Overview

Comprehensive Description

Comments

Daisy Fleabane resembles Erigeron annuus (Annual Fleabane), but robust specimens of these two species are fairly easy to distinguish. Daisy Fleabane is a more slender plant with fewer and skinnier leaves, and the hairs along the middle and upper portions of the central stem are short and appressed, rather than spreading outward. However, some malnourished specimens of Annual Fleabane can resemble Daisy Fleabane, thus becoming a source of possible confusion. While the fleabanes are often dismissed as 'weeds' because of their ubiquitousness during the summer, they are actually rather cheerful plants that are beneficial to many small insects that play an important role in the functioning of the ecological system.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This native annual or biennial plant is erect and up to 3' tall. It is largely unbranched, except for a few side stems near the inflorescence at the apex. The ridged central stem has spreading white hairs near the base, but these hairs become short and appressed along its middle and upper portions. The alternate leaves are up to 4' long and 2/3' across, becoming smaller and more sparsely distributed as they ascend the stems. They are usually oblanceolate (shaped like a narrow spoon), narrowly ovate, or linear. Some of the larger leaves may have a few coarse teeth toward their outer tips. The base of each leaf narrows gradually to a slender petiole-like base. The upper stems terminate in small clusters of daisy-like compound flowers and their buds. The buds have appressed fine hairs that are difficult to see. The compound flowers are about ½' across, consisting of about 40-100 ray florets that surround numerous disk florets. The tiny disk florets are yellow, while the ray florets are usually white (sometimes light violet or pink). The blooming period occurs primarily from late spring to mid-summer, and lasts about 1-2 months. However, some plants may bloom later in the year until the early fall. The flowers may have a mild fragrance. Both the ray and disk florets can set fertile seed without cross-pollination. The small achenes enclosing the seeds have small bristles or white hairs that promote distribution of the seeds by wind. The root system consists of a taproot. This plant spreads by re-seeding itself, and often forms loose colonies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range and Habitat in Illinois

Daisy Fleabane is fairly common and has been reported from almost all counties of Illinois (see Distribution Map). Habitats include upland areas of black soil prairies, gravel prairies, hill prairies, limestone glades, dry savannas, eroding clay banks, pastures and abandoned fields, and areas along roadsides and railroads. While this plant species favors disturbed areas, it is more likely to occur in higher quality habitats than the closely related Erigeron annuus (Annual Fleabane).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Erigeron strigosus Muhl. ex Willd.:
China (Asia)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

Annuals, biennials, or short-lived perennials, 30–70 cm; fibrous-rooted, caudices simple, sometimes lignescent, sometimes producing rhizomes that bear leaf tufts at upturned ends. Stems erect or ascending, sparsely to moderately strigose to strigillose or hirsuto-strigillose (hairs usually ascending, rarely spreading, 0.1–1.2 mm), eglandular. Leaves basal (usually persistent through flowering) and cauline; basal blades spatulate to broadly or narrowly oblanceolate to linear, (10–)30–150(–170) × 5–15(–21) mm, cauline usually gradually reduced distally, continuing to near heads, margins entire or shallowly to deeply serrate or crenate, faces glabrous or glabrate to sparsely strigose or strigoso-hirsute, eglandular. Heads 10–200+ in loosely corymbiform to paniculiform-corymbiform arrays (on distal branches). Involucres (2–)3–4 × 5–12 mm. Phyllaries in 2–4 series, glabrous, strigose, or sparsely hirsute, sometimes minutely glandular. Ray florets 50–100; corollas white, less commonly pinkish or bluish, 4–6 mm, laminae coiling. Disc corollas 1.5–2.5 mm (throats sometimes slightly indurate and inflated). Cypselae (0.5–)0.9–1.2 mm, 2-nerved, faces sparsely strigose; pappi: outer crowns of setae or scales, inner 0 (rays) or of 8–15 bristles (disc).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Synonym

Erigeron annuus (Linnaeus) Persoon subsp. strigosus (Muhlenberg ex Willdenow) Wagenitz
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Range and Habitat in Illinois

Daisy Fleabane is fairly common and has been reported from almost all counties of Illinois (see Distribution Map). Habitats include upland areas of black soil prairies, gravel prairies, hill prairies, limestone glades, dry savannas, eroding clay banks, pastures and abandoned fields, and areas along roadsides and railroads. While this plant species favors disturbed areas, it is more likely to occur in higher quality habitats than the closely related Erigeron annuus (Annual Fleabane).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Primarily small bees and flies visit the flowers for nectar or pollen. Among the bees, are such visitors as Little Carpenter bees, Nomadine bees, Carder bees, Green Metallic bees, and Plasterer bees. An exceptional variety of flies also visit the flowers, while less common visitors include small butterflies, wasps, and beetles. The caterpillars of Schinia lynx (Lynx Flower Moth) eat the buds and flowerheads. Mammalian herbivores occasionally feed on the foliage and flowers, including livestock, deer, rabbits, and groundhogs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower-Visiting Insects of Daisy Fleabane in Illinois

Erigeron strigosus (Daisy Fleabane)
(Bees collect pollen or suck nectar; beetles feed on pollen & are non-pollinating; other insects suck nectar; most observations are from Robertson, otherwise they are from Mitchell, Moure & Hurd, Reed, Grundel & Pavlovic, and Krombein et al. as indicated below)

