Molecular Biology and Genetics

Molecular Biology

Barcode data: Tholera cespitis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATATTTTATTTTCGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGTGCCGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTCCTACCCCCCTCATTAACTTTATTAATTTCAAGTAGAATTGTAGAAACTGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCACAGAGGAAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGACTAAATAACTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTACTCTTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tholera cespitis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tholera cespitis

The Hedge Rustic (Tholera cespitis) is a species of moth of the Noctuidae family. It is found from Europe to Siberia.

The wingspan is 34–40 mm. There is one generation per year with adults on wing from the end of July to September.

The larvae feed on various grasses, including Nodus stricta, Calamagrostis purpurea, Festuca and Deschampsia species. .[1] Larvae can be found from March to July. The species overwinters as an egg.

Subspecies

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!