Overview

Brief Summary

Ecology

Ecology: benthic, inshore. General distribution: tropical, west Pacific, depth range to 20 m. (Rowe & Gates, 1995). Also distributed in Australia (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Holotype for Acanthaster brevispinus Fisher, 1917
Catalog Number: USNM 37027
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1908
Locality: Sulu Archipelago, Tapul Group, Lapac Island, East Of, Sulu, Philippines, North Pacific Ocean
Depth (m): 18 to 18
Vessel: Albatross R/V
  • Holotype: Fisher. 1917. Proc. Biol. Soc. Wash. 30: 92.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 18 - 75.4
  Temperature range (°C): 23.278 - 28.315
  Nitrate (umol/L): 0.395 - 2.380
  Salinity (PPS): 34.080 - 35.493
  Oxygen (ml/l): 4.230 - 4.793
  Phosphate (umol/l): 0.043 - 0.308
  Silicate (umol/l): 0.777 - 1.453

Graphical representation

Depth range (m): 18 - 75.4

Temperature range (°C): 23.278 - 28.315

Nitrate (umol/L): 0.395 - 2.380

Salinity (PPS): 34.080 - 35.493

Oxygen (ml/l): 4.230 - 4.793

Phosphate (umol/l): 0.043 - 0.308

Silicate (umol/l): 0.777 - 1.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthaster brevispinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGGCGATGATTTTTTTCAACAAAACACAAGGACATTGGAACACTATATCTAATATTCGGAGCCTGGGCAGGAATGGTTGGAACTGCCATGAGAGTAATAATACGAACAGAACTGGCCCAACCAGGATCACTCCTCCAAGAC---GACCAAATATACAACGTAATAGTTACGGCCCACGCCCTAGTAATGATATTCTTCATGGTAATGCCAATCATGATTGGCGGATTTGGCAACTGACTAATCCCCTTAATGATCGGAGCACCCGATATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGGCTAGTCCCCCCCTCCTTCCTGCTACTCTTAGCATCAGCCGGAGTTGAAAGAGGTGCTGGAACCGGATGAACCATCTACCCTCCACTGTCTAGTGGCCTAGCCCACGCTGGGGGGTCAGTAGACCTTGCAATATTTTCCCTCCACCTTGCAGGAGCATCCTCTATCCTAGCCTCCATAAAATTCATCACTACTGTCATTAACATGCGAACCCCTGGTATCTCATTCGACCGCCTACCATTATTTGTCTGATCTGTATTCGTGACAGCATTCTTACTCCTCCTTTCCCTTCCCGTTCTAGCTGGAGCCATAACGATGCTCCTCACTGATCGAAAAGTGAACACAACCTTCTTCGACCCAGCAGGAGGAGGGGACCCTATTCTATTCCAACACCTTTTCTGGTTCTTCGGACACCCTGAAGTCTACATTCTCATACTTCCAGGATTTGGAATGATATCCCATGTAATTGCTCACTACTCAGGTAAGAGAGAACCTTTTGGTTACCTAGGTATGGTCTACGCTATAGTATCTATTGGAATACTAGGGTTCCTGGTGTGAGCCCACCACATGTTTACAGTTGGTATGGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthaster brevispinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthaster brevispinus

Acanthaster brevispinus or the short-spined crown-of-thorns starfish is one of the two members of the Acanthaster genus of starfish, along with the much more well-known Acanthaster planci or crown-of-thorns starfish.

Contents

Physical description

The body form of Acanthaster brevispinus is fundamentally the same as that of a typical starfish or seastar. Like Acanthaster planci, however, its distinctive traits include being disc-shaped, multi-armed with multiple madreporites (see Starfish), flexible, prehensile and densely spined, and having a large ratio of stomach surface to body mass. Its prehensile ability arises from the two rows of numerous tube feet that extend to the tip of each arm. In being multi-armed it has lost the five-fold symmetry (pentamerism) typical of starfish although it begins with this symmetry in its life cycle.

A. brevispinus is readily distinguished from A. planci in that it has:

  • dense blunt spines over the upper (aboral) surface of its disc
  • short pedicillaria on its aboral surface
  • purple-brown aboral surface becoming more intense along the arms
  • blotches of darker colour around the perimeter of the disc and along the arms, including a large blotch at the base of each arm
  • pale marks on the disc between each arm
  • spines along it arms which are not as long as in A. planci

Taxonomy

A. brevispinus holotype, oral surface

Acanthaster brevispinus was described by W.K. Fisher from a specimen collected at 18 m depth off Sirun Is., Sulu Archipelago, Philippines, 18 m.[1] The holotype is lodged in the U.S. National Museum, Washington, registration number USNM37027. Fisher described it as a new subspecies A. brevispinus brevispinus, which was unnecessary as it was a new species.

