Molecular Biology and Genetics

Molecular Biology

Barcode data: Tholera cespitis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATATTTTATTTTCGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGTGCCGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTCCTACCCCCCTCATTAACTTTATTAATTTCAAGTAGAATTGTAGAAACTGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCACAGAGGAAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGACTAAATAACTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTACTCTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tholera cespitis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tholera cespitis

The Hedge Rustic (Tholera cespitis) is a species of moth of the Noctuidae family. It is found through the Palearctic from Europe to the Altai Mountains, Siberia.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 34–40 mm. Forewing dark earth brown; lines indistinct; inner and outer black with paler edges; submarginal pale, with black wedge-shaped spots before it; claviform stigma obscure, black-edged; orbicular roundish, brown with pale ring; reniform large with paler outline, especially externally; hindwing whitish, the veins dark; termen diffusely brownish; in male white, with termen narrowly grey; — ab. ferruginea Hofm. (Carinthia and the Tyrol) is much paler with a reddish yellow tint.[1]

Biology[edit]

There is one generation per year with adults on wing from the end of July to September.

Larva shining dark brown; thoracic and anal plates black; head brown; dorsal and subdorsal lines narrow, pale yellow; lateral stripe broader; spiracles black. The larvae feed on various grasses, including Nodus stricta, Calamagrostis purpurea, Festuca and Deschampsia species. .[2] Larvae can be found from March to July. The species overwinters as an egg.

Subspecies[edit]

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!