Overview

Brief Summary

Salicaceae -- Willow family

    Perala

    Quaking aspen (Populus tremuloides) is the most  widely distributed tree in North America. It is known by many  names: trembling aspen, golden aspen, mountain aspen, popple,  poplar, trembling poplar, and in Spanish, álamo blanco,  and álamo temblón (49). It grows on many soil  types, especially sandy and gravelly slopes, and it is quick to  pioneer disturbed sites where there is bare soil. This  fast-growing tree is short lived and pure stands are gradually  replaced by slower-growing species. The light, soft wood has very  little shrinkage and high grades of aspen are used for lumber and  wooden matches. Most aspen wood goes into pulp and flake-board,  however. Many kinds of wildlife also benefit from this tree.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This single-trunked tree is usually 30-60' tall, although specimens up to 70-100' are known to occur (see photo of Small Tree). The trunk is normally ½-1½' in diameter (rarely up to 3' across), relatively narrow, and straight. The crown is narrowly rounded with ascending to spreading branches. Trunk bark is variable, depending on the age of a tree. On a mature tree, the bark at the base of the trunk is coarse, gray, and furrowed, becoming more smooth and light-colored above. On immature trees, the trunk bark is white to light yellowish gray and relatively smooth; there are usually black horizontal rings and scattered black knots along the trunk. The bark of larger branches is similar in appearance to the trunk bark of immature trees. Small branches are light brown and warty from abundant lenticels, while twigs are light to dark brown and glabrous. Young shoots are light green or yellowish green and glabrous. Alternate leaves occur along the twigs and young shoots. Individual leaves are 1½-3' long and a little less across; they are oval-ovate in shape with 18-40 small teeth along each side of their margins. These teeth are crenate-dentate. The upper leaf surface is medium green and glabrous, while the lower surface is pale green and glabrous. The petioles are 1½-3' long, light green or pale yellow, and flattened, enabling the leaves to flutter in response to every breeze. Quaking Aspen is usually dioecious, producing either all male (staminate) catkins or all female (pistillate) catkins on separate trees. However, a small minority of trees produce catkins with perfect florets. These catkins are about 1½-2½' long and drooping. Each floret of a male catkin consists of 5-10 stamens with glabrous filaments that develop from a shallow cup-shaped disk. The upper rim of the disk is oblique. There is also a brown floral bract that is narrowly lobed and hairy along its upper side. Each floret of a female catkin consists of a naked pistil that develops from a shallow cup-shaped disk. The upper rim of the disk is oblique. The pistil is 3-6 mm. long and lanceoloid with bifurcated stigmata at its apex. There is also a brown floral bract that is narrowly lobed and hairy along its upper side. The blooming period occurs during mid-spring for about 1-2 weeks before the vernal leaves unfold. The florets of the catkins are cross-pollinated by the wind. During the early summer, the female catkins become up to 4' long and their seed capsules split open, to release their seeds. Each capsule contains 4-10 tiny seeds that are embedded in cottony hairs. The seeds are distributed by the wind or water. The root system is relatively shallow and widely spreading. Clonal offsets often develop from the lateral roots. As a result, colonies of clonal trees are commonplace. The deciduous leaves turn golden yellow during the autumn.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

General: Willow Family (Salicaceae): This is a native tree 5-30 m high, typically less than 15 m, with a rounded crown; lateral roots may extend over 30 meters and vertical sinker roots from the laterals may extend downward for nearly 3 m; bark typically smooth, greenish-white to gray-white, often thin and peeling, becoming thicker and furrowed with age, especially toward the base. Leaves simple, deciduous, broadly ovate to nearly round, 4–6 cm long, with small, rounded teeth on the margins, on a slender, flattened petiole, dark green and shiny above, pale green below, turning bright yellow, yellow-orange, gold, or reddish after the first frosts. The male (staminate) and female (pistillate) flowers are on separate trees (the species dioecious – or ‘polygamodioecious,’ because bisexual flowers may be produced at low frequencies on staminate and pistillate trees), each type of flower borne in pendent catkins. The fruits are narrowly ovoid to flask-shaped capsules 5-7 mm long, splitting to release the seeds; seeds ca.2 mm long, each with a tuft of long, white, silky hairs, easily blown by the wind. The common name is in reference to the shaking of the leaves in light wind.

Variation within the species: Considerable genetic and morphological variation exists over the range of quaking aspen. A number of species and varieties have been described but none are currently recognized. Entire stands are often produced as a single clone from root sprouts – this sometimes easily observable on a single mountainside in different timing in leaf appearance or in different hues and timing of fall coloration. Distinctively large triploid trees are sometimes found.

Quaking aspen hybridizes naturally with bigtooth aspen (Populus grandidentata), narrowleaf cottonwood (P. angustifolia), curly poplar (P. canescens), balsam poplar (P. balsamifera), eastern cottonwood (P. deltoides), and white poplar (Populus alba, a naturalized European species), and hybrids with black cottonwood (P. trichocarpa) occur rarely in Alaska. Quaking aspen, bigtooth aspen, European aspen (P. tremula), and three Asian species are closely related and sometimes classed together as a single, circumglobal superspecies (see Peterson and Peterson 1992).

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alternative names

Trembling aspen, golden aspen, mountain aspen, trembling poplar, white poplar, popple; aspen

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurrence in North America

     AK  AZ  CA  CO  CT  ID  IL  IN  IA  KY
     MA  ME  MD  MI  MN  MO  MT  NE  NV  NH
     NJ  NM  NY  ND  OH  OR  PA  RI  SD  TX
     UT  VT  VA  WA  WV  WI  WY  AB  BC  MB
     NB  NF  NT  NS  ON  PE  PQ  SK  YT  MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

More info for the terms: density, tree

Quaking aspen is the most widely distributed tree in North America.  It
occurs from Newfoundland west to Alaska and south to Virginia, Missouri,
Nebraska, and northern Mexico.  A few scattered populations occur
further south in Mexico to Guanajuato [99].  Quaking aspen is
distributed fairly continuously in the East.  Distribution is patchy in
the West, with trees confined to suitable sites.  Density is greatest in
Minnesota, Wisconsin, Michigan, Colorado, and Alaska; each of those
states contains at least 2 million acres of commercial quaking aspen
forest.  Maine, Utah, and central Canada also have large acreages of
quaking aspen [89,125].
  • 89.  Jones, John R.; Schier, George A. 1985. Growth. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 19-24.  [11903]
  • 99.  Little, Elbert L., Jr. 1971. Atlas of the United States trees. Volume 1.        Conifers and important hardwoods. Misc. Publ. 1146. Washington, DC: U.S.        Department of Agriculture, Forest Service. 320 p.  [1462]
  • 125.  Perala, Donald A.; Carpenter, Eugene M. 1985. Aspen: An American wood.        FS-217. Washington, DC: U.S. Department of Agriculture, Forest Service.        8 p.  [4122]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Outside of cultivation, the native Quaking Aspen is occasional in northern Illinois, rare in central Illinois, and absent from the southern section of the state (see Distribution Map). This tree has a large range in the boreal region of North America. Habitats include upland woodlands, sandy woodlands, sandy savannas, sandy thickets, woodland edges, edges of marshes, bogs, riverbanks, borders of lakes, and abandoned sandy fields. Quaking Aspen is a pioneer species that prefers disturbed habitats, especially burned-over areas. It is able to resprout from its root system after a fire. Quaking Aspen sometimes becomes the dominant tree in these habitats, although it is eventually replaced by other trees in the absence of a regimen of disturbance. Quaking Aspen is occasionally cultivated as a landscape tree for its attractive bark and foliage.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Quaking aspen grows singly and in multi-stemmed clones over 111°  of longitude and 48° of latitude for the widest distribution  of any native tree species in North America (48). The range  extends from Newfoundland and Labrador west across Canada along  the northern limit of trees to northwestern Alaska, and southeast  through Yukon and British Columbia. Throughout the Western United  States it is mostly in the mountains from Washington to  California, southern Arizona, Trans-Pecos Texas, and northern   Nebraska. From Iowa and eastern Missouri it ranges east to West  Virginia, western Virginia, Pennsylvania, and New Jersey. Quaking  aspen is also found in the mountains of Mexico, as far south as  Guanajuato. Worldwide, only Populus tremula, European  aspen, and Pinus sylvestris, Scotch pine, have wider  natural ranges.

   
  -The native range of quaking aspen.


  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Populus tremuloides var. magnifica Vict.:
Canada (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Populus tremuloides Michx.:
Canada (North America)
Mexico (Mesoamerica)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Newfoundland, Labrador to southern Alaska; British Columbia through Alberta to New Jersey; Virginia, Missouri and the mountains of western United States and northern Mexico (Fowells 1965). The most widely distributed native tree in the United States (Knotts, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adaptation

Quaking aspen occurs in a wide variety of habitats (including soil type and moisture conditions) and at a great range of elevation, matching its extensive geographic range. It characteristically forms pure stands or mixed stands with bigtooth aspen, but it occurs with scrub oaks and sagebrush at lower elevations and as a prostrate form above timberline and exists as a dominant species in many communities at mid elevations. It is a shade-intolerant, disturbed site species and is quickly replaced in succession by more tolerant species.

Some trees are self-pruning, dropping numerous small twigs with excess fall foliage and returning nutrients to the soil. Leaves decay relatively rapidly, and a characteristic "aspen soil," with a higher pH than on conifer-dominated soils, develops on sites that have supported aspen for a number of generations.

Flowering occurs March–April (East) or May–June (West), before the leaves appear and fruiting in May–June (–July), often before the leaves are fully expanded. Temperatures above 12 C for about 6 days apparently trigger flowering. Female trees generally flower and leaf out before male trees.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Quaking aspen is the most widely distributed tree species in North America. It grows from Alaska across the Northwest Territories to Quebec and Newfoundland, south to West Virginia and Virginia, and in all of the western North America US states (except Oklahoma and Kansas) -- in all Canadian provinces and all but 13 US states (absent from the Southeast). It occurs in both the eastern and western sierras of Mexico, into the south-central part of the country. Outside of the main range, it is represented by a huge number of disjunct populations. For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

More info for the terms: capsule, cotyledon, dioecious, phenology, tree

Quaking aspen is a native deciduous tree.  It is small- to medium-sized,
typically less than 48 feet (15 m) in height and 16 inches (40 cm) dbh
[75].  It has spreading branches and a pyramidal or rounded crown
[60,75,88,166].  The bark is thin.  Leaves are orb- to ovately shaped,
with flattened petioles [90].  The fruit is a tufted capsule bearing six
to eight seeds.  A single female catkin usually bears 70 to 100 capsules
[88,166].  The root system is relatively shallow, with widespreading
lateral roots and vertical sinker roots descending from the laterals.
Laterals may extend over 100 feet (30 m) into open areas [88].  Gifford
[59] found that vertical roots of quaking aspen in Utah extended more
than 9 feet (2.7 m) down, branching into fine, dense roots at their
extremities [88].

Quaking aspen forms clones connected by a common parent root system.  It
is typically dioecious, with a given clone being either male or female.
Some clones produce both stamens and pistils, however [88].  Quaking
aspen stands may consist of a single clone or aggregates of clones
[166].  Clones can be distinguished by differences in phenology, leaf
size and shape, branching habit, bark character, and by electrophoresis
[123].  In the West, quaking aspen stands are often even-aged,
originating after a single top-killing event.  Some stands, resulting
from sprouting of a gradually deteriorating stand, may be only broadly
even-aged [88].  Clones east of the Rocky Mountains tend to encompass a
few acres at most [125], and aboveground stems are short lived.  Maximum
age of stems in the Great Lakes States is 50 to 60 years.  Clones in the
West tend to occupy more area, and aboveground stems may live up to 150
years [86].  A male clone in the Wasatch Mountains of Utah occupies 17.2
acres (43 ha) and has more than 47,000 stems.  To date, it is the
world's most massive known organism.  Clone age can be great; the large
Utah clone is estimated to be 1 million years old [107].

Seedling morphology:  Quaking aspen seedlings can easily be
misidentified as cottonwood (Populus spp.) or willow (Salix spp.)
seedlings because quaking aspen seedlings bear only a slight resemblance
to the adult form.  Leaves of quaking aspen seedlings are nearly
lanceolate.  During the first growing season, vertical flattening of the
leaf petioles is not obvious, and there is no lateral branching.  By the
second growing season, leaves are characteristically orbicular to
ovate, and there is vertical branching.  Renkin and others [133] have
published photographs of excavated quaking aspen seedlings.

Quaking aspen seedlings can be differentiated from root sprouts by leaf
morphology, lack of woody tissue, lack of vertical shoots, and presence
of a taproot [90,133].  There are a few visual clues that can
distinguish seedlings from sprouts without excavation.  Seedlings have
paired cotyledons or cotyledon scars a few millimeters above the soil
surface.  The first pair of true leaves is nearly opposite, at right
angles to, and directly above the cotyledons.  Leaf pattern of sprouts
is strongly alternate [133].

Physiology:  Quaking aspen is not shade tolerant [123,130]; neither does
it tolerate long-term flooding nor waterlogged soils [123].  Even if
quaking aspen survives flooding in the short term, stems subjected to
prolonged flooding usually develop a fungus infection that greatly
reduces stem life (and renders the wood commercially useless) [37,118,126].

Sprouting is hormonally controlled in quaking aspen.  Sprouting is
suppressed by auxin, which is transported from the stem to the roots.
Auxin therefore maintains apical dominance.  When stems are killed and
apical dominance is removed, cytokinins in the roots initiate root
sprouting.  Clones with a strong tendency to sprout probably have high
cytokinin:auxin ratios [145].
  • 37.  Davidson, Ross W.; Hinds, Thomas E.; Hawksworth, Frank G. 1959. Decay of        aspen in Colorado. Station Paper No. 45. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 14 p.  [26838]
  • 59.  Gifford, Gerald F. 1966. Aspen root studies on three sites in northern        Utah. American Midland Naturalist. 75(1): 132-141.  [16509]
  • 60.  Gleason, Henry A.; Cronquist, Arthur. 1991. Manual of vascular plants of        northeastern United States and adjacent Canada. 2nd ed. New York: New        York Botanical Garden. 910 p.  [20329]
  • 75.  Hickman, James C., ed. 1993. The Jepson manual: Higher plants of        California. Berkeley, CA: University of California Press. 1400 p.        [21992]
  • 86.  Johnston, B. C.; Hendzel, L. 1985. Examples of aspen treatment,        succession, and management in western Colorado. Lakewood, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Region. 164 p.        [18670]
  • 88.  Jones, John R.; DeByle, Norbert V. 1985. Fire. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 77-81.  [11910]
  • 90.  Kay, Charles E. 1993. Aspen seedlings in recently burned areas of Grand        Teton and Yellowstone National Parks. Northwest Science. 67(2): 94-104.        [21653]
  • 107.  Mitton, Jeffrey B.; Grant, Michael C. 1996. Genetic variation and the        natural history of quaking aspen. Bioscience. 46(1): 25-31.  [26169]
  • 118.  Pausler, M. Gabrielle; Ayer, William A.; Hiratsuka, Yasuyuki. 1995.        Benzoic acid, salicyclic acid, and the role of black galls on aspen in        protection against decay. Canadian Journal of Forest Research. 25(9):        1479-1483.  [26667]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 125.  Perala, Donald A.; Carpenter, Eugene M. 1985. Aspen: An American wood.        FS-217. Washington, DC: U.S. Department of Agriculture, Forest Service.        8 p.  [4122]
  • 126.  Peterson, E. B.; Peterson, N. M. 1992. Ecology, management, and use of        aspen and balsam poplar in the Prairie Provinces, Canada. Special Report        1. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry        Centre. 252 p.  [22689]
  • 130.  Puettmann, Klaus J.; Reich, Peter B. 1995. The differential sensitivity        of red pine and quaking aspen to competition. Canadian Journal of Forest        Research. 25: 1731-1737.  [26165]
  • 133.  Renkin, Roy; Despain, Don. 1994. Suckering in burned aspen as related to        above-ground and below-ground biomass. In: Despain, Don G., editor.        Plants and their environments: proceedings of the 1st biennial        scientific conference on the Greater Yellowstone Ecosystem; 1991        September 16-17; Yellowstone National Park. Tech. Rep.        NPS/NRYELL/NRTR-93/XX. Denver, CO: U.S. Department of the Interior,        National Park Service, Rocky Mountain Region, Yellowstone National Park:        341-343. [Abstract]
  • 145.  Schier, George A.; Jones, John R.; Winokur, Robert P. 1985. Vegetative        regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 29-33.        [11905]
  • 166.  Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry        C., eds. 1987. A Utah flora. Great Basin Naturalist Memoir No. 9. Provo,        UT: Brigham Young University. 894 p.  [2944]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Isotype for Populus tremuloides var. intermedia Vict.
Catalog Number: US 1524538
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Preparation: Pressed specimen
Collector(s): Fr. Marie-Victorin
Year Collected: 1926
Locality: Des Deux-montagnes., Quebec, Canada, North America
  • Isotype: Victorin, Fr. J. L. 1930. Contr. Inst. Bot. Univ. Montreal. 16: 8.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Botany

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Isotype for Populus tremuloides var. magnifica Vict.
Catalog Number: US 1524536
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Preparation: Pressed specimen
Collector(s): Fr. Rolland-Germain
Year Collected: 1926
Locality: Hull, Que., Quebec, Canada, North America
  • Isotype: Victorin, Fr. J. L. 1930. Contr. Inst. Bot. Univ. Montreal. 16: 10.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Botany

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat characteristics

More info for the term: tree

Quaking aspen occurs on a wide variety of sites [40,111].  It grows on
moist upland woods, dry mountainsides, high plateaus, mesas, avalanche
chutes, talus, parklands, gentle slopes near valley bottoms, alluvial
terraces, and along watercourses [40,109,158,166]. 