Madsen (1955) reviewed the taxonomy of the genus Acanthaster and concluded that there were three species: the Indo-Pacific A. planci(L.); the short-armed, blunt spined eastern Pacific A. ellisii (Gray) and A. brevispinus Fisher.[2] Madsen suspected that A. brevispinus was part of the variability of A. planci over its wide geographical range. See Acanthaster planci for a treatment of the status of Acanthaster ellisii.

Subsequently, A. brevispinus was reported from the Great Barrier Reef region.[3][4][5][6]

Jangoux and Aziz reported a specimen from the Seyshelles.[7] They considered it sufficiently different to the holotype in some features to describe it as A. brevispinus seyshellesensis nov. subsp.

Geographic distribution, Habitat and Food

Acanthaster brevispinus has been reported from the Philippines (western Pacific Ocean, south-east Asia), Great Barrier Reef (western Pacific Ocean, eastern Australia) and the Seychelles (western Indian Ocean). These are widely-separated locations and it is not possible to accurately describe the geographic distribution of this species, except to sey that it is broad and that it is sympatric with a significant part of the distribution of A. planci. The locations are also within the tropics or subtropics. The highest latitatude from which it has been collected is at the southern part of the Great Barrier Reef(see the Endean and Bennett references). Obviously, there is still coral reef in this vicinity.

All specimens have been collected from at least moderated depth: 18 m (Fisher), 20+ m (Lucas, Nash and Nishida) and 63 m in the Seychelles (Jangoux and Aziz). A. brevispinus wasn't abundant at any of these locaities, judging from the one or few collected, although it is possible that this is an artifact of the ways that they were collected from depth. It appears that all were collect from soft substrates, not hard substrates like coral reef. There is minimal data on the benthic communities of which they are a part.

The Great Barrier Reef specimens that were used by Lucas and Jones came as an incidental by-catch of trawling inshore of the Great Barrier Reef off Townsville in the Central zone of the Reef. They came from a sandy substrate. Two invertebrate were also collected in the trawls: the scallops Amusium balloti and Amusium pleuronectes. Scallops would seem to be difficult prey for slow-moving starfish with their rapid swmimming by 'flapping' their valves and with 'eyes' on their mantle edges. In the laboratory, however, the starfish were able to trap unrestrained scallops. They slowly approached the scallop over its hinge, where they were less visible, so that when the scallop detected the starfish its movements were towards and under the starfish's disk where it could be trapped. Only a proportion of attempts at trapping scallops were successful.

After trapping a scallop the starfish fed and digested the scallop while adopting a characteristic arched posture.[8] A. brevispinus was fed commercial scallop meat as its standard laboratory diet and they adopted the same arched feeding posture during feeding. This suggests that scallops are a significant component of their normal diet, such that even the 'taste' of scallop meat triggers the distinct feeding behaviour. A. brevispinus, however, is quite omnivorous, at least according to observations in the laboratory.[9]

Distinctly hungry individuals of A. planci will feed on a range of animal tissue, including scallop meat, in the laboratory. However, they never arch during this feeding (Lucas and Jones, ref.).

Experimental Hybridization with A. Planci

In 1973 Lucas and Jones conducted a hybridization experiment to investigate genetic relatedness between A. brevispinus and A. planci. Specimens of A. brevispinus were obtained by trawling in December of that year, near the approximate time of annual gamete release by A. planci in Great Barrier Reef waters.[10] The A brevispinus had ripe gonads and it was possible to dissect out gonad tissue without killing the starfish and thus obtain mature eggs (oocytes) and sperm. Mature eggs and sperm were also obtained from A. planci. Eggs were fertilized in vitro with sperm. Four groups of larvae were reared resulting from the fertilizations, i.e. larvae of each species and reciprocal crosses. The A. planci eggs by A. brevispinus sperm will be referred to subsequently as A. planci hybrids and correspondingly A. brevispinus hybrids, according to the source of eggs.

