to produce eggs. Crazy ants get much of their food requirements from scale insects. Scale insects are serious plant pests that feed on sap of trees and release honeydew, a sugary liquid. Ants eat honeydew, and in return protect the scale from their enemies and spread them among trees. This relationship is called a mutualism. The honeydew not eaten by ants drips onto the trees and encourages the growth of sooty mould over the leaves and stems giving the plants an ugly, black appearance, and reducing the health and vigour of the plant. In summary, crazy ants kill the fauna, but encourage scale insects. Increased densities of scale insects causes forests trees to dieback, creating light gaps in the forest canopy. Light gaps and removal of crabs encourages seedling growth and weed invasion into the forest.

Other threats

Over recent decades yellow crazy ants have emerged as one of the worst 100 invasive species in the world. Communities from Hawaii to Madagascar are trying to eradicate them, but no one has found a permanent solution yet. Christmas Island is a focal point for this international control effort. It is the only place where the ants are known to have formed supercolonies - groups with up to 300 queens that can contain millions of ants (although new reports on Johnston Atoll Pacific Remote Island Marine National Monument from the 'Crazy and Strike Team' (CAST) from the USFWS have begun to show the YCA supercolony status as colonies are reaching >300 queens in population[8]). These supercolonies spread further and cause more damage than single colonies, and they pose the single greatest known threat to the island's biodiversity. Staff from Christmas Island National Park have worked constantly in recent years to keep ant numbers in check. With help from the Christmas Island Crazy Ant Scientific Advisory Panel and support from the Australian Government they are holding ground.

Measures

To reduce the impacts of crazy ants on red crabs and the island's ecosystems the national park carried out a major aerial baiting program in 2009, to follow up the first aerial baiting conducted in 2002. The first step was conducting an extensive island-wide survey to work out exactly where the supercolonies were. For several months staff traversed the entire island surveying over 900 sites. The result was a map of crazy ant supercolonies and red crab burrow densities together with other biodiversity data. In September 2009, a helicopter was used to precisely bait crazy ant supercolonies, which covered 784 hectares of the island. A very low concentration of Fipronil bait (a tenth of 1 per cent) was used to control the ants. Monthly monitoring of these baited supercolony sites shows that crazy ant densities were reduced by 99 per cent. Park staff placed a high emphasis on minimising any non-target impacts of baiting. Food lures were dropped from a helicopter to attract robber crabs away from areas that were about to be baited. This technique, combined with the low concentration Fipronil bait, proved to be highly successful with extremely low numbers of robber crabs and no red crabs known to be killed by the baiting.

References

  1. ^ a b c d "Global Invasive Species Database: Anoplolepis gracilipes". 
  2. ^ "Pests and Diseases Image Library: Anoplolepis gracilipes". 
  3. ^ a b c Holoway D.A., David A.; Lach, Lori; Suarez, Andrew V.; Tsutsui, Neil D.; Case, Ted J. (2002). "The causes and consequences of ant invasions". Annual Review of Ecology and Systematics 33: 181–233. doi:10.1146/annurev.ecolsys.33.010802.150444. 
  4. ^ McGlynn T.P., Terrence P. (1999). "The Worldwide Transfer of Ants: Geographical Distribution and Ecological Invasions". Journal of Biogeography 26 (3): 535–548. doi:10.1046/j.1365-2699.1999.00310.x. 
  5. ^ a b O’Dowd D.J. (1999). "Crazy Ant Attack". Wingspan 9 (2): 7. 
  6. ^ Ness et al., J.H.; Bronstein, J.L. (2004). "The Effects of Invasive Ants on Prospective ant Mutualists". Biological Invasions 6 (4): 445–461. doi:10.1023/B:BINV.0000041556.88920.dd. 
  7. ^ Abbott et al., Kirsti L.; Green, Peter T. (2007). "Collapse of an ant-scale mutualism in a rainforest on Christmas Island". Oikos 116 (7): 1238–1246. doi:10.1111/j.0030-1299.2007.15629.x. 
  8. ^ http://www.conservationregistry.org/assets/0000/9006/Environment_Hawaii_Newsletter_Ant.pdf
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!