Bees (long-tongued)
Apidae (Apinae): Apis mellifera sn; Anthophoridae (Ceratinini): Ceratina calcarata sn, Ceratina dupla dupla sn cp fq; Anthophoridae (Epeolini): Epeolus bifasciatus sn; Anthophoridae (Nomadini): Nomada articulata sn, Nomada denticulata sn, Nomada erigeronis sn; Anthophoridae (Pastitidini): Holcopasites illinoiensis sn fq; Megachilidae (Stelidini): Stelis lateralis sn fq, Stelis trypetinum sn fq; Megachilidae (Trypetini): Heriades leavitti sn cp fq, Heriades variolosa variolosa sn

Bees (short-tongued)
Halictidae (Halictinae): Augochlorella aurata sn cp, Halictus confusus sn cp fq, Halictus ligatus sn cp fq, Lasioglossum albipennis sn cp fq (Rb, MH, Re), Lasioglossum imitatus sn cp, Lasioglossum paradmirandus (Re), Lasioglossum pectoralis sn cp, Lasioglossum pruinosus sn cp, Lasioglossum tegularis sn cp, Lasioglossum versatus sn, Lasioglossum zephyrus sn; Halictidae (Sphecodini): Sphecodes cressonii sn, Sphecodes stygius sn; Colletidae (Colletinae): Colletes eulophi sn, Colletes mandibularis (Mch, Kr); Colletidae (Hylaeinae): Hylaeus affinis sn, Hylaeus floridanus sn, Hylaeus mesillae sn; Andrenidae (Andreninae): Andrena quintilis (Kr)

Wasps
Sphecidae (Crabroninae): Oxybelus mexicanus; Sphecidae (Philanthinae): Cerceris clypeata; Sphecidae (Sphecinae): Ammophila pictipennis; Vespidae (Eumeninae): Leionotus ziziae, Stenodynerus ammonia, Stenodynerus anormis fq, Stenodynerus histrionalis; Chrysididae: Chrysis montana; Leucospididae: Leucospis affinis; Braconidae: Coeloides scolytivorus

Flies
Syrphidae: Eristalis dimidiatus, Eristalis stipator, Paragus bicolor, Paragus geminatus, Sphaerophoria contiqua, Syritta pipiens, Toxomerus geminatus (Rb, Re), Toxomerus marginatus fq (Rb, Re), Tropidia mamillata; Empidae: Empis clausa; Bombyliidae: Bombylius atriceps, Exoprosopa fascipennis, Ogcodocera leucoprocta, Toxophora amphitea; Conopidae: Zodion fulvifrons; Tachinidae: Cylindromyia euchenor, Cylindromyia propusilla, Epigrimyia polita, Gymnoclytia immaculata, Gymnoclytia occidua, Gymnosoma fuliginosum, Leucostoma simplex, Periscepsia laevigata, Phasia purpurascens fq, Siphona geniculata; Sarcophagidae: Amobia floridensis, Helicobia rapax, Ravinia anxia, Senotainia rubriventris fq, Sphixapata trilineata; Muscidae: Limnophora narona, Neomyia cornicina; Anthomyiidae: Calythea nigricans, Delia platura; Milichiidae: Pholeomyia indecora; Tephritidae: Orellia ruficauda (Re)

Butterflies
Lycaenidae: Lycaeides melissa samuelis (GP), Lycaena hyllus

Beetles
Melyridae: Collops quadrimaculatus fp np; Mordellidae: Mordellistena comata fp np

Plant Bugs
Miridae: Lygus lineolaris

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erigeron strigosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTTGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATATTTTTTATGGTTATGCCGGCGATGATAGGTGGATTTGGTAATTGGTTTGTTCCGATTCTGATAGGTGCGCCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGTGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCAGTTGATTTAGCAATTTTTAGTCTTCATCTATCTGGTATTTCCTCCATTTTAGGTTCTATCAATTTTATAACAACTATCTTCAACATGCGTGGACCTGGAATGACTATGCATAGATTACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCTACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTTTGATCCCGCTGGAGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erigeron strigosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

These species are introduced in Switzerland.
  • Aeschimann, D. & C. Heitz. 2005. Synonymie-Index der Schweizer Flora und der angrenzenden Gebiete (SISF). 2te Auflage. Documenta Floristicae Helvetiae N° 2. Genève.   http://www.crsf.ch/ External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Info Flora (CRSF/ZDSF) & Autoren 2005

Supplier: Name It's Source (profile not public)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Cultivation

The preference is full sun, dry conditions, and poor soil containing clay or stony material. In moist situations with richer soil, Daisy Fleabane may have trouble competing with taller plants with broader leaves. This plant tends to fade away after flowering and setting seed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Erigeron strigosus

Erigeron strigosus is a species of flowering plant in the daisy family known by the common name plains fleabane.

It is native to eastern North America, and it is present in western North America as a somewhat weedy naturalized species. This is an annual or biennial daisy reaching heights of anywhere from 30 to 80 centimeters. It has hairy, petioled, oval-shaped leaves a few centimeters long mostly on the lower part of the plant. The spindly, branching stem has inflorescences of several flower heads each. The tiny head is less than a centimeter wide and has white ray florets surrounding a golden center.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!