There were high fertilization rates for all gamete combinations and thus no evident of gamete incompatibility between the species. The larvae were reared according to the methods employed for A. planci[11] and developed through the typical larval stages of bipinaria and brachiolaria (see Life-cycle of Acanthaster planci). Numbers of late stage larvae were 10-29% of the original numbers of eggs, except for the A. brespinus batch in which there was only a few normal late brachiolaria. The subsequent development of the A planci batch and reciprocal hybrid batches followed the typical pattern of A. planci. There was settlement and metamorphosis into a five-armed starfish, 0.4–1  mm diameter. They fed on encrusting algae. Many failed to develop normally and six weeks after metamorphosis there were 60 A. planci, 30 A. planci hybrids, six A. brevispinus hybrids and no A. brevispinus. It was impossible to distinguish the hybrids from A. planci during the early months of development, but when the hybrids were 200 mm diameter they were conspicuously different to this species. Hybrids showed intermediate features between the parent species. Spines were the immediately obvious feature, being intermediate in length between the species. In other features that distinguish A. planci and A. brevispinus (see Physical description), the hybrids were intermediate. The hybrids were variable, but there were no consistent differences between the two kinds of hybrids. Juvenile A. planci tend to have a 'bull's-eye' pattern on their aboral disk and this persists in some adults. One of three adult A. brevispinus hybrids showed this pattern (see photograph). None of the twelve adult A. planci hybrids showed it. None of the hybrids showed the pale marks between the bases of the arms that are characteristic of A. brevispinus.

Of particular interest was the inheritance of scallop-trapping behaviour by both kinds of hybrids, although they did not arch their body as much as A. brevispinus during feeding on scallops, possibly because their arms were thicker than those of A. brevispinus and less appropriate for this posture (Lucas and Jones, ref).

The hybrid starfish reached sexual maturity at the end of their second year (summer spawning season in the field). Further crosses were undertaken with these F1 generation hybrids to determine the extent to which there could be gene flow through interbreeding between the two species.[12] Sexually mature male and female F1 A. brevispinus hybrids were not available and the crosses and reciprocal crosses were made with male and female F1 A. planci hybrids.

Although high fertilization rates were achieved again, without evidence of gamete incompatibility, there was poor survival through early development and some morphological abnormalities that had not been seen previously in batches of juvenile starfish .[13] It was concluded that introgression of genetic material broke down at this stage.

References

  1. ^ Fisher, W.K. (1917). "New starfishes from the Philippines and Celebes". Proceedings of the Biological Society of Washington 30: 89–93. 
  2. ^ Madsen, F.J. (1955). "A note on the seastar genus Acanthaster". Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening 117: 179–192. 
  3. ^ Endean, R (1961). "Queensland faunistic records. Part VII. Additional records of Echinodermata (excluding Crinordea)". Papers of the Zoology Department, University of Queensland 1: 289–298. 
  4. ^ Bennett, I (1958). "Echinoderms from the Capricornia Group. Queensland. 23 degress 27 minutes S.". Proceeding of the Linnean Society of New South Wales 83: 375–376. 
  5. ^ Lucas, JS; Jones MM (1976). "Hybrid crown-of-thorns starfish (Acanthaster planci X A. brevispinus) reared to maturity in the laboratory". Nature 263 (September 30): 409–412. 
  6. ^ Lucas, J.S., W.J. Nash and M. Nishida. (1985). "Aspects of the evolution of Acanthaster planci (L.) (Echinodermata; Asteroidea)". Proceedings of the 5th. International Coral Reef Congress 5: 327–332. 
  7. ^ Jangoux, M 1 ; Aziz, A (1984). "Les asterides (echinodermes) du centre-ouest del l'Ocean Indien (Seychelles, Maldives et Iles Mineures)". Bulletin du Museum national d'Histoire naturelle (France). 4e serie. Section A. Zoologie, biologie, et ecologie animales. Paris 6 (4): 857–884. 
  8. ^ Lucas JS and Jones MM. ".Hybrid crown-of-thorns starfish (Acanthaster planci x A. brevispinus) reared to maturity in the laboratory". Nature 263: 409–412. 
  9. ^ Lucas, J.S., W.J. Nash and M. Nishida. (1985). "Aspects of the evolution of Acanthaster planci (L.) (Echinodermata; Asteroidea).5: 327- 332.". Proceedings of the 5th. International Coral Reef Congress 5: 327–332. 
  10. ^ Lucas J.S. (1973). "Reproductive and larval biology of Acanthaster planci (L.) in Great Barrier Reef waters.". Micronesica 9: 197–204. 
  11. ^ Lucas J.S. (1973). "Reproductive and larval biology of Acanthaster planci (L.) in Great Barrier Reef waters.". Micronesica 9: 197–204. 
  12. ^ Lucas, J.S., W.J. Nash and M. Nishida (1985). "Aspects of the evolution of Acanthaster planci (L.) (Echinodermata; Asteroidea).". Proceedings of the 5th. International Coral Reef Congress 5: 327–332. 
  13. ^ Lucas, J.S., W.J. Nash and M. Nishida (1985). "Aspects of the evolution of Acanthaster planci (L.) (Echinodermata; Asteroidea).". Proceedings of the 5th. International Coral Reef Congress 5: 327–332. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!