Climate:  Climatic conditions vary widely over the range of quaking
aspen, especially minimum winter temperatures and annual precipitation.
Generally, quaking aspen occurs where annual precipitation exceeds
evapotranspiration.  In Alaska and northwestern Canada, quaking aspen is
common in the boreal zone and extends into the warmest, frost-free sites
of the permafrost zone.  At the eastern edge of quaking aspen's range,
climate is humid, with snowfall exceeding 120 inches (3,050 mm) per
year.  The southern limit of quaking aspen distribution in the East is
roughly delinated by the 75 degree Fahrenheit (24 deg C) mean July
temperature isotherm.  In the central Rocky Mountains, altitude plays an
important role in quaking aspen distribution.  The lower limit of its
range coincides with a mean annual temperature of 45 degrees Fahrenheit
(7 deg C) [123].

Soils:  Quaking aspen grows on soils ranging from shallow and rocky to
deep loamy sands and heavy clays.  Good quaking aspen sites are usually
well drained, loamy, and high in organic matter and nutrients [123].
Cryer and Murray [36] stated that stable quaking aspen stands are found
on only one soil order - mollisols - and a few soil subgroups of which
Agric Pachic Cryoborolls and Pachic Cryoborolls are dominant.  The best
stands in the Rocky Mountains and Great Basin are on soils derived from
basic igneous rock such as basalt, and from neutral or calcareous shales
and limestones.  The poorest stands are on soils derived from granite.
In the Great Lakes States, the best stands occur in lime-rich, gray
glacial drift [123].

Elevation:  Quaking aspen spans an elevational range from sea level on
both coasts to 11,500 feet (3,505 m) in northern Colorado.  At its
northern limit, quaking aspen is found only up to 3,000 feet (910 m).  In
Baja California, it does not occur below 8,000 feet (2,440 m).  In
Arizona and New Mexico is is most abundant between 6,500 and 10,000 feet
(1,980-3,050 m); in Colorado and Utah, it occurs about 1,000 feet (300
m) higher.  At either either of its elevational limits, quaking aspen is
stunted.  At its lower limit, it grows as a scrubby tree along streambanks;
at high elevations, its stems are bent or prostrate [123].

Aspect:  In Alaska and western Canada, quaking aspen grows best on south
to southwesterly exposures.  It is common on all aspects in the West,
except in the Southwest, where it is most common on northern aspects.
In the prairie provinces of Canada, particularly on the prairie-woodland
interface, quaking aspen occurs on cooler north and east slopes, and in
depressions [123].
  • 36.  Cryer, Douglas H.; Murray, John E. 1992. Aspen regeneration and soils.        Rangelands. 14(4): 223-226.  [19078]
  • 40.  DeByle, N. V. 1985. Environment of Populus tremuloides. In: Proceedings        of the 1985 Society of American Foresters National Convention; 1985 July        28 - July 31; Fort Collins, CO. Bethesda, MD: Society of American        Foresters: 87-91.  [222]
  • 109.  Morgan, M. D. 1969. Ecology of aspen in Gunnison County, Colorado.        American Midland Naturalist. 82(1): 204-228.  [15935]
  • 111.  Mueggler, W. F. 1976. Type variability and succession in Rocky Mountain        aspen. In: Utilization and marketing as tools for aspen management in        the Rocky Mountains: Proceedings of the symposium. General Technical        Report RM-29. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 16-19.        [3893]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 158.  Stubbendieck, J.; Hatch, Stephan L.; Hirsch, Kathie J. 1986. North        American range plants. 3rd ed. Lincoln, NE: University of Nebraska        Press. 465 p.  [2270]
  • 166.  Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry        C., eds. 1987. A Utah flora. Great Basin Naturalist Memoir No. 9. Provo,        UT: Brigham Young University. 894 p.  [2944]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Key Plant Community Associations

More info for the terms: cover, fern, forbs, shrub

Quaking aspen is a major cover type in North America.  In Minnesota,
Wisconsin, and Utah, quaking aspen occupies more land than any other
forest type.  Quaking aspen also occurs in a large number of other
forest cover types over its extensive range.  It is common in spruce-fir
(Picea-Abies spp.) types of the Great Lakes States and central Canada
and in mixed northern hardwoods.  Mixed jack pine (Pinus banksiana) and
quaking aspen occur on the Precambrain shield in Canada and Minnesota.
In the Rocky Mountains, quaking aspen groves are scattered throughout
Engelmann spruce-subalpine fir (Picea engelmannii-A. lasiocarpa)
forests.  Quaking aspen is common in mixed conifer forests of New
Mexico, Arizona, and California.  At its lower altitudinal limit in the
western United States, quaking aspen is associated with scrub oaks
(Quercus spp.) or sagebrush (Artemisia spp.).  Prostrate quaking aspen
occur above timberline [125].  Throughout its range, quaking aspen
occurs in mid- to upper riparian zones [56,123].

Quaking aspen is listed as a dominant species in over 100 habitat, plant
community, and vegetation typings.  A comprehensive list of these
publications can be obtained by using the Citation Retrieval System
(CRS).  In CRS, a combination search using the keywords POPTRE and HTS
(Populus tremuloides and habitat types), and a second search using the
keywords POPTRE and COMM TYPES (P. tremuloides and community types),
will produce a list of habitat, plant community, and vegetation typings
describing quaking aspen as a dominant species.  The search can be
narrowed by including the keyword for the state or administrative unit
of interest (e.g., search:  POPTRE and HTS and CO).

Associated shrub species:  East - Shrub species commonly associated with
quaking aspen in the East include beaked hazel (Corylus cornuta),
American hazel (C. americana), mountain maple (Acer spicatum), speckled
alder (Alnus rugosa), American green alder (A. viridis spp. crispa),
dwarf bush-honeysuckle (Diervilla lonicera), raspberries and
blackberries (Rubus spp.), willows (Salix spp.), and gooseberries (Ribes
spp.).

Great Plains - Additional species occurring with quaking aspen in the
prairie provinces included snowberry (Symphoricarpos spp.), highbush
cranberry (Viburnum edule), limber honeysuckle (Lonicera dioica),
red-osier dogwood (Cornus sericea), western serviceberry (Amelanchier
alnifolia), chokecherry (Prunus virginiana), Bebb willow (Salix
bebbiana), and roses (Rosa spp.).

Alaska - Bebb willow and roses are also associated with quaking aspen in
Alaska.  Other common shrub associates are Scouler willow (S.
scouleriana), bearberry (Arctostaphylos uva-ursi), mountain cranberry
(Vaccinium vitis-idaea), and highbush cranberry.

Rocky Mountains - Mountain snowberry (Symphoricarpos oreophilus),
western serviceberry, chokecherry, common juniper (Juniperus communis),
Oregon-grape (Berberis repens), Wood's rose (R. woodsii), myrtle
pachistima (Pachistima myrsinites), redberry elder (Sambucus pubens),
and a number of Ribes species are associated with quaking aspen in the
Rocky Mountains [123].

Pacific Northwest - In valleys west of the Cascades in Oregon and
Washington, quaking aspen alternates dominance with Douglas hawthorn
(Crataegus douglasii).  Quaking aspen grows through the Douglas hawthorn
overstory, resulting in reduced vigor of Douglas hawthorn.  Quaking
aspen eventually dies back, releasing Douglas hawthorn in the understory
[56].

Associated herbaceous species:  East - Herbs commonly found in the
understory of quaking aspen in the East include largeleaf aster (Aster
macrophyllus), wild sarsaparilla (Aralia nudicaulis), Canada beadruby
(Maianthemum canadense), bunchberry (Cornus canadensis), yellow beadlily
(Clintonia borealis), roughleaf ricegrass (Oryzopsis asperifolia),
sweet-scented bedstraw (Galium triflorum), sweetfern (Comptonia
perigrina), lady fern (Athyrium filix-femina), bracken fern (Pteridium
aquilinum), sedges (Carex spp.), and goldenrods (Solidago spp.).

West - The herbaceous component of quaking aspen communities in the West
is too diverse to list.  Forbs dominate most sites [123].
  • 56.  Franklin, Jerry F.; Dyrness, C. T. 1973. Natural vegetation of Oregon        and Washington. Gen. Tech. Rep. PNW-8. Portland, OR: U.S. Department of        Agriculture, Forest Service, Pacific Northwest Forest and Range        Experiment Station. 417 p.  [961]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 125.  Perala, Donald A.; Carpenter, Eugene M. 1985. Aspen: An American wood.        FS-217. Washington, DC: U.S. Department of Agriculture, Forest Service.        8 p.  [4122]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

   105  Antelope bitterbrush-Idaho fescue
   107  Western juniper/big sagebrush/bluebunch wheatgrass
   318  Bitterbrush-Idaho fescue
   401  Basin big sagebrush
   402  Mountain big sagebrush
   403  Wyoming big sagebrush
   411  Aspen woodland
   412  Juniper-pinyon woodland
   413  Gambel oak
   420  Snowbush
   421  Chokecherry-serviceberry-rose
   422  Riparian
   509  Transition between oak-juniper woodland and mahogany-oak association
   920  White spruce-paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

     1  Jack pine
     5  Balsam fir
    12  Black spruce
    13  Black spruce-tamarack
    15  Red pine
    16  Aspen
    18  Paper birch
    19  Gray birch-red maple
    20  White pine-northern red oak-red maple
    21  Eastern white pine
    25  Sugar maple-beech-yellow birch
    26  Sugar maple-basswood
    27  Sugar maple
    28  Black cherry-maple
    30  Red spruce-yellow birch
    31  Red spruce-sugar maple-beech
    32  Red spruce
    33  Red spruce-balsam fir
    35  Paper birch-red spruce-balsam fir
    37  Northern white-cedar
    38  Tamarack
    39  Black ash-American elm-red maple
    42  Bur oak
    51  White pine-chestnut oak
    55  Northern red oak
    60  Beech-sugar maple
    63  Cottonwood
   107  White spruce
   108  Red maple
   201  White spruce
   202  White spruce-paper birch
   203  Balsam poplar
   204  Black spruce
   205  Mountain hemlock
   206  Engelmann spruce-subalpine fir
   207  Red fir
   208  Whitebark pine
   209  Bristlecone pine
   210  Interior Douglas-fir
   211  White fir
   212  Western larch
   213  Grand fir
   215  Western white pine
   216  Blue spruce
   217  Aspen
   218  Lodgepole pine
   219  Limber pine
   220  Rocky Mountain juniper
   238  Western juniper
   239  Pinyon-juniper
   252  Paper birch
   256  California mixed subalpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K003  Silver fir-Douglas-fir forest
   K005  Mixed conifer forest
   K007  Red fir forest
   K008  Lodgepole pine-subalpine forest
   K011  Western ponderosa forest
   K012  Douglas-fir forest
   K013  Cedar-hemlock-pine forest
   K014  Grand fir-Douglas-fir forest
   K015  Western spruce-fir forest
   K016  Eastern ponderosa forest
   K017  Black Hills pine forest
   K018  Pine-Douglas-fir forest
   K019  Arizona pine forest
   K020  Spruce-fir-Douglas-fir forest
   K021  Southwestern spruce-fir forest
   K022  Great Basin pine forest
   K023  Juniper-pinyon woodland
   K024  Juniper steppe woodland
   K029  California mixed evergreen forest
   K037  Mountain-mahogany-oak scrub
   K038  Great Basin sagebrush
   K055  Sagebrush steppe
   K095  Great Lakes pine forest
   K096  Northeastern spruce-fir forest
   K098  Northern floodplain forest
   K100  Oak-hickory forest
   K101  Elm-ash forest
   K106  Northern hardwoods
   K107  Northern hardwoods-fir forest
   K108  Northern hardwoods-spruce forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

   FRES10  White-red-jack pine
   FRES11  Spruce-fir
   FRES15  Oak-hickory
   FRES17  Elm-ash-cottonwood
   FRES18  Maple-beech-birch
   FRES19  Aspen-birch
   FRES20  Douglas-fir
   FRES21  Ponderosa pine
   FRES22  Western white pine
   FRES23  Fir-spruce
   FRES24  Hemlock-Sitka spruce
   FRES25  Larch
   FRES26  Lodgepole pine
   FRES28  Western hardwoods
   FRES29  Sagebrush
   FRES34  Chaparral-mountain shrub
   FRES35  Pinyon-juniper
   FRES36  Mountain grasslands
   FRES37  Mountain meadows
   FRES38  Plains grasslands
   FRES39  Prairie

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Outside of cultivation, the native Quaking Aspen is occasional in northern Illinois, rare in central Illinois, and absent from the southern section of the state (see Distribution Map). This tree has a large range in the boreal region of North America. Habitats include upland woodlands, sandy woodlands, sandy savannas, sandy thickets, woodland edges, edges of marshes, bogs, riverbanks, borders of lakes, and abandoned sandy fields. Quaking Aspen is a pioneer species that prefers disturbed habitats, especially burned-over areas. It is able to resprout from its root system after a fire. Quaking Aspen sometimes becomes the dominant tree in these habitats, although it is eventually replaced by other trees in the absence of a regimen of disturbance. Quaking Aspen is occasionally cultivated as a landscape tree for its attractive bark and foliage.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate

Climatic conditions vary greatly over the range of the species,  especially winter minimum temperatures and annual precipitation.  The known widest range in temperatures aspen has endured in the  conterminous United States is in Montana, where January lows of  -57° C (-70° F) and summer highs of 41° C (105°  F) have been recorded. In Alaska and northwest Canada, part of  the range lies within the permafrost zone, but quaking aspen  grows only on the warmest sites free of permafrost (28,91).

    At the eastern end of the range, in the Maritime Provinces of  Canada, the climate is mild, humid, and snowfall is extremely  heavy, 300 cm (120 in) or more per year. Some representative  climates for the northern and eastern limits of quaking aspen as  well as for the warmer parts of its eastern range are as follows  (78):

                           Interior Alaska  Gander, NF  Ft. Wayne, IN            Temperature, C:               Minimum   -61°  -34°  -31°      January average  -30°  -7°  -3°      Maximum   38°  32°  41°      July average  16°  16°  23°      Precipitation, mm:               Total   180  1020  860      Growing season  80  250  330      Frost-free days  81  160  176      Temperature, F:               Minimum  -78°  -29°  -24°      January average  -22°  19°  27°      Maximum  100°  90°  106°      July average  61°  61°  73°      Precipitation, in:               Total  7  40  34      Growing season  3  10  13      Frost-free days  81  160  176                            In the central Rocky Mountains, where altitude plays an important  role in the distribution of aspen, the lower limit of its  occurrence coincides roughly with a mean annual temperature of 7°  C (45° F). In Colorado and southern Wyoming, quaking aspen  grows in a narrow elevational belt of 2100 to 3350 m (6,900 to  11,000 ft). Average annual precipitation in this belt ranges from  410 to 1020 mm (16 to 40 in). The southern limit of the range of  aspen in the Eastern United States is roughly delineated by the  24° C (75° F) mean July temperature isotherm. In Canada  the mean annual degree-day sum of 700° C (1260° F) with  a threshold temperature 5.6° C (42° F) coincides  closely with the northern limit of the species (51,69, 70,78,80).

    Quaking aspen occurs where annual precipitation exceeds  evapotranspiration. It is abundant in interior Alaska where  annual precipitation is only about 180 mm (7 in) because  evapotranspiration is limited by cool summer temperatures. In the  interior west the 2.5 cm (I in) average annual surface water  runoff isopleth is more coincident with the range of aspen than  is any isotherm. This isopleth also is coincident with the  southern limit of aspen in the prairie provinces of Canada  eastward to northwestern Minnesota and south to Iowa where high  summer temperatures limit growth and longevity. In summary, the  range of quaking aspen is limited first to areas of water surplus  and then to minimum or maximum growing season temperatures  (33,71,91).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Climatic conditions vary throughout the ranges, but are often characterized by low seasonal temperature provided by high altitudes or northern latitudes, and short growing seasons. P. tremuloides tolerates a wide range of soil conditions from rocky soils or loamy sands, to clay soils. The most favorable soils are porous, and loamy soils that have abundant lime and humus. Growth in clay soils is reduced because of poor aeration; growth in sand is poor because of low moisture and nutrient levels. Rocky soils can hinder the spread of lateral roots. P. tremuloides grows at elevations up to 5,800 feet (1768 m) in the north, and rarely below 8,000 feet (2438 m) in lower California, growing at sea level only as far south as Maine and Washington. In the southwest United States, it often grows in cool shaded mountain slopes, canyons, and on stream banks, at about 6,500 to 10,000 feet (1981 to 3048 m) in elevation. P. tremuloides grows with other aspens and often in the following forest types: Jack pine-aspen, white spruce, balsam fir-aspen, black spruce-aspen, aspen-paper birch (Fowells 1965).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Quaking aspen commonly establishes from seed in Alaska, northern Canada, and eastern North America. Seedling establishment is less common in the West but occurs there in moist sites such as kettles and other topographic depressions, seeps, springs, lake margins, and burnt-out riparian zones. Drought stress kills seedlings, as does standing water.

Young trees first flower at 2-3 years but production of large seed crops begins at about 10-20 years; maximum seed production occurs at 50-70 years. Heavy seed crops are produced at 4-5-year intervals. Seeds are wind-dispersed for distances of 500 meters to several kilometers.

Germination generally begins nearly immediately after moisture is received and can occur across a broad temperature range, with optimal germination at 15-25 C. Surface placement or a very shallow depth of burial on exposed mineral soil (such as burned or scarified sites) apparently provide the best environment for germination. Continuous moisture is required.

Asexual reproduction and clones

Reproduction of quaking aspen is primarily by root sprouts, and extensive clones of root-interconnected trees are characteristic of the species. Most root sprouts develop within 10 meters of the parent stem, although some are produced at 30 meters or more. They develop from roots within 2-10 centimeters of the surface. Growth in primordia and buds is suppressed by apical dominance but resumes after stems are top-killed by fire, harvest or wind-breakage, or after defoliation and many thousands of sprouts per acre may be produced. Removal of the above-ground plant portion in June or July after maximum auxin production (the chemical agent of apical dominance) results in fewer suckers than top-removal during the dormant season. Sprouts produced in a closed stand usually die unless in a canopy gap. Saplings may begin producing root sprouts at 1 year of age.

Stands of quaking aspen may consist of a single clone or represent a mosaic of different clones. Even in a small area, wide variation in genetic traits exists between clones – differences may be seen in leaf shape and size, bark colour and texture, branching habit, resistance to disease and insect attack, sexual expression, growth rate, and phenology. The most conspicuous differences may be in the timing of spring leaf flush and in autumn leaf coloration.

The staminate-pistillate ratio of clones is 1:1 in most localities, but in the eastern US staminate trees may outnumber pistillate ones by 3:1. Some clones alternate between staminate and pistillate forms in different years or produce combinations of perfect, staminate, and pistillate flowers.

Individual trees of quaking aspen are short-lived (maximum age in the Great Lakes states is 50–60 years, up to 150 years in the West). Stands may be even-aged (after a single top-kill event) or only broadly even-aged (from sprouting of a gradually deteriorating stand). The clones are much older: many in the Rocky Mountain and Great Basin regions are at least 8000 years old, persisting since the last glacial retreat. A male clone in the Wasatch Mountains of Utah occupies 17.2 acres (43 ha) and has more than 47,000 stems – this clone is estimated to be 1 million years old and may be the world's most massive known organism. Clones east of the Rocky Mountains usually cover no more than a few acres.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Many insects feed on the leaves, bore through the wood, or suck juices from Quaking Aspen and other Populus spp. This include Chrysomela crotchi (Aspen Leaf Beetle), Chrysomela scripta (Cottonwood Leaf Beetle), and many other leaf beetles (see Leaf Beetle Table) that feed on the foliage. The larvae of some beetles bore through the wood of either living or dead trees. These species include Oberea delongi (Poplar Twig Borer), Oberea schaumi (Poplar Branch Borer), Saperda calcarata (Poplar Borer), Descarpentriesina cyanipes (Eastern Poplar Buprestid), and Dicerca tenebrica (Flat-Headed Poplar Borer). Other insect feeders include the plant bug Orthotylus candidatus, Aphis maculatae (Spotted Poplar Aphid) and Chaitophorus populicola (Poplar Leaf Aphid), the leafhopper Kybos copula, and the treehopper Palonica tremulata (see the Insect Table for a more complete listing of these species). Caterpillars of such butterflies as Limenitis archippus (Viceroy), Limenitis arthemis arthemis (White Admiral), Nymphalis antiopa (Mourning Cloak), and Nymphalis vau-album j-album (Compton Tortoiseshell) feed on the leaves of Quaking Aspen and other Populus spp., as do caterpillars of the skipper Erynnis icelus (Dreamy Duskywing). In addition to these species, the caterpillars of a large number of moths feed on the leaves and other parts of these trees (see Moth Table), including Lobophora nivigerata (Powdered Bigwig), Protitame virginalis (Virgin Moth),  Pseudosciaphila duplex (Spotted Aspen Leafroller), and Phyllonorycter tremuloidella (Aspen Blotch Leafminer). Many vertebrate animals use Quaking Aspen and other Populus spp. as a source of food, protective cover, and nesting habitat. The Ruffed Grouse, Greater Prairie Chicken, and Purple Finch feed on either the buds or catkins, as does the Red Squirrel. The Yellow-Bellied Sapsucker drills holes into the thin bark to access the sap. White-Tailed Deer, Elk, and the Cottontail Rabbit browse on the twigs and foliage of young trees. Such domesticated animals as cattle, sheep, and goats also browse on the twigs and foliage. When Quaking Aspen grows along bodies of water, its bark, branches, and foliage are eaten by the Beaver and, to a lesser extent, by the Muskrat. The Meadow Vole also feeds on the bark below the snow line during winter. Insectivorous birds often visit aspen groves to feed on the many insects that these trees attract. Many birds construct nests on the branches or in the cavities of this tree, including the Red-Breasted Nuthatch, Yellow Warbler, Warbling Vireo, and Northern Flicker. Beavers use the branches of Quaking Aspen in the construction of their dams and lodges.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower-Visiting Insects of Quaking Aspen in Illinois

Populus tremuloides (Quaking Aspen)
(honeybees collect pollen; this tree is wind-pollinated; observations are from Robertson)

Bees (long-tongued)
Apidae (Apinae): Apis mellifera cp fq

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Forest Cover

Quaking aspen grows with a large number of trees and shrubs over  its extensive range. It is a major component of three forest  cover types (72), Aspen (Eastern Forest) (Society of American  Foresters Type 16), Aspen (Western Forest) (Type 217), and White  Spruce-Aspen (Type 251). It is a minor component of 35 other  types and an occasional to rare component in 3 types.

    Shrub species commonly associated with quaking aspen in the  eastern part of its range include beaked hazel (Corylus  cornuta), American hazel (C. americana), mountain  maple (Acer spicatum), speckled alder (Alnus rugosa),  American green alder (A. crispa), dwarf bush -honeysuckle  (Diervilla lonicera), raspberries and blackberries (Rubus  spp.), and various species of gooseberry (Ribes) and  willow (Salix). Additional species occurring with quaking  aspen in the prairie provinces include: snowberry (Symphoricarpos  spp.), highbush cranberry (Viburnum edule), limber  honeysuckle (Lonicera dioica), red-osier dogwood (Cornus  stolonifera), western serviceberry (Amelanchier  alnifolia), chokecherry (Prunus virginiana), Bebb  willow (Salix bebbiana), and several species of rose (Rosa).  The latter two also occur in Alaska plus such additional  species as Scouler willow (Salix scouleriana), bearberry  (Arctostaphylos uva-ursi), russet buffaloberry (Shepherdia  canadensis), mountain cranberry (Vaccinium vitisidaea),  and highbush cranberry. In the Rocky Mountains, shrubs  commonly occurring with quaking aspen include mountain snowberry  (Symphoricarpos oreophilus), western serviceberry,  chokecherry, common juniper (Juniperus communis), creeping  hollygrape (Berberis repens), woods rose (Rosa  woodsii), myrtle pachistima (Pachistima myrsinites), redberry  elder (Sambucus pubens), and a number of Ribes (69,70,72,78,85,91).

    Herbs characteristic of quaking aspen stands in the east include  largeleaf aster (Aster macrophyllus), wild sarsaparilla  (Aralia nudicaulis), Canada beadruby (Maianthemum  canadense), bunchberry (Cornus canadensis), yellow  beadlily (Clintonia borealis), roughleaf ricegrass (Oryzopsis  asperifolia), sweetscented bedstraw (Galium triflorum),  sweetfern (Comptonia perigrina), lady fern (Athyrium  filix-femina), bracken (Pteridium aquilinum), and  several species of sedges (Carex spp.) and goldenrods  (Solidago spp.). In the West, the herbaceous component is  too rich and diverse to describe. Forbs dominate most sites, and  grasses and sedges dominate others (72).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known Pests: Malacosoma disstria, Marssonia populi, FOMES IGNARIUS, Hypoxylon CANKER

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Damaging Agents

Numerous factors other than competition  injure or kill young stands (25,40). Young trees are sometimes  killed by bark-eating mammals, such as meadow mice and snowshoe  hares, which may girdle the stem at or near the ground line.  Also, larger animals, such as mule deer, white-tailed deer, elk,  and moose, frequently seriously damage reproduction by browsing  and by rubbing their antlers against the stems. Elk and moose can  also damage pole- and saw log-size trees by "barking"  them with their incisors. Such injuries often favor secondary  attack by insects or pathogens. Heavy use by overwintering big  game animals can greatly reduce the number of aspen trees in  localized areas. Cattle and sheep browsing is a serious problem  in many areas of the Rockies because livestock are allowed to  range through recent aspen clearcuts. Mature aspen stands  adjacent to livestock concentrations (water holes, salt blocks,  isolated stands in large open areas) often have root damage, are  declining, and have few if any suckers present. Excessive use and  vandalism by recreationists has caused aspen to deteriorate in  many campsites (41,70).

    Beaver feed on the young tender bark and shoots of aspen and often  cut down large numbers of trees near their colonies. A high  population of porcupines can greatly damage tree crowns both  directly by feeding, and indirectly by increasing the trees'  susceptibility to attack by insects and diseases.

    The red-breasted and yellow-bellied sapsuckers may seriously sear  trees with drill holes. Minor damage is caused by such woodland  birds as the ruffed grouse and the sharp-tailed grouse, which  feed on the buds of quaking aspen; ruffed grouse also feed on the  leaves during the summer months (78).

    Aspen is susceptible to a large number of diseases  (28,39,41,81,82). Shoot blight of some aspen caused by Venturia  macularis is periodically severe. Angular black spots appear  on the leaves, enlarging until the leaf dies. If the infection  occurs at the top of the tree, the entire new shoot may be  infected, blackened, killed, and bent to form a "shepherd's  crook." This disease is common in young stands. A similar  leaf disease in Wisconsin is caused by Colletotrichum  gloeosporioides.

    Two or more species of Ciborinia cause a leaf spot on  trees of all ages. When the disease is severe, small trees may be  killed, but older ones rarely die. Marssonina populi causes  a leaf spot and shoot blight that is especially prevalent and  damaging in the western states. It is responsible for occasional  severe defoliation. Severe, repeated infection can cause  mortality, although susceptibility to this disease varies greatly  among clones. Another leaf spot of aspen is caused by Septoria  musiva.

    Several leaf rust fungi of the genus Melampsora infect  aspen. M. medusae is common east of the Rocky  Mountains. M. abietis-canadensis occurs throughout the  range of eastern hemlock (Tsuga canadensis) and M.  albertensis in the West. All can discolor and kill aspen leaf  tissue and cause premature autumn leaf drop, but their damage is  not serious.

    Powdery mildew, Erysiphe cichoracearum in the West and the  widespread Uncinula salicis can be conspicuous on aspen  leaves but probably do little damage.

    Recently, viruses have been detected in a few quaking  aspen clones. Once trees in the clone are infected, regeneration  by suckering maintains the infection, which is then impossible to  eliminate except by artificially culturing virus-free tissue. The  full extent and seriousness of viruses in aspen is unknown but  decline of some clones has been attributed to them in both the  East and the West.

    Stain and decay have the greatest direct impact of the many stem  pathogens on wood production. The role of microorganisms  frequently associated with discoloration is poorly understood  because staining also develops in their absence. Bacteria and  yeast organisms are commonly associated with "wetwood,"  a water-soaked condition of live trees that leads to wood  collapse during lumber drying.

    A number of different bacteria and fungi are found in aspen  tissue, apparently interacting to follow one another  successionally, with bacteria appearing first. Phellinus  tremulae causes a white rot of the heartwood at first but may  eventually invade the entire stem. It causes the greatest volume  of aspen decay and is so prevalent it conceals rot caused by  other fungi. Sporophores (fruiting bodies) are the most reliable  external indicator of decay. They provide a means to estimate  present and future decay. Resistance to this fungus is strongly  genetically controlled. Incidence and extent of infection  increases with tree age or size but is not strongly related to  site (76).

    Peniophora polygonia is the second most important trunk  rot fungus in the West and in Alaska, but it causes little actual  cull. Libertella spp. is also an important trunk rot  fungus in the West. Other less important trunk rot fungi found on  aspen include Radulodon caesearius, Peniophora polygonia, P.  rufa, and Pholiota adiposa.

    More fungi species cause butt and root rots than trunk rots-as  much as one-third of the decay volume in Colorado. Collybia  velutipes is found in Alaska and causes the greatest amount  of butt cull in the West. Ganoderma applanatum may be as  important because it also decays large roots, which leads to  windthrow. Less important butt rot fungi include Pholiota  squarrosa, Gymnopilus spectabilis, Peniophora polygonia, and  Armillaria mellea. The latter is primarily a root rot which  can infect a high proportion of the trees (74). Other locally  important root rots in the West include Phialophora spp. and  Coprinus atramentarius.

    Stem cankers are common diseases of aspen that have a great impact  on the aspen resource. Depending on the causal fungus, cankers  can kill a tree within a few years or persist for decades.  Hypoxylon canker caused by Hypoxylon mammatum is probably  the most serious aspen disease east of the Rockies, killing 1 to  2 percent of the aspen annually. It is not an important disease  in the West, nor has it been found in Alaska. The infection mode  of Hypoxylon is poorly understood but seems to be related  to ascospore germination inhibitors in bark. Most canker  infections seem to originate in young branches with scars or  galls formed by twig-boring insects (4). Once infected, the host  bark tissue is rapidly invaded and the fungus girdles and kills  the tree in a few years (5).

    Ceratocystis canker is a target-shaped canker caused by Ceratocystis  fimbriata, C. moniliformis, C. piceae, C. pluriannulataC. ambrosia, C. cana, C. serpens, C. crassivaginata, C. populina,  C. tremuloaurea, and C. alba. This canker is found  throughout the range of aspen, with C. fimbriata the most  common causal pathogen. These cankers seldom kill aspens but can  reduce usable volume of the butt log. Infection is primarily  through trunk wounds and insects are the primary vectors.

    Sooty-bark canker of aspen is caused by Phibalis pruinosa and  is common and a major cause of mortality in Alaska and the West.  The fungus infects trunk wounds and spreads rapidly, killing  trees of all sizes. The fungus has been found only as an  innocuous bark saprophyte on quaking aspen in the East.

    Cytospora canker is caused by Cytospora chrysosperma, a  normal inhabitant of aspen bark. The fungus is not considered a  primary pathogen and causes cankers, lesions, or bark necrosis  only after the host tree has been stressed, such as by drought,  fire, frost, suppression, or leaf diseases. The disease is most  serious on young trees and is found throughout the range of  aspen.

    Dothichiza canker, caused by Dothichiza populea, occurs in  the eastern range of aspen. It is an endemic disease of young or  weakened trees and is not found in vigorous stands.

    In Ontario, a canker caused by Neofabraea populi has been  found on young aspen. Few trees have been killed by it, however,  and the disease is not known in the United States.

    Cryptosphaeria populina cause a long, narrow, vertical  canker that may spiral around an aspen trunk for 1 to 6 in (3 to  20 ft) or more. It is common in the West as far north as Alaska.  Trees with large cankers have extensive trunk rot and are  frequently broken by wind.

    Aspen is susceptible to three types of rough-bark which are caused  by the fungi Diplodia tumefaciens, Rhytidiella baranyayiand Cucurbitaria staphula. Rough, corky bark  outgrowths persist for many years but do little harm.

    Quaking aspen hosts a wide variety of insects (28,81). One  Canadian survey recorded more than 300 species, but only a few  are known to severely damage trees. They may be grouped into  defoliators, borers, and sucking insects.

    Defoliators of aspen belong primarily to the orders Lepidoptera  and Coleoptera. The forest tent caterpillar (Malacasoma  disstria) and the western tent caterpillar (M.  californicum) have defoliated aspens over areas as large as  259 000 km² (100,000 mi²). Outbreaks usually persist  for 2 to 3 years and may collapse as quickly as they begin (88).  Aspen growth losses during defoliation have been as high as 90  percent and may take as long as 3 or 4 years for total growth  recovery. Some trees never recover and die as much as 20 to 80  percent of them on poor sites (90). On good sites mortality may  be restricted to suppressed trees (59).

    The large aspen tortrix (Choristoneura conflictana) is  found throughout the range of aspen. It has defoliated trees over  an area as large as 25 900 km² (10,000 mi²) in Canada  and Alaska. Caterpillars predominantly infest the leaves of early  flushing clones (89). Outbreaks normally collapse in 2 or 3 years  and, although aspen growth is reduced, few trees are killed.

    In the East, aspen is a favored host for the gypsy moth (Lymantria  dispar) and the satin moth (Leucoma salicis) (78).

    A great number of leaf tiers defoliate aspen. Sciaphila duplex  is one that is often associated with the large aspen tortrix  and has been a major pest in Utah. Other Lepidopterous  defoliators of aspen include the Bruce spanworm, Operophtera  bruceata, and Lobophora nivigerata.

    Three species of leaf-rolling sawflies of the genus Pontania  sometimes erupt in local outbreaks in the Lake States. Anacampsis  niveopulvella is a Lepidopterous leaf roller that causes  local damage in the West. Sawflies of the Platycampus genus  chew holes in leaves.

    The more common leaf miners of aspen are aspen leaf miner (Phyllocnistis  populiella), the aspen blotch miners (Phyllonorycter  tremuloidiella and Lithocolletis salicifoliella), and  a leaf-mining sawfly (Messa populifoliella).

    Defoliating beetles include the aspen leaf beetle (Chrysomela  crotchi), the cottonwood leaf beetle (C. scripta), the  American aspen beetle (Gonioctena americana), and the  gray willow leaf beetle (Pyrrhalta decora). All have  similar feeding habits; the larvae skeletonize lower surfaces of  leaves, and adults feed on whole leaves.

    Wood-boring insects that attack aspen are primarily beetles of the  Cerambycidae (round-headed borers or long-horned beetles) and  Buprestidae (flatheaded borers or metallic beetles). The poplar  borer (Soperda calcarata) is the most damaging. The  larvae tunnel in the bole, weakening and degrading the wood.  Breakage by wind increases and the tunnels serve as infection  courts for wood-rotting fungi. S. moesta is a  smaller related borer that attacks small suckers and aspen twigs.  It is important only in the West. Xylotrechus obliteratus  has killed large areas of aspen in the West above 2130 in  (7,000 ft).

    The root-boring saperda (Saperda calcarata) feeds on  phloem and outer sapwood near the base of young aspen suckers.  Oviposition incisions of the poplar gall saperda (S. inornata)  frequently cause globose galls to form on the stems of young  suckers and on small branches of larger trees. These oviposition  wounds can serve as infection sites for Hypoxylon that can then  grow from a branch gall down into the bole of the tree causing a  canker (4). The poplar branch borer (Oberea schaumi) attacks  larger suckers and tree limbs. Damage by all these insects can  lead to stem breakage. Site quality is not an important variable,  and maintaining high stocking density of vigorous suckers is the  best practice to minimize loss.

    Two flatheaded borers, the bronze poplar borer (Agrilus  liragus) and the aspen root girdler (A. horni),  bore galleries that disrupt nutrient and water movement. The  former attacks sucker stems and makes zig-zag galleries; the  latter girdles the sucker with a spiral gallery from the lower  trunk to the roots and back. A. anxius
also girdles and  kills aspen twigs in the West.

    Some other Buprestids attacking aspen in the East are the  flatheaded apple tree borer (Chrysobothris femorata), the  Pacific flatheaded borer (C. mali), and the  flatheaded aspen borers (Dicerca tenebrica, D. divaricataand Poecilonota cyanipes). The first two and the  latter are also reported in the West, along with the aspen  ambrosia beetle (Typodendron retusum). None of these  cause serious injury in well-managed stands.

    A widespread weevil, the poplar and willow borer, Cryptorhynchus  lapathi, can riddle aspen stems with galleries, especially  planted trees.

    A clear-wing moth of the genus Aegeria, and willow shoot  sawfly (Janus abbreviatus) are examples of borers from  nonbeetle families.

    In the West, the fungus Ceratocystis fimbriata is carried  by Epurea spp., Nudobius spp., and Rhisophagus  spp. (28).

    Sucking insects are represented mainly by aphids and leafhoppers.  The poplar vagabond aphid (Mordvilkoja vagabunda) causes  a peculiar curled and twisted gall of leaves as large as 5 cm (2  in) in diameter at the tip of twigs. Poplar petiole gall and twig  gall aphids of the genus Pernphigus produce swellings on  leaf petioles. Increased forking of aspen suckers may be caused  by high populations of the speckled poplar aphid (Chaitophorus  populicola) and the spotted poplar aphid (Aphis  maculatae). They are commonly found on expanding aspen sucker  leaves (35,81).

    The genera Idiocerus, Oncomtopia, Macropsis, Oncopsis, and  Agallia have several species of leafhoppers that cause  leaf browning and slitlike ruptures in the bark of twigs. Only  Idiocerus spp. have been found in the West. Several  species of scale insects such as the oystershell scale (Lepidosaphes  u1mi) are found on aspen but do little damage to healthy  trees. Cutworms (moth family Noctuidae larvae) sometimes can cut  a large number of succulent new suckers at the ground line. Black  carpenter ants (Camponotus pennsylvanicus) frequently use  and extend the tunneling made by the poplar borer, causing  further damage (35,78).

    Aspen is highly susceptible to fire damage. Fires may kill trees  outright or cause basal scars that serve as avenues of entrance  for wood-rotting fungi. Intense fires can kill or injure surface  roots and thereby reduce sucker regeneration (19,56,78).

    Early spring frosts may kill new leaves and shoots and, when  especially severe, some of the previous year's shoots. Overwinter  freezing can cause frost cracks. Strong wind can uproot or break  mature aspen and even moderate wind can crack the bole of trees  with lopsided crowns. Hail can bruise the bark of young aspen  and, in severe storms, kill entire sapling stands. Aspen suffers  little from ice storms or heavy wet snow, except when in leaf.  Snow creep on steep slopes can bend or break aspen suckers as  tall as 1.2 in (4 ft) (28).

    Aspen suddenly exposed to full sunlight may suffer sunscald.  Pole-size trees are more susceptible than saplings (19,58).

    Aspen growth and vigor suffer from drought (79), and  drought- stressed trees become predisposed to secondary agents  such as insects and disease. Mechanical injuries inflicted on  aspen bark by thoughtless recreationists can lead to infection by  canker disease and eventual death in as few as 10 to 20 years.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Considerations

More info for the terms: cover, fuel, fuel moisture, headfire, litter, prescribed fire, shrubs

Prescribed fire is recommended for quaking aspen [2,25,123,143].
Currently, an estimated 600 acres (240 ha) of quaking aspen burns per
year in the Intermountain Region.  At that rate, it will require 12,000
years to burn the entire quaking aspen type in that Region.  It is
likely that seral quaking aspen will be replaced by conifers; stable
quaking aspen stands may become less productive [46].  In many areas of
the West, quaking aspen stands have lived longer than they did prior to
fire exclusion, and many stands are in a state of decline due to
advanced age [62].  Gruell and Loope [69] found that in Jackson Hole,
Wyoming, quaking aspen stands begin to deteriorate after about 80 years.
Houston [80] stated in 1973 that quaking aspen in Yellowstone National
Park were primarily large trees ranging from 75 to 120 years of age.

Applying fire:  Prescribed fire is often difficult to apply in quaking
aspen stands because of the prominence of live fuels and often sparse
distribution of fine dead fuels [25].  Even if fuels are plentiful, they
are usually too moist to burn easily.  Prescribed fire may be possible,
however, when live vegetation cures enough to contribute to fire spread
rather than hinder it.  The combination of dry weather and cured fuels
occurs most often in early spring, late summer, and fall [131,138].  The
forest floor of a quaking aspen stand immediately after snowmelt is
covered by matted, cured surface vegetation and deciduous leaf litter.
Before leaf-out this mat is directly exposed to drying by wind and sun,
which increase fuel temperature and decrease fuel moisture.  Without
rain, the withered leaves in the litter begin to curl, resulting in a
more favorable fuelbed for combustion and heat transfer.  In Alberta,
these moderately severe, early season burning conditions can persist
from snowmelt until the first week in June [131].

In most years, leaf fall and autumn precipitation coincide, making fall
burning difficult.  If September and October are dry, however, burning
may be possible.  Surface fuels are dead and sometimes frozen, with a
continuous layer of loosely packed leaves, making quaking aspen more
flammable than at any other time of year [138].

Live fuel moisture varies greatly between understory species throughout
the growing season, but can be estimated well enough to determine when
to light prescribed fires.  Brown and others [25] estimated that when
herbaceous vegetation is the primary fine fuel, at least 50 percent
curing is needed to sustain fire spread.  Less than 50 percent curing
may be sufficient in stands with substantial conifers.  Brown and
Simmerman [28] provide a method for appraising fuels and flammability in
quaking aspen to assist managers in choosing when to apply prescribed
fire and help determine proper conditions for burning.  Five fuel types
in 19 community types common in the Intermountain West are presented,
accompanied by color photographs.

Prescriptions:  Aspen parkland and northern forest - Bailey [174,175]
found that in Alberta, prescribed burning in quaking aspen forests and
parklands in spring was usually not successful above relative humidity
of 35 to 40 percent.  He recommended that prescribed burning be
conducted 8 to 10 drying days after snowmelt, when air temperature is at
least 64 degrees Fahrenheit (18 deg C), relative humidity is less than
30 percent, and 3.3-foot (10-m) open winds are 5.4 to 21 miles per hour
(9-35 km/hr).

Bailey and Anderson [173] reported that in central Alberta, quaking
aspen forest in a grassland-shrub-quaking aspen forest mosaic was the
most difficult of the three vegetation types to prescribe burn.  With
spring burning, backfires consistently gave poor results, frequently
going out within a few feet of ignition and yielding a maximum
temperature of only 550 degrees Fahrenheit (288 deg C).  Headfires were
hotter but gave variable results.  Most headfire temperatures ranged
from 700 to 900 degrees Fahrenheit (371-482 deg C), but 14 percent were
in excess of 1,112 degrees Fahrenheit (600 deg C).  Fire and fuel data
from the quaking aspen sites follow.

________________________________________________
| fire temperature        393 +/-  28* (deg C) |       
| total fuel           13,436 +/- 354  (kg/ha) |  
| ground fuel          11,704 +/- 337  (kg/ha) |    
| standing woody fuel   1,732 +/- 181  (kg/ha) |    
|______________________________________________|

*standard error of the mean (SEM)

Perala [119] recommended this prescription for burning quaking aspen
slash in the Great Lake States:

______________________________________________________________________
Months for burning          dormant season
                              (all but June, July, & August)
Fuel model*                 D
Air temperature             > 65 degrees Fahrenheit (18 deg C)
Relative humidity           < 35%
Ignition component*         40-50
Energy release component*   14-17
Spread component*            4-7
Burning index*              13-21
Wind**                       2.5-5 m/s
Number of days with less              
  than 2.5 mm rain         > 5     
______________________________________________________________________
*from the National Fire-danger Rating System [176]
**measured 20 ft. above ground, or at average height of vegetation
    cover, averaged over at least a 10-minute period

Canadian Forest Fire Behavior Prediction (FBP) System :  Alexander and
Maffey [1] provide examples for predicting fire spread rate, fuel
consumption, and frontal intensity in quaking aspen types using the FBP
System. 

Forage quality and fire:  Three burned quaking aspen/shrub/tall forb
communities on the Caribou National Forest, Wyoming, showed increased
forage quality (better Ca:P ratios, higher elk digestibility, and higher
crude protein and P levels) than adjacent unburned sites during the
first postfire year.  By the second postfire year, there were no
significant differences between forage quality on burned and unburned
sites.  Shrubs on the unburned sites were above browse level throughout
the study period, however, while shrubs on the burned site were still
accessible to elk in the second postfire year [47].
  • 1.  Alexander, Martin E.; Maffey, Murray E. 1993. Predicting fire behavior        in Canada's aspen forests. Fire Management Notes. 53/54(1): 10-13.        [20938]
  • 2.  Anderson, Murray L.; Bailey, Arthur W. 1979. Effect of fire on a        Symphoricarpos occidentalis shrub community in central Alberta. Canadian        Journal of Botany. 57: 2820-2823.  [2867]
  • 25.  Brown, J. K.; Booth, G. D.; Simmerman, D. G. 1989. Seasonal change in        live fuel moisture of understory plants in western U.S. aspen. In:        MacIver, D. C.; Auld, H.; Whitewood, R., eds. Proceedings of the 10th        conference on fire and forest meteorology; 1989 April 17-21; Ottawa, ON.        [Place of publication unknown]
  • 28.  Brown, James K.; Simmerman, Dennis G. 1986. Appraising fuels and        flammability in western aspen: a prescribed fire guide. Gen. Tech. Rep.        INT-205. Ogden, UT: U.S. Department of Agriculture, Forest Service,        Intermountain Research Station. 48 p.  [544]
  • 46.  DeByle, Norbert V.; Bevins, Collin D.; Fischer, William C. 1987.        Wildfire occurrence in aspen in the interior western United States.        Western Journal of Applied Forestry. 2(3): 73-76.  [774]
  • 47.  DeByle, Norbert V.; Urness, Philip J.; Blank, Deborah L. 1989. Forage        quality in burned and unburned aspen communities. Res. Pap. INT-404.        Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain        Research Station. 8 p.  [6588]
  • 62.  Gordon, Floyd A. 1976. Spring burning in an aspen-conifer stand for        maintenance of moose habitat, West Boulder River, Montana. In:        Proceedings, Montana Tall Timbers fire ecology conference and        Intermountain Fire Research Council fire & land management symposium;        1974 October 8-10; Missoula, MT. No. 14. Tallahassee, FL: Tall Timbers        Research STation: 501-538.  [13529]
  • 69.  Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and        ungulate browsing in Jackson Hole, Wyoming. Lakewood, CO: U.S.        Department of the Interior, National Park Service, Rocky Mountain        Region. 33 p. In cooperation with: U.S. Department of Agriculture,        Forest Service, Intermountain Region.  [3862]
  • 80.  Houston, Douglas B. 1973. Wildfires in northern Yellowstone National        Park. Ecology. 54(5): 1111-1117.  [5781]
  • 119.  Perala, Donald A. 1974. Prescribed burning in an aspen-mixed hardwood        forest. Canadian Journal of Forest Research. 4: 222-228.  [5816]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 131.  Quintilo, D.; Alexander, M. E.; Ponto, R. L. 1991. Spring fires in a        semimature trembling aspen stand in central Alberta. Information Report        NOR-X-323. Edmonton, AB: Forestry Canada, Northwest Region, Northern        Forestry Centre. 30 p.  [19243]
  • 138.  Rothwell, R. L.; Woodard, P. M.; Samran, S. 1991. The effect of soil        water on aspen litter moisture content. In: Andrews, Patricia L.; Potts,        Donald F., eds. Proceedings, 11th conference on fire and forest        meteorology; 1991 April 16-19; Missoula, MT. Bethesda, MD: Society of        American Foresters: 117-123.  [26671]
  • 143.  Schier, George A.; Campbell, Robert B. 1978. Aspen sucker regeneration        following burning and clearcutting on two sites in the Rocky Mountains.        Forest Science. 24(2): 303-308.  [3657]
  • 173.  Bailey, Arthur W.; Anderson, Murray L. 1980. Fire temperatures in grass,        shrub and aspen forest communities of central Alberta. Journal of Range        Management. 33(1): 37-40.  [6937]
  • 174.  Bailey, Arthur W. 1978. Prescribed burning as an important tool for        Canadian rangelands. In: Proceedings of the fire and range seminar; 1978        April; Regina,   .wegina, SK. Saskatchewan Department of Agriculture,        Lands Branch, Regina, SK, and Department Reg. Econ. Expansion-PFRA, Land        Use Service, Regina, SK: 15-27.  [18390]
  • 175.  Bailey, Arthur W. 1978. Use of fire to manage grasslands of the Great        Plains: Northern Great Plains and adjacent forests. In: Hyder, Donald        N., ed. Proceedings, 1st international rangeland congress; 1978 August        14-18; Denver, CO. Denver, CO: Society for Range Management: 691-693.        [372]
  • 176.  Deeming, John E.; Lancaster, James W.; Fosberg, Michael A.; [and        others]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Plant Response to Fire

More info for the terms: fire use, mixed-severity fire, prescribed fire, restoration

These Research Project Summaries provide information on prescribed fire use and
postfire response of plant species associates in quaking aspen communities:From the Colorado fire study just above, the Fire Case Study Prescribed fire behavior and quaking aspen recovery in Colorado's Front Range
provides a more detailed description of prescribed fire's effects on quaking aspen.

For further information on quaking aspen response to fire, see the other Fire Case Studies in this species summary.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the terms: basal area, density, fire severity, litter, prescribed fire, presence, severity, surface fire, wildfire

A prescribed fire in a black spruce-paper birch-quaking aspen community in boreal Alaska. Photo courtesy of US Forest Service, FROSTFIRE.

Quaking aspen sprouts from the roots and establishes from off-site,
wind-blown seed after fire [27,123,157].  It is the classic soboliferous
species described by Stickney [157]:  a plant that sprouts from
carbohydrate-storing lateral roots (sobols).

Sprouting:  Quaking aspen generally sprouts vigorously after fire.
Long-term growth and survival of quaking aspen sprouts depend on a
variety of factors including prefire carbohydrate levels in roots,
sprouting ability of the clone(s), fire severity, and season of fire.
Moderate-severity fire generally results in dense sprouting.  Fewer
sprouts may be produced after severe fire.  Since quaking aspen is
self-thinning, however, sprouting densities are generally similar
several years after moderate and severe fire.  A low-severity surface
fire may leave standing live trees that locally suppress sprouting,
resulting in an uneven-aged stand [12,13,28,123].

Quaking aspen burned in spring generally sprouts later in the growing
season and again the following year.  Fires in mid-growing season
generally result in late-season sprouting.  Quaking aspen burned in late
summer or fall usually sprouts the next spring [28].

Predicting postfire sprouting:  Applying prescribed fire in exclosures
in Yellowstone National Park, Renkin and Despain [133] found that root
biomass can be estimated from basal area, and both can be used to
predict local response of quaking aspen to burning.  Sprout biomass
produced in postfire year 1 was positively correlated (r2=0.90, p=0.013)
with both prefire basal area and root biomass.  On average, 11.5 metric
tons per hectare of root mass were required to produce 0.1 metric ton
per hectare of sprouts.  Average sprout height was positively correlated
with basal area and root biomass (r2=0.85, p=0.004).  On average, 25
square meters per hectare of basal area and/or 19 metric tons per
hectare of root biomass were required to produce 0.5 meter of sprout
growth.

Examples of sprouting:  After the 1988 fires in Yellowstone National
Park, percentage of sprouts produced in spring, 1989, was significantly
higher (p=0.030) in burned stands (mean 82%) than on unburned stands
(mean 60%).  The percentage of sprouts in fall, 1989, was also higher
(p=0.103) on burned stands (mean 82%) than in unburned stands (mean
65%).  In spring 1990, sprout density averaged 80,000 stems per hectare
in burned stands and 27,000 stems per hectare in unburned stands.  By
fall 1991, density was 38,000 stems per hectare in burned and 25,000
stem per hectare in unburned stands, respectively.  Mean heights were
9.6 inches (24 cm) in spring 1990 and 10.8 inches (27 cm) in spring
1991.  Browsing intensity was much higher in winter and spring (45-55%
of sprouts browsed) than summer and fall (5-10%).  There were no
significant differences in browsing among burned stands, unburned stands
adjacent to burned stands, and remote unburned stands:  Sprouts were
heavily browsed in all stand types [137].

Birch-aspen:  Following a 1944 summer wildfire in Maine, quaking aspen
and paper birch sprouted vigorously, forming a dense stand.  In 1951,
there were 40,000 to 45,000 stems (both spp.) per acre.  Quaking aspen
dominated the stand; it averaged 20 feet (6 m) in height while paper
birch averaged only 6 feet (1.8 m) [96].

Birch-aspen:  Following a 1944 summer wildfire in Maine, quaking aspen
and paper birch sprouted vigorously, forming a dense stand.  In 1951,
there were 40,000 to 45,000 stems (both spp.) per acre.  Quaking aspen
dominated the stand; it averaged 20 feet (6 m) in height while paper
birch averaged only 6 feet (1.8 m) [96].

Southwestern mixed conifer:  Quaking aspen sprouted after the Walker Wildfire
on the Santa Fe National Forest of New Mexico.  The Walker Fire occurred in
mixed-conifer forest with an overstory of Engelmann spruce (P. engelmannii),
Douglas-fir (Pseudotsuga menziesii), quaking aspen (Populus tremuloides),
and ponderosa pine (Pinus ponderosa).  The litter layer was deep prior to the
wildfire.  The fire was a moderate-severity surface fire that consumed
understory conifers and hardwoods (mainly quaking aspen).  Overstory foliage
was killed by heat from the surface fire. The Walker Fire top-killed most of the
quaking aspen stems.  Eighteen months after the fire, 1 acre of the Walker Burn
was fenced to exclude deer, elk, and cattle.  Wildfire significantly increased
the number of quaking aspen sprouts.  Five-year average sprout density was 12,960
sprouts per acre on the burn compared to 100 sprouts per acre in adjacent unburned
forest and 200 and 500 sprouts per acre on similar spruce-fir types in Arizona.
In 1964, quaking aspen sprouts on the burn were less then 3 feet (0.9 m)
tall, so ungulates could browse them easily.  By June 1968, sprouts were
8 to 10 feet (2.4-3 m) tall, and getting out of reach as a food supply.
Cattle and wildlife use on the burned area did not significantly affect
quaking aspen sprout density; the number of sprouts was similar inside
and outside the exclosure [115].

For further examples of quaking aspen sprouting response after fire,
refer to the FIRE CASE STUDIES section.  Cases from Arizona,
Colorado, Wyoming, Minnesota, and Alberta are presented.

Seedling Establishment:  Fire exposes mineral soil, which is an
excellent seedbed for quaking aspen [61].  Quaking aspen seedlings have
been noted following severe fire in Canada.  Six years after fire in
northeastern Wisconsin, quaking aspen seedlings composed 20 to 35
percent of seedlings of all species present on the burn [79].  Kay [90]
reported good seedling establishment following 1986 fires in Grand Teton
National Park and 1988 fires in Yellowstone National Park.  Height
growth was negligible, however, due to ungulate browsing.  Density,
height, and ungulate use of quaking aspen seedlings on the Yancy's Hole
Burn, Yellowstone National Park, were [90]:
_____________________________________________________________________
Transect #     Year     Number/ha      % browsed     Mean height (cm)

     1         1989      177,202           --              62 
               1991       32,154          100              50

     2         1989      141,362           --              60
               1991       46,148          100              57

     3         1989      109,522           --              53
               1991       16,660          100              75
__________________________________________________________________
   Mean        1989      142,695           --              58
               1991       31,654          100              47

Renkin and others [134] are conducting a similar seedling study on
forested and nonforested sites in Yellowstone National Park; only
preliminary data are available at this time.  They found that quaking
aspen seedlings were concentrated on wet microsites but widely scattered
on other site types.  In 1989, quaking aspen seedling density on 14
plots ranged from 0.6 to 1,014 per square meter; average height ranged
from 2.3 to 11.1 inches (mean=5.1 inches) (5.7-27.8 cm, mean= 12.8 cm).
Quaking aspen seedlings were two to four times taller than lodgepole
pine seedlings on forested plots.  In 1990, all plots had persistent
quaking aspen seedlings; in some cases the stem had died back but the
1-year-old roots had produced suckers.  Density of surviving seedlings
ranged from 0.05 to 332 per square meter.  Average heights had
increased, ranging from 3.6 to 15.6 inches (mean=7.8 in) (9-39 cm,
mean=19.4 cm).  Quaking aspen seedlings on fenced plots averaged 12
inches (30 cm) in height; seedlings on unfenced plots averaged 5.36
inches (13.4 cm).  Seedling survival was significantly greater (p=0.004)
on forested than nonforested plots.  Survival was also influenced by
presence of ungulates, spring flooding, disease, and intraspecific
competition.  Ungulate presence negatively influenced seedling survival
on unfenced plots (r=0.97, p=0.004).  Plots submerged in spring showed
high seedling mortality.  A fungus (Venturia tremulae) also contributed
to seedling death or dieback [134].
  • 12.  Bartos, Dale L.; Mueggler, Walter F. 1979. Influence of fire on        vegetation production in the aspen ecosystem in western Wyoming. In:        Boyce, Mark S.; Hayden-Wing, Larry D., eds. North American elk, ecology,        behavior and management. Laramie, WY: University of Wyoming: 75-78.        [5101]
  • 13.  Bartos, D. L.; Mueggler, W. F. 1981. Early succession in aspen        communities following fire in western Wyoming. Journal of Range        Management. 34(4): 315-318.  [5100]
  • 27.  Brown, James K.; DeByle, Norbert V. 1989. Effects of prescribed fire on        biomass and plant succession in western aspen. Res. Pap. INT-412. Ogden,        UT: U.S. Department of Agriculture, Forest Service, Intermountain        Research Station. 16 p.  [9286]
  • 28.  Brown, James K.; Simmerman, Dennis G. 1986. Appraising fuels and        flammability in western aspen: a prescribed fire guide. Gen. Tech. Rep.        INT-205. Ogden, UT: U.S. Department of Agriculture, Forest Service,        Intermountain Research Station. 48 p.  [544]
  • 61.  Godman, Richard M.; Mattson, Gilbert A. 1976. Seed crops and        regeneration problems of 19 species in northeastern Wisconsin. Res. Pap.        NC-123. St. Paul, MN: U.S. Department of Agriculture, Forest Service,        North Central Forest Experiment Station. 5 p.  [3715]
  • 79.  Horton, K. W.; Hopkins, E. J. 1966. Influence of fire on aspen        suckering. Department of Forestry Publication No. 1095. Ottawa, ON:        Canadian Ministry of Forestry. 19 p.  [3694]
  • 90.  Kay, Charles E. 1993. Aspen seedlings in recently burned areas of Grand        Teton and Yellowstone National Parks. Northwest Science. 67(2): 94-104.        [21653]
  • 96.  LaBonte, George A.; Leso, Robert J. 1990. Cleaning paper birch in a        birch-aspen stand in Maine: a 34 year case history. Northern Journal of        Applied Forestry. 7: 22-23.  [26668]
  • 115.  Patton, David R.; Avant, Herman D. 1970. Fire stimulated aspen sprouting        in a spruce-fir forest in New Mexico. RM-159. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 3 p.  [6941]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 133.  Renkin, Roy; Despain, Don. 1994. Suckering in burned aspen as related to        above-ground and below-ground biomass. In: Despain, Don G., editor.        Plants and their environments: proceedings of the 1st biennial        scientific conference on the Greater Yellowstone Ecosystem; 1991        September 16-17; Yellowstone National Park. Tech. Rep.        NPS/NRYELL/NRTR-93/XX. Denver, CO: U.S. Department of the Interior,        National Park Service, Rocky Mountain Region, Yellowstone National Park:        341-343. [Abstract]
  • 134.  Renkin, Roy; Despain, Don; Clark, Dave. 1994. Aspen seedlings following        the 1988 Yellowstone fires. In: Despain, Don G., editor. Plants and        their environments: proceedings of the 1st biennial scientific        conference on the Greater Yellowstone Ecosystem; 1991 September 16-17;        Yellowstone National Park. Tech. Rep. NPS/NRYELL/NRTR-93/XX. Denver, CO:        U.S. Department of the Interior, National Park Service, Rocky Mountain        Region, Yellowstone National Park: 335-337. [Abstract]
  • 137.  Romme, William H.; Turner, Monica G.; Wallace, Linda L.; Walker,        Jennifer S. 1995. Aspen, elk, and fire in northern Yellowstone National        Park. Ecology. 76(7): 2097-2106.  [25945]
  • 157.  Stickney, Peter F. 1989. Seral origin of species originating in northern        Rocky Mountain forests. Unpublished draft on file at: U.S. Department of        Agriculture, Forest Service, Intermountain Research Station, Fire        Sciences Laboratory, Missoula, MT; RWU 4403 files. 7 p.  [20090]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Fire

More info for the terms: severity, tree, wildfire

Fire may kill (as opposed to top-kill) a deteriorating stand of quaking
aspen.  A deteriorating stand on the Sweetwater drainage of the Wind
River Mountains, Wyoming, failed to sprout following a 1963 wildfire.
However, another 1963 wildfire in the Wind River Mountains, near
Pinedale, had the opposite effect on a deteriorating stand of quaking
aspen.  Although the site was considered poor for quaking aspen due to
dry, sandy soil, fire only top-killed the stand.  Browsing pressure on
sprouts was light, and postfire stocking was "more than adequate" for
regeneration [69].

The position of an individual tree on a slope, or within a stand, can
influence the degree of damage caused by fire.  Even when damaged, trees
located near the boundaries of a fire can often maintain a live crown.
These peripheral trees may receive food supplies from the roots of
unburned neighbors.  Quaking aspen on slopes generally show greater
damage than do trees on flatter areas.  Flames moving uphill often curl
up the lee side of trees when fanned by upslope wind, charring the stem
further up its bole.  The effect of slope is particularly pronounced (up
to 31-44% higher char heights) after fires of higher severity.  This
relationship is presented in the following table [26]:

                              Probability of mortality
                              ________________________
                                0.90          0.95
                              ________________________
     dbh (cm)                   Average char height -
      10                          5               12
      15                         14               21
      20                         23               30
      25                         32               39

                                 Uphill char height -
      10                          6               16
      15                         19               29
      20                         31               42
      25                         44               55
  • 26.  Brown, James K.; DeByle, Norbert V. 1987. Fire damage, mortality, and        suckering in aspen. Canadian Journal of Forest Research. 17: 1100-1109.        [5099]
  • 69.  Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and        ungulate browsing in Jackson Hole, Wyoming. Lakewood, CO: U.S.        Department of the Interior, National Park Service, Rocky Mountain        Region. 33 p. In cooperation with: U.S. Department of Agriculture,        Forest Service, Intermountain Region.  [3862]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

More info for the term: tree

Small-diameter quaking aspen is usually top-killed by low-severity
surface fire [88].  Brown and DeByle [26] found that as dbh increases
beyond 6 inches (15 cm), quaking aspen becomes increasingly resistant to
fire mortality.  Large quaking aspen may survive low-severity surface
fire, but usually shows fire damage [26,94].  Moderate-severity surface
fire top-kills most quaking aspen, although large-stemmed trees may
survive.  Some charred stems that survived low- or moderate-severity
fire initially have been observed to die within 3 or 4 postfire years.
Severe fire top-kills quaking aspen of all size classes.

Moderate-severity fire does not damage quaking aspen roots insulated by
soil.  Severe fire may kill roots near the soil surface or damage
meristematic tissue on shallow roots so that they cannot sprout.  Deeper
roots are not damaged by severe fire and retain the ability to sucker
[69,160,143,146].

Mortality does not always occur immediately after fire.  Sometimes buds
in the crown will survive and leaf out prior to the death of the tree
[26].  Brown and DeByle [26] reported that quaking aspen trees died over
a 4-year period following fires in Wyoming and Idaho, although most
individuals succumbed by the second postfire year.  Even when quaking
aspen is not killed outright by fire, the bole may be sufficiently
damaged to permit the entrance of wood-rotting fungi [94].  According to
Jones and DeByle [88], basal scars which lead to destructive heart rot
can be made on even good-sized aspen by "the lightest of fires."  Basal
fire scars may also permit entry of borers and other insects which can
further weaken the tree [23].
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 26.  Brown, James K.; DeByle, Norbert V. 1987. Fire damage, mortality, and        suckering in aspen. Canadian Journal of Forest Research. 17: 1100-1109.        [5099]
  • 69.  Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and        ungulate browsing in Jackson Hole, Wyoming. Lakewood, CO: U.S.        Department of the Interior, National Park Service, Rocky Mountain        Region. 33 p. In cooperation with: U.S. Department of Agriculture,        Forest Service, Intermountain Region.  [3862]
  • 88.  Jones, John R.; DeByle, Norbert V. 1985. Fire. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 77-81.  [11910]
  • 94.  Kovalchik, Bernard L. 1987. Riparian zone associations: Deschutes,        Ochoco, Fremont, and Winema National Forests. R6 ECOL TP-279-87.        Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific        Northwest Region. 171 p.  [9632]
  • 143.  Schier, George A.; Campbell, Robert B. 1978. Aspen sucker regeneration        following burning and clearcutting on two sites in the Rocky Mountains.        Forest Science. 24(2): 303-308.  [3657]
  • 146.  Schier, George A.; Shepperd, Wayne D.; Jones, John R. 1985.        Regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 197-208.        [11921]
  • 160.  Tucker, R. E.; Jarvis, J. M. 1967. Prescribed burning in a white        spruce--trembling aspen stand in Manitoba. Woodlands Review. July: 2-4.        [3641]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the term: tree

   Tree with adventitious-bud root crown/soboliferous species root sucker
   Initial-offsite colonizer (off-site, initial community)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: cover, density, fire suppression, natural, resistance, severity, shrubs, wildfire

Fire adaptations:  Quaking aspen is highly competitive on burned sites
[46].  Even where quaking aspen was a barely detectable component of the
prefire vegetation, it often dominates a site after fire.  Quaking aspen
has adapted to fire in the following ways [41].

1.  The thin bark has little heat resistance, and quaking aspen is
easily top-killed by fire.

2.  Root systems of top-killed stems send up a profusion of sprouts for
several years after fire. 

3.  Sprouts grow rapidly by extracting water, nutrients, and
photosynthate from an extant root system, and may outcompete other woody
vegetation.

4.  Following a fire, a new, even-aged quaking aspen stand can develop
within a decade.

5.  In contrast to most trees, quaking aspen is self-thinning.  Without
intervention, a mature forest of healthy trees can develop from dense
sprouts.

Fire releases sprout primorida on roots from hormonally controlled
growth inhibition; removes canopy shade; and blackens the soil surface,
increasing heat absorption.  Increased soil temperatures aid sprout
production [22,83].  On cold sites, quaking aspen may be unable to
sprout until soil temperatures rise after fire [83].

Quaking aspen is able to naturally regenerate without fire or cutting on
some sites [123], but fire may be required for regeneration on others.
There are areas in Jackson Hole, Wyoming, where ungulate browsing has
been light, both historically and recently, yet stems have not attained
tree size since extensive fires in the 1800's [69].

Fuels and fire behavior:  Fuels are usually more moist in quaking aspen
stands than in surrounding forest.  Crown fires in coniferous forests
often drop to the surface in quaking aspen, or may extinguish after
burning into quaking aspen only a few meters [19,55,138].  Quaking aspen
stands often act as natural fuelbreaks during wildfires [55], and fires
sometimes bypass quaking aspen stands surrounded by conifers [138].  In
an analysis of fires in quaking aspen in National Forests of the
Intermountain West (USFS Regions 2, 3, and 4) from 1970 through 1982,
Bevins [19] reported that wildfires that burned thousands of acres
during extreme weather conditions usually penetrated less than 65 feet
(20 m) into quaking aspen.  Managers he interviewed used the terms
"asbestos type" and "firebreak" to describe quaking aspen stands.  Bevins
reported that mixed quaking aspen-conifer types such as those on the
northern Kaibab and Dixie National Forests did sustain fires, however,
and burned substantial amounts of quaking aspen.  Throughout all three
Regions, a relatively few, large fires (>100 acres burned) accounted for
93.2 percent (or 1.12 million acres) of all quaking aspen burned.

Fire history:  Before and during the mid-nineteenth century, fires were
apparently more frequent, and larger acreages of quaking aspen and
quaking aspen-conifer mixes burned, than any time since.  A large
majority of the quaking aspen stands in Jackson Hole, Wyoming, date from
fires between 1850 and 1890 [69].  In central Utah, Baker [5] and
Meinecke [106] found few quaking aspen fire-scarred later than 1885.
Earlier fire scars were common and showed a 7- to 10-year fire
frequency.  Since quaking aspen is fire-sensitive, the fires were
probably of low severity.  Extensive sampling of quaking aspen in
Colorado found few fire scars dating later than about 1880 [37].

These data indicate that there has been a great reduction of fire
rejuvenation of quaking aspen in the West since about 1900.  Extensive
young stands of quaking aspen are uncommon in the West [65,151,46].
Conifers now dominate many seral quaking aspen stands.  Probable
contributing factors are:

1.  highly effective direct control of wildfires in the last 50 years,
especially in the quaking aspen type [46],

2.  reduction of fine fuels in quaking aspen/grass and quaking
aspen/forb types due to grazing [28,46], and

3.  cessation of deliberate burning by Native Americans [9,68,80].

Ungulates, fire, and quaking aspen:  In most areas, ungulate browsing is
probably not a major factor restricting postfire quaking aspen
regeneration.  Quaking aspen has increased in importance in the East
despite browsing pressure from large white-tailed deer populations.  In
many areas of the United States, elk populations impact quaking aspen
very little.  Browsing elk had no significant impact on quaking aspen
sprout density after wildfire in New Mexico [115].  In some areas,
however, fire suppression coupled with heavy ungulate browsing has
reduced quaking aspen regeneration.  Failure of some stands in the Great
Lakes States to regenerate has been attributed to overbrowsing of
sprouts by white-tailed deer [145].  Overbrowsing has particularly been
noted in northwestern Wyoming, in Yellowstone and Grand Teton National
Parks and the Bridger-Teton National Forest.  Elk are the primary
browsers of quaking aspen in this area, although where moose populations
are high, moose have also removed considerable quaking aspen
regeneration.  Historic narratives and photographic evidence suggest
that ungulates were a major biotic influence on quaking aspen in this
region during the the exploration and settlement periods.  However,
fires were extensive during this period, so postfire sprouting of
quaking aspen and growth of palatable grasses, shrubs, and herbs,
probably produced a forage supply that dispersed browsing ungulates
sufficiently for quaking aspen to regenerate [69].

Coring of old quaking aspen stems in Yellowstone National Park showed
that most live, large quaking aspen established in a brief period
between the 1870's and 1880's:  a period of severe fires followed by
above-normal precipitation.  Elk, moose, and beaver populations were at
a historic low, and some wolves were present.  Neither this combination
of conditions nor significant quaking aspen regeneration has occurred
since then.  Elk populations were low in the 1950's and 1960's, but
fires were suppressed and the climate was dry.  In the 1910's, there
were numerous elk and beaver and few fires.  After the 1988 fires, elk
numbers were high and climatic conditions were dry.  In this region,
even large-scale burning does not seem sufficient for quaking aspen
regeneration [69,90,137].

Prairie:  Frequent fires on prairies and plains grasslands historically
helped control quaking aspen invasion [30].  Fire may have been only one
of several factors controlling quaking aspen, however.  Drought [76] and
ungulate browsing may have worked in conjunction with fire to curtail
woody plant invasion.  Fire alone may not control quaking aspen spread
[32].  Anderson and Bailey [2] reported that 24 years of annual spring
burning checked quaking aspen invasion onto tallgrass prairie, but
actually increased the number and cover of quaking aspen sprouts in the
area.  Elk Island National Park, Alberta, was described by early
settlers as a grassland with scattered quaking aspen groves.  By 1895,
extirpation of bison and severe reduction of other ungulates was
followed by expansion of quaking aspen.  Bison were reintroduced with
Park establishment, but fire was not.  Ungulate populations rose rapidly
and were culled in the 1930's and 1950's.  Grassland expanded with the
ungulates, while quaking aspen expanded when culling occurred [21].
  • 2.  Anderson, Murray L.; Bailey, Arthur W. 1979. Effect of fire on a        Symphoricarpos occidentalis shrub community in central Alberta. Canadian        Journal of Botany. 57: 2820-2823.  [2867]
  • 5.  Baker, Frederick S. 1925. Aspen in the central Rocky Mountain region.        Department Bulletin No. 1291. Washington, DC: U.S. Department of        Agriculture. 47 p.  [15589]
  • 9.  Barrett, Stephen, W.; Arno, Stephen F. 1982. Indian fires as an        ecological influence in the Northern Rockies. Journal of Forestry.        80(10): 647-651.  [12711]
  • 19.  Bevins, Collin D. 1984. Historical fire occurrence in aspen stands of        the Intermountain West. Missoula, MT: Systems for Environmental        Management. Cooperative Agreement 22-C-4-INT-31. 23 p.  [3649]
  • 21.  Blinn, Charles R.; Buckner, Edward R. 1989. Normal foliar nutrient        levels in North American forest trees: A summary. Station Bulletin        590-1989. St. Paul, MN: University of Minnesota, Minnesota Agricultural        Experiment Station. 27 p.  [15282]
  • 22.  Bradley, Anne F.; Noste, Nonan V.; Fischer, William C. 1992. Fire        ecology of forests and woodlands of Utah. Gen. Tech. Rep. INT-287.        Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain        Research Station. 128 p.  [18212]
  • 28.  Brown, James K.; Simmerman, Dennis G. 1986. Appraising fuels and        flammability in western aspen: a prescribed fire guide. Gen. Tech. Rep.        INT-205. Ogden, UT: U.S. Department of Agriculture, Forest Service,        Intermountain Research Station. 48 p.  [544]
  • 30.  Buell, Murray F.; Buell, Helen F. 1959. Aspen invasion of prairie.        Bulletin of the Torrey Botanical Club. 86(4): 264-269.  [14068]
  • 32.  Campbell, Celina; Campbell, Ian D.; Blyth, Charles B.; McAndrews, John        H. 1994. Bison extirpation may have caused aspen expansion in western        Canada. Ecography. 17(4): 360-362.  [25941]
  • 37.  Davidson, Ross W.; Hinds, Thomas E.; Hawksworth, Frank G. 1959. Decay of        aspen in Colorado. Station Paper No. 45. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 14 p.  [26838]
  • 41.  DeByle, Norbert V. 1985. The role of fire in aspen ecology. In: Lotan,        James E.; Kilgore, Bruce M.; Fisher, William C.; Mutch, Robert W.,        technical coordinators. Proceedings--Symposium and workshop on        wilderness fire; 1983 November 15 - November 18; Missoula, MT. Gen.        Tech. Rep. INT-182. Ogden, UT: U.S. Department of Agriculture, Forest        Service, Intermountain Forest and Range Experiment Station: 326.  [7363]
  • 46.  DeByle, Norbert V.; Bevins, Collin D.; Fischer, William C. 1987.        Wildfire occurrence in aspen in the interior western United States.        Western Journal of Applied Forestry. 2(3): 73-76.  [774]
  • 55.  Fechner, Gilbert H.; Barrows, Jack S. 1976. Aspen stands as wildfire        fuel breaks. Eisenhower Consortium Bulletin 4. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 26 p. In cooperation with: Eisenhower        Consortium for Western Environmental Forestry Research.  [7611]
  • 65.  Jourdonnais, Craig S.; Bedunah, Donald J. 1990. Prescribed fire and        cattle grazing on an elk winter range in Montana. Wildlife Society        Bulletin. 18(3): 232-240.  [14113]
  • 68.  Gruell, George E. 1985. Fire on the early western landscape: an        annotated record of wildland fire. Northwest Science. 59(2): 97-107.        [15660]
  • 69.  Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and        ungulate browsing in Jackson Hole, Wyoming. Lakewood, CO: U.S.        Department of the Interior, National Park Service, Rocky Mountain        Region. 33 p. In cooperation with: U.S. Department of Agriculture,        Forest Service, Intermountain Region.  [3862]
  • 76.  Hildebrand, David V.; Scott, Geoffrey A. J. [n.d.]
  • 80.  Houston, Douglas B. 1973. Wildfires in northern Yellowstone National        Park. Ecology. 54(5): 1111-1117.  [5781]
  • 83.  Hungerford, Roger D. 1988. Soil temperatures and suckering in burned and        unburned aspen stands in Idaho. Research Note INT-378. Ogden, UT: U.S.        Department of Agriculture, Forest Service, Intermountain Research        Station. 6 p.  [5180]
  • 90.  Kay, Charles E. 1993. Aspen seedlings in recently burned areas of Grand        Teton and Yellowstone National Parks. Northwest Science. 67(2): 94-104.        [21653]
  • 106.  Meinecke, E. P. 1929. Quaking aspen: A study in applied forest        pathology. Tech. Bull. No. 155. Washington, DC: U.S. Department of        Agriculture. 34 p.  [26669]
  • 115.  Patton, David R.; Avant, Herman D. 1970. Fire stimulated aspen sprouting        in a spruce-fir forest in New Mexico. RM-159. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 3 p.  [6941]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 137.  Romme, William H.; Turner, Monica G.; Wallace, Linda L.; Walker,        Jennifer S. 1995. Aspen, elk, and fire in northern Yellowstone National        Park. Ecology. 76(7): 2097-2106.  [25945]
  • 138.  Rothwell, R. L.; Woodard, P. M.; Samran, S. 1991. The effect of soil        water on aspen litter moisture content. In: Andrews, Patricia L.; Potts,        Donald F., eds. Proceedings, 11th conference on fire and forest        meteorology; 1991 April 16-19; Missoula, MT. Bethesda, MD: Society of        American Foresters: 117-123.  [26671]
  • 145.  Schier, George A.; Jones, John R.; Winokur, Robert P. 1985. Vegetative        regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 29-33.        [11905]
  • 151.  Shepperd, Wayne D. 1981. Stand characteristics of Rocky Mountain aspen.        In: DeByle, Norbert V., ed. Symposium proceedings--situation management        of two Intermountain species: aspen and coyotes. Volume 1. Aspen; 1981        April 23-24; Logan, UT. Logan, UT: Utah State University, College of        Natural Resources: 22-30.  [10435]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the terms: cover, forbs, succession, swamp, tree

Quaking aspen is shade intolerant and cannot reproduce beneath its own
canopy [23,40,98,123,126].  Beyond that, there is no single, generalized
pattern of succession in quaking aspen.  Quaking aspen is seral to
conifers in most of its range in the West, and in some portions of its
eastern range.  In the East, quaking aspen is also replaced by hardwoods
[23,98].  In the Great Lakes States, successional trends are toward
northern hardwoods, spruce-fir, ash-elm (Fraxinus-Ulmus spp.), oak
(Quercus spp.), swamp conifers, and pine (Pinus spp.) types, in
decreasing order of importance [23].  Where it is seral, quaking aspen
usually persists as a minor tree in late seral stages [98].

The canopy closes rapidly in young aspen stands [126].  A quaking aspen
stand in Ontario closed and reached maximum development (foliage/unit
area of soil surface) in 4 years [127,128].  If quaking aspen does not
remain stable, rate of succession to other species varies with with
soil, site, and invading species [71].  Mueggler [112] stated that
succession to conifers may occur in a single generation, or take longer
than 1,000 years.  Harper [72] found that in central Utah, quaking aspen
succeeded to conifers in 75 to 100 years on sandstone soils.  On
limestone or alluvial soils, succession to conifers took 140 years or
more.

Quaking aspen is apparently stable on some sites.  On some former pine
stands in the East, extensive clearcutting of the conifer overstory has
removed the pine seed sources.  Quaking aspen has formed an apparently
stable overstory on many of these sites [24].  Quaking aspen stands are
also considered stable in parts of Canada and the western United States
[71].  Some stands, however, remain stable for decades but eventually
deteriorate.  Deteriorating stands are often succeeded by conifers, but
shrubs, grasses, and/or forbs gain dominance on some sites [71].
Succession to grasses and forbs is more likely on dry sites and is more
common in the West than in the East [126].

Quaking aspen readily colonizes after fire, clearcutting, or other
disturbance [123].  In Emigrant Wilderness Area, California, red fir
(Abies magnifica) stands on north slopes have converted to quaking aspen
after fire [66].  In the Great Lakes States, quaking aspen has
regenerated on cut/burned sites through sprouting and seedling
establishment, becoming the dominant forest cover type [23].
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 24.   Brown, J. K. 1996 [pers. comm.]
  • 40.  DeByle, N. V. 1985. Environment of Populus tremuloides. In: Proceedings        of the 1985 Society of American Foresters National Convention; 1985 July        28 - July 31; Fort Collins, CO. Bethesda, MD: Society of American        Foresters: 87-91.  [222]
  • 66.  Greenlee, John M. 1973. A study of the fire ecology of the Emigrant        Basin Primitive Area. Sonora, CA: U.S. Department of Agriculture, Forest        Service, Stanislaus National Forest. 64 p.  [21257]
  • 71.  Harniss, Roy O. 1981. Ecological succession in aspen and its        consequences on multiple use values. In: DeByle, Norbert V., ed.        Symposium proceedings--situation management of two Intermountain        species: aspen and coyotes. Volume 1. Aspen; 1981 April 23-24; Logan,        UT. Logan, UT: Utah State University, College of Natural Resources:        31-39.  [10436]
  • 72.  Rickard, W. H.; McShane, M. C. 1984. Demise of spiny hopsage shrubs        following summer wildfire: an authentic record. Northwest Science.        58(4): 282-285.  [6939]
  • 98.  Lavertu, Denis; Mauffette, Yves; Bergeron, Yves. 1994. Effects of stand        age and litter removal on the regeneration of Populus tremuloides.        Journal of Vegetation Science. 5: 561-568.  [26666]
  • 112.  Mueggler, W. F. 1985. Aspen communities in the Interior West. In:        Proceedings of the 1985 Society of American Foresters national        convention; 1985 July 28 - July 31; Fort Collins, CO. Bethesda, MD:        Society of American Foresters: 106-111.  [258]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 126.  Peterson, E. B.; Peterson, N. M. 1992. Ecology, management, and use of        aspen and balsam poplar in the Prairie Provinces, Canada. Special Report        1. Edmonton, AB: Forestry Canada, Northwest Region, Northern Forestry        Centre. 252 p.  [22689]
  • 127.  Faust, Mildred E. 1936. Germination of Populus grandidentata and P.        tremuloides, with particular reference to oxygen consumption. Botanical        Gazette. 97: 808-821.  [26842]
  • 128.  Pollard, D. F. W. 1971. Mortality and annual changes in distribution of        above-ground biomass in an aspen sucker stand. Canadian Journal of        Forest Research. 1: 262-266.  [26840]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: competition, density, frequency, fresh, litter, natural, perfect, presence, root crown, top-kill, tree

Quaking aspen regenerates from seed and by sprouting from the roots
[146].  Stump and root crown sprouting is rare in older trees, but
saplings sometimes sprout from the stump and root crown as well as the
roots [123,145].

Vegetative reproduction:  Root sprouting is the most common method of
regeneration.  Root suckers originate from meristems in the root's cork
cambium and can develop anytime during secondary growth [140].  Saplings
may begin producing root sprouts at 1 year of age [123].  There are
thousands of suppressed shoot primoridia on the roots of most mature
quaking aspen clones.  Recently initiated meristems or primordia usually
sprout and elongate more vigorously than older primorida or suppressed
root buds [145].  Root suckering is affected by depth and diameter of
parent roots.  In Utah and Wyoming, Schier and Campbell [144] found that
25 percent of sprouts came from roots within 1.6 inches (4 cm) of the
surface, 70 percent from within 3.2 inches (8 cm), and 92 percent within
4.7 inches (28 cm).  Compared with parent roots of quaking aspen in the
Great Lakes States, those of quaking aspen in the West were deeper.  On
a Utah burn site, high-severity fires increased the depth of the parent
roots from which sprouts originated.  Range in diameter of roots
producing sprouts was 0.04 to 3.7 inches (0.1-9 cm).  Sixty percent of
suckers grew from roots smaller than 0.4 inch (1 cm) in diameter, 88
percent from roots smaller than 0.8 inch (2 cm), and 93 percent from
roots smaller than 1.2 inches (3 cm) in diameter.  On a Wyoming site,
the percentages were 38 percent, 68 percent, and 86 percent,
respectively.

Sprout development is largely suppressed by apical dominance [145].
Closed stands produce a few inconspicuous sprouts each growing season;
the sprouts usually die unless they occur in a canopy gap.  When stems
are removed by cutting, burning, girdling, or defoliation, suppressed
primoridia, buds, and shoots resume growth.  Best sucker production
follows either a fire that kills all parent trees and brush or other
complete clearing [23].  The number of suckers produced can vary
markedly among clones [7,159], but the potential for suckering is
enormous.  Jones [87] indicated that 20,000 to 30,000 sprouts per acre
is typical the first year following top-kill.  Natural thinning is heavy
and effective.  The least vigorous suckers die within 1 to 2 years.
After 5 to 10 years, most sucker clumps reduce to a single stem [87].
Most stems are overtopped by more vigorous neighbors.  Diseases,
insects, browsing mammals, and snow damage also reduce sprout density
[35,87,108].  Bella and De Franceschi [17] reported that in Alberta and
Saskatchewan, stem density averaged 280,000 per hectare at age 2;
190,000 per hectare at age 3; and 80,000 per hectare at age 5.

Seedling establishment:  Quaking aspen commonly establishes from seed in
Alaska, northern Canada, and eastern North America.  Seedling
establishment is less common in the West, where rainfall is often
followed by dry periods that kill newly germinated seedlings [90].  Even
in the West, however, quaking aspen may establish from seed more
frequently than previously thought.  Studies on frequency of seedling
establishment in the West are conflicting.  Some researchers found
absolutely no quaking aspen seedling establishment despite diligent
searching [4,5,16]; others reported the presence of only one [51] or a
few [52] seedlings, while still other researchers documented the
presence of hundreds of seedlings [7,90,97,167].  Only since the
stand-replacement fires of the late 1980's have researchers used
permanent plots to monitor quaking aspen seedling establishment and
survival in the West.  Data from one such study are summarized after the
following discussion of sexual reproduction in quaking aspen.

Sexual reproduction:  The staminate-pistillate ratio of adult clones is
1:1 in most localities, although it may be as high as 3:1 or more [117].
Some clones alternate between staminate and pistillate forms in
different years, or produce various combinations of perfect, staminate,
and pistillate flowers [50].  Quaking aspen first flowers at 2 to 3
years.  Minimum tree age for production of large seed crops is 10 to 20
years, and maximum seed production occurs at about 50 years of age.  In
Utah, one 23-year-old tree produced an estimated 1.6 million seeds in
one spring [123].  There are 3- to 5-year intervals between heavy seed
crops [55,102,110,148].  Seeds disperse a few days after they ripen.
Dispersal lasts 2 to 3 weeks [123].  The plumose seeds are dispersed by
wind for distances of 1,600 feet (500 m) to several miles with heavy
winds.  Seeds also disperse by water, and can germinate while floating
or submerged [54].  Viability of fresh seed is good; germination of 80
to 95 percent is reported under laboratory conditions [103,109,142].
Viability lasts 2 to 4 weeks under favorable conditions of low
temperature and humidity [123], but seed loses viability rapidly under
less than optimum conditions [54,171].

Optimum conditions for germination and seedling survival include a moist
mineral seedbed with adequate drainage, moderate temperature, and
freedom from competition [104].  In various collections, seeds have
germinated at temperatures from 32 to 102 degrees Fahrenheit (0-39 deg
C), with germination sharply reduced from 35 to 41 degrees Fahrenheit
(2-5 deg C) and progressively curtailed above 77 degrees Fahrenheit (25
deg C) [54,172].  Quaking aspen seed from northern Utah showed optimal
germination between 59 and 68 degrees Fahrenheit (15-20 deg C), and had
no light requirement.  Seeds germinated best on the soil surface, with
emergence decreased by shallow burial [104].  Burned or scarified soil
is an excellent seedbed [61]; litter provides the poorest seedbed.  The
primary root grows slowly the first few days following germination, and
during this critical period the seedling depends upon a brush of hairs
to absorb water and anchor the plant [123].  Minor disturbances can
uproot surface-germinated seedlings, and a drying seedbed can rapidly
desiccate seedlings [104].

Seedlings may reach 6 to 24 inches (15-61 cm) in height by the end of
their first year, and roots may extend 6 to 10 inches (15-25 cm) in
depth and up to 16 inches (41 cm) laterally.  Roots grow more rapidly
than shoots; some seedlings show little top-growth until about their
third year [23].  During the first several years, natural seedlings grow
faster than planted seedlings but not as fast as sprouts.  High
mortality characterizes young quaking aspen stands regardless of origin.
In both seedling and sprout stands natural thinning is rapid.  Stems
that occur below a canopy die within a few years [123].

Seedling study:  Kay [90] documented postfire quaking aspen seedling
establishment following 1986 and 1988 fires in Grand Teton and
Yellowstone National Parks, respectively.  He found seedlings were
concentrated in kettles and other topographic depressions, seeps,
springs, lake margins, and burnt-out riparian zones.  A few seedlings
were widely scattered throughout the burns.  In Grand Teton National
Park, establishment was greatest (950-2,700 seedlings/ha) in 1989, a wet
year, but hundreds to thousands of seedlings established each year
despite drought conditions in 1986-1988 and 1990-1991.  Seedlings
surviving past one season occurred almost exclusively on severely burned
surfaces.  In Grand Teton National Park, where seedlings were monitored
for several years, surviving seedlings were associated with bare mineral
soil, ash, and the absence of competing vegetation.  In both Parks, 100
percent of seedlings were browsed, and mean heights of seedlings at
postfire year 5 (Grand Teton) and postfire year 3 (Yellowstone) were
nearly equal to mean heights at postfire year 1.  During the same
period, 0 percent of lodgepole pine seedlings were browsed.  Kay
predicted that long-term survival of quaking aspen seedlings will be
low.  Most seedlings established on depressions that are subject to
spring flooding.  Since quaking aspen does not tolerate standing water,
seedlings on depressions such as kettles and lake margins will probably
die in the first prolonged flood.  At postfire year 5, quaking aspen
seedlings in Grand Teton National Park attained only 5 percent more
height growth than attained in the first postfire year.  In contrast,
lodgepole pine seedlings had increased in height by an average of 176
percent.
  • 4.  Baker, Frederick S. 1918. Aspen reproduction in relation to management.        Journal of Forestry. 16: 389-398.  [16494]
  • 5.  Baker, Frederick S. 1925. Aspen in the central Rocky Mountain region.        Department Bulletin No. 1291. Washington, DC: U.S. Department of        Agriculture. 47 p.  [15589]
  • 7.  Barnes, Burton V. 1966. The clonal growth habit of American aspens.        Ecology. 47: 439-447.  [16466]
  • 16.  Beetle, A. A. 1974. Range survey in Teton County, Wyoming: Part IV -        quaking aspen. SM 27. Laramie, WY: University of Wyoming, Agricultural        Experiment Station. 28 p.  [26850]
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 35.  Crouch, Glenn L. 1981. Regeneration on aspen clearcuts in northwestern        Colorado. Res. Note RM-407. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station. 5 p.  [3381]
  • 50.  Einspahr, Dean W.; Winton, Lawson L. 1976. Genetics of quaking aspen.        Res. Pap. WO-25. Washington, DC: U.S. Department of Agriculture, Forest        Service. 23 p.  [26702]
  • 51.  Ellison, Lincoln. 1943. A natural seedling of western aspen. Journal of        Forestry. 41: 767-768.  [26841]
  • 52.  Every, A. David; Wiens, Delbert. 1971. Triploidy in Utah aspen. Madrono.        21: 138-147.  [26844]
  • 54.  Faust, Mildred E. 1936. Germination of Populus grandidentata and P.        tremuloides, with particular reference to oxygen consumption. Botanical        Gazette. 97: 808-821.  [26842]
  • 55.  Fechner, Gilbert H.; Barrows, Jack S. 1976. Aspen stands as wildfire        fuel breaks. Eisenhower Consortium Bulletin 4. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 26 p. In cooperation with: Eisenhower        Consortium for Western Environmental Forestry Research.  [7611]
  • 61.  Godman, Richard M.; Mattson, Gilbert A. 1976. Seed crops and        regeneration problems of 19 species in northeastern Wisconsin. Res. Pap.        NC-123. St. Paul, MN: U.S. Department of Agriculture, Forest Service,        North Central Forest Experiment Station. 5 p.  [3715]
  • 87.  Jones, John R. 1976. Aspen harvesting and reproduction. In: Utilization        and marketing as tools for aspen management in the Rocky Mountains:        Proceedings of the symposium; 1976 September 8-9; Fort Collins, CO. Gen.        Tech. Rep. RM-29. Fort Collins, CO: U.S. Department of Agriculture,        Forest Service, Rocky Mountain Forest and Range Experiment Station:        30-34.  [26854]
  • 90.  Kay, Charles E. 1993. Aspen seedlings in recently burned areas of Grand        Teton and Yellowstone National Parks. Northwest Science. 67(2): 94-104.        [21653]
  • 97.  Larson, George C. 1944. More on seedlings of western aspen. Journal of        Forestry. 42: 452.  [16485]
  • 102.  Maini, J. S. 1968. Silvics and ecology of Populus in Canada. In: Maini,        J. S.; Cayford, J. H., eds. Growth and utilization of poplars in Canada.        Departmental Publication No. 1205. Ottawa, ON: Department of Forestry        and Rural Development: 20-69.  [6500]
  • 103.  Maini, J. S. 1972. Silvics and ecology in Canada. In: Aspen: Symposium        proceedings; [Date of conference unknown]
  • 104.  McDonough, W. T. 1979. Quaking aspen--seed germination and early        seedling growth. Res. Pap. INT-234. Ogden, UT: U.S. Department of        Agriculture, Forest Service, Intermountain Forest and Range Experiment        Station. 13 p.  [3904]
  • 108.  Moir, William H. 1969. The lodgepole pine zone in Colorado. American        Midland Naturalist. 81: 87-98.  [10798]
  • 109.  Morgan, M. D. 1969. Ecology of aspen in Gunnison County, Colorado.        American Midland Naturalist. 82(1): 204-228.  [15935]
  • 110.  Moss, E. H. 1938. Longevity of seed and establishment of seedlings in        species of Populus. Botanical Gazette. 99: 529-542.  [26846]
  • 117.  Pauley, S. S.; Mennel, G. F. 1957. Sex ratio and hermaphrodism in a        natural population of aspen. Minnesota Forestry Notes No. 55. St. Paul,        MN: University of Minnesota, School of Forestry. 2 p.  [26859]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 140.  Schier, George A. 1973. Seasonal variation in sucker production from        excised roots of Populus tremuloides and the role of endogenous auxin.        Canadian Journal of Forest Research. 3(3): 459-461.  [16481]
  • 142.  Schier, George A. 1981. Physiological research on adventitious shoot        development in aspen roots. Gen. Tech. Rep. INT-107. Ogden, UT: U.S.        Department of Agriculture, Forest Service, Intermountain Forest and        Range Experiment Station. 12 p.  [26701]
  • 144.  Schier, George A.; Campbell, Robert B. 1980. Variation among healthy and        deteriorating aspen clones. Res. Pap. INT-264. Ogden, UT: U.S.        Department of Agriculture, Forest Service, Intermountain Forest and        Range Experiment Station. 12 p.  [16492]
  • 145.  Schier, George A.; Jones, John R.; Winokur, Robert P. 1985. Vegetative        regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 29-33.        [11905]
  • 146.  Schier, George A.; Shepperd, Wayne D.; Jones, John R. 1985.        Regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 197-208.        [11921]
  • 148.  Fowells, H. A., compiler. 1965. Silvics of forest trees of the United        States. Agric. Handb. 271. Washington, DC: U.S. Department of        Agriculture, Forest Service. 762 p.  [12442]
  • 159.  Tew, Ronald K. 1970. Seasonal variation in the nutrient content of aspen        foliage. Journal of Wildlife Management. 34(2): 475-478.  [3771]
  • 167.  Williams, Bryan D.; Johnston, Robert S. 1984. Natural establishment of        aspen from seed on a phosphate mine dump. Journal of Range Management.        37(6): 521-522.  [26847]
  • 171.  Zasada, J. C.; Densmore, R. A. 1977. Changes in seed viability during        storage for selected Alaskan Salicaceae. Seed Science and Technology. 5:        509-518.  [26849]
  • 172.  Zasada, J. C.; Viereck, L. A. 1975. The effect of temperature and        stratification on germination in selected members of the Salicaceae in        interior Alaska. Canadian Journal of Forest Research. 5: 333-337.        [26848]
  • 17.  Shields, Paul W. 1981. Opportunities for wildlife Habitat management in        aspen. In: DeByle, Norbert V., ed. Situation management of two        intermountain species: aspen and coyotes; 1981 April 23-24; Logan, UT.        UMC 52. Logan, UT: Utah State University, College of Natural Resources:        69-76.  [11897]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the terms: geophyte, phanerophyte

   Phanerophyte
   Geophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reaction to Competition

In both the eastern and western  parts of its range, quaking aspen is classed as very intolerant  of shade, a characteristic it retains throughout its life.  Natural pruning is excellent, and long, clean stems are usually  produced when side shade is present. However, this is a clonally  variable characteristic and self-pruned and unpruned clones exist  side by side in some stands (69,78). The intolerance of aspen to   shade dictates an even-aged silvicultural system, that is,  clearcutting, for regenerating fully stocked sucker stands and  maximizing growth (19,57,75),

    The tree has a pronounced ability to express dominance, and  overstocking to stagnation of growth is extremely rare.

    Quaking aspen is an aggressive pioneer. It readily colonizes burns  and can hold invaded land even though subjected to fires at  intervals as short as 3 years. In the northeastern United States,  it is an old-field type, and in Canada it invades grassland if  fire is excluded. In the Central Rocky Mountains, it constitutes  the typical fire climax at the lower elevations of the subalpine  forest. The extensive stands of aspen in that area are usually  attributed to repeated wildfires, and aspen is generally regarded  as a successional species able to dominate a site until replaced  by less fire-enduring but more shade-tolerant conifers, a process  that may take only a single aspen generation or as long as 1,000  years of fire exclusion. Aspen is considered a permanent type on  some sites in the intermountain region of Utah, Nevada, and   southern Idaho, but conifers would invade the type if seed trees  were available.

    The uneven-aged character of some western aspen stands suggests  that under certain conditions aspen is self-perpetuating without  major disturbance. These stands are relatively stable and can be  considered de facto climax. Seral and stable aspen stands  seem to be associated with certain indicator species (28,78,82).

    In its eastern range, aspen in the absence of disturbance is  regarded as transient. Successional patterns are determined by  soil water regime (61). Pure aspen stands gradually deteriorate  to a "shrubwood" dominated by the shrub component of  the stand and with only a few scattered aspen suckers. If  intolerant associates are present, they will outlive the aspen  and eventually dominate but in turn will be replaced again by the  shrubwood type. If tolerant hardwoods or balsam fir (Abies  balsamea) are associated with aspen, they will eventually  dominate by their longevity and ability to regenerate in their  own shade (81).

    The deterioration of aspen stands begins earliest at the southern  limits of its eastern range and seems to be related to summer  temperatures. Deterioration begins when crowns in old stands can  no longer grow fast enough to fill the voids in the canopy left  by dying trees. Increased breakage accelerates the deterioration  process, which may be completed in as few as 3 or 4 years (81).  Deterioration is a much slower process in the West, where aspen  often is replaced by conifers. Dry sites may revert to rangeland  dominated by shrubs, forbs, and grasses. Sometimes suckers appear  in a deteriorating stand and ultimately an all-age climax aspen  forest develops (28).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rooting Habit

Seedlings initially have a short taproot,  but a heart root system develops on deep, well-drained soils.  Clonal ramets have a flat root system when young but again will  develop a heart system on deep, well-drained soils. If rooting  depth is restricted, a flat root system develops regardless of  regeneration origin (28,59).

    The shallow and extensive laterals have cordlike branch roots that  undulate and meander for great distances without tapering. These  roots are the main producers of suckers, particularly when they  are close to the soil surface. Roots tend to follow soil surface  irregularities and may even grow into decaying stumps or logs.  The fine feeding roots are found at all levels down to 0.6 to 0.9  in (2 to 3 ft) except in restrictive horizons. Sinker roots occur  as frequently as every meter or so on the lateral roots. They may  descend to depths of 3 in (10 ft) or more where they end in a  dense fan-shaped fine root mass. Sinkers are capable of  penetrating strongly massive soil horizons or cracks in bedrock  and often use vacated root channels (28,78).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

PESTS AND DISEASE: Populus spp. have many natural enemies. The forest tent caterpillar, Malacosoma disstria, is one of the most important insects to attack P. tremuloides. The fungus Marssonia populi induces a leaf and twig blight of P. tremuloides that periodically becomes epidemic over extensive areas of the northwestern U.S. Clones vary in their susceptibility to the disease, and may become anywhere from only slightly damaged to entirely defoliated. The last reported epidemic occurred over large areas of northeastern Utah, southeastern Idaho, and western Wyoming (Harniss 1984).

The most serious diseases affecting P. tremuloides are the wood-rotting fungi and cankers. Fomes ignarius is a wood-rotting fungus that attacks the species throughout its range, causing decay of heartwood and sapwood (Fowells 1965). Hypoxylon canker is widely distributed in the Northeast and Lake States and causes heavy losses of Populus spp. in these regions. French (pers. comm.) stated that perhaps 15-20% of all trees in the Lake States are infected with Hypoxylon. The Hypoxylon fungus attacks the phloem, and kills the tree within 2-4 years of initial infection (French pers. comm.).

Moderate browsing by mammals such as deer causes little permanent damage to suckers. Mice, voles, and rabbits can girdle suckers, and beaver frequently cut larger trees.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

Quaking aspen catkins elongate before the leaves expand.  In New
England, catkins appear in mid-March to April; in the central Rockies,
flowering occurs in May to June.  Sustained air temperatures above 54
degrees Fahrenheit (12 deg C) for about 6 days apparently trigger
flowering [55,123].  At high elevation, trees may flower before snow is
off the ground [5].  Female trees generally flower and leaf out before
male trees.  Local clonal variation produces early- and late-flowering
clones of either sex, however.  Catkins mature in 4 to 6 weeks (usually
in May or June).  Branches usually leaf out from early May to June
[123].  Seed dispersal in the Great Lakes States occurs from early May
to mid-June, beginning earliest on protected sites and in southern
portions of the region [23].
  • 5.  Baker, Frederick S. 1925. Aspen in the central Rocky Mountain region.        Department Bulletin No. 1291. Washington, DC: U.S. Department of        Agriculture. 47 p.  [15589]
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 55.  Fechner, Gilbert H.; Barrows, Jack S. 1976. Aspen stands as wildfire        fuel breaks. Eisenhower Consortium Bulletin 4. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station. 26 p. In cooperation with: Eisenhower        Consortium for Western Environmental Forestry Research.  [7611]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Vegetative Reproduction

The aggregation of stems (ramets)  produced asexually from a single sexually produced individual  (the genet) is termed a clone. In aspen a clone is formed from  the root system of the seedling genet following an event  (cutting, fire) that destroys the genet (9).

    Quaking aspen seedlings at 1 year of age are already capable of  reproducing by root sprouts (suckers), and mature stands  reproduce vigorously by this means (19,43). Root collar sprouts  and stump sprouts are produced only occasionally by mature trees  but saplings commonly produce them (77). Aspen clones vary widely  in many characteristics, even over a small area. Members of a  clone are indistinguishable but can be distinguished from those  of a neighboring clone by electrophoresis and often by a variety  of traits such as leaf shape and size, bark character, branching  habit, resistance to disease and air pollution, sex, time of  flushing, and autumn leaf color (9,10,11,17,22,23,57,87). Clones  typically have many ramets over an area up to a few tenths of a  hectare in stands east of the Rocky Mountains (45,76). In the  Rockies, clones tend to be much larger-one Utah clone covered  43.3 ha (107 acres) and contained an estimated 47,000 ramets.  Clone size in an aspen stand is primarily a function of clone  age, number of seedlings initially established, and the frequency  and degree of disturbance since seedling establishment (46).

    The root suckers are produced from meristems on the shallow,  cordlike lateral roots within 2 to 10 cm (1 to 4 in) of the soil  surface (28,81). In response to clone disturbance, the meristems  may develop into buds and then elongate into shoots. Frequently,  however, they remain in the primordial stage until stimulated to  develop further. These preexisting primordia are visible as small  bumps when cork is peeled off an aspen root (63).

    The development of suckers on aspen roots is suppressed by apical  dominance exerted by auxin transported from growing shoots, while  cytokinins, hormones synthesized in root tips, apparently  initiate adventitious shoot development. When an aspen is cut,  cytokinins accumulate in the roots, the supply of inhibitory  auxins is eliminated, and suckers are initiated. If aspen is  girdled, the downward transport of auxin again is stopped, but  upward translocation of cytokinins via the xylem is unimpeded.  Cytokinins in this case do not accumulate in the roots, with  consequently less sucker production. Thus high cytokinin-to-auxin  ratios favor shoot initiation while low ratios inhibit it. A  gibberellic-acid-like growth regulator also stimulates shoot  elongation after sucker initiation.

    Carbohydrate reserves supply the energy needed by elongating  suckers until they emerge at the soil surface to carry on their  own photosynthesis. Therefore, the density of regeneration varies  according to the level of these reserves. However, the number of  suckers initiated by aspen roots is independent of variation in  carbohydrate levels. Apical dominance by elongating suckers  further limits the total amount of regeneration. Carbohydrates  can be exhausted by grazing, repeated cropping or killing of  sucker stands, or insect defoliation (63,77,82).

    Soil temperature is the most critical environmental factor  affecting suckering. Initiation and development of suckers is  optimum at about 23° C (74° F). High temperatures tend  to degrade auxin and promote cytokinin production, which may  account in part for the aspen invasion of grassland without  apparent clone disturbance (51,82).

    Excess soil moisture (impeded aeration) or severe drought inhibit  sucker production (25,57,82).

    Light is not needed for sucker initiation but is essential for  secondary growth (78). Large clonal. differences in ability to  produce suckers may be due to differences in growth regulators,  carbohydrate reserves, and developmental stages of shoot  primordia (63). Some clones in the interior West are unevenaged,  suggesting weak apical control or high concentration of  growth-promoting hormones so that they sucker at the least  disturbance (69,82).

    Suckers are initially sustained by the root system of the parent  tree, but they may form as much as 4.7 in (15.5 ft) of new main  roots in 10 weeks. In contrast, suckers of some Utah clones  produce only weak adventitious roots and depend on the distal  parent root for sustenance. The parent root usually thickens at  the point of sucker origin distal to the parent tree. This  indicates that translocation of food produced by the sucker is  toward the growing tip of the parent root, which usually becomes  part of the new root system (28,51,78,81). These connections  readily conduct water and solutes from tree to tree (27). True  root grafts, in contrast, are rare in aspen.

    Suckers from the roots of badly decayed trees are not infected by  the parent stump. Heart rot usually terminates in the base of the  stump. Deteriorating clones, however, produce few suckers.

    In general, sucker regeneration is proportional to the degree of  cutting, with most suckers arising after a complete clearcut  (43,57,64,65,75,78). Typically, from 25,000 to 75,000 suckers per  hectare (10,000 to 30,000/acre) are regenerated in Alaska and the  Great Lakes region and about half as many in the Rockies (28,91).

    Light burning on heavily cut areas increases the number of suckers  and stimulates their initial growth. However, hot slash fires  diminish sucker vigor. Repeated burning increases stand density  because it stimulates sucker numbers and prepares mineral soil  seedbeds for seedling establishment; however, it reduces stand  growth (6,19,28,56,64,78). Surface fires in established aspen  stands are not common because of aspen's inherently low  flammability. When they do occur, fire wounds and loss of shallow  feeder roots substantially reduce aspen productivity. Fire is a  useful tool, however, to stimulate regeneration and to reduce  competition if clearcutting is not practiced. It is especially  valuable for regenerating deteriorated stands and for maintaining  wildlife habitat (21,57).

    Disking stimulates suckering, but sucker growth and survival are  usually diminished because of injury to their sustaining parent  roots. Rows of suckers often appear along furrows prepared for  planting conifers.

    Herbicides have been used to kill residual trees and to increase  suckering without affecting sucker growth or vigor (19,57,78).

    Dormant season cutting generally produces vigorous suckers the  next growing season. Summer cutting produces a sparse stand  initially, but the number of suckers after 2 years is usually the  same regardless of cutting season (15). Suckering sometimes fails  inexplicably after hay-vesting aspen on fine-textured soils  during the growing season (59).

    The number of suckers following cutting increases as stocking  density of the parent stand increases up to full site  utilization. The effect of age and site index on aspen suckering  is not clear (35,81).

    Age of wood is the most important factor in rooting quaking aspen  cuttings. With rare exceptions, the species roots poorly from  woody stem cuttings, even when treated with indolebutyric acid  (IBA). However, newly initiated shoots can usually be induced to  root by dipping in IBA or other commercially available rooting  powders. These softwood stem cuttings should be taken from  actively growing shoots except during the period of extremely  rapid mid-season elongation (14,63,78). Propagation by excising  succulent young sucker shoots from root cuttings is easily  accomplished by treating the shoots with IBA and growing them in  a suitable medium in a misting chamber until rooted, in about 2  to 3 weeks (62). Quaking aspen scions can be grafted onto balsam  poplar (Populus balsamifera), willows (Salix spp.), or  bigtooth aspen (P. grandidentata). Quaking aspen  plantlets have been produced by tissue culture (81).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seedling Development

Germination is epigeal. The primary  root of a seedling grows very slowly for several days, and during  this critical period the young plant depends upon a brush of long  delicate hairs to perform the absorptive functions and anchor the  seedling to the seedbed. Exposed mineral soils are the best  seedbeds and litter the poorest seedbeds (28,51,60,78).

    During the first year seedlings may attain a height of 15 to 30 cm  (6 to 12 in) and develop a 20- to 25-cm (8- to 10-in) long  taproot and from 30- to 40-cm (12 to 16-in) long laterals. During  the second and third years, wide-spreading lateral roots are  developed, reaching lengths of 2 m (6 ft) or more in the second  year. Quaking aspen roots form ectomycorrhizae if suitable  inoculum is present (28,78,86).

    Despite the abundance of aspen seed and high germinative capacity,  few aspen seedlings survive in nature because of the short period  of seed viability, unfavorable moisture during seed dispersal,  high soil surface temperatures, fungi, adverse diurnal  temperature fluctuations during initial seedling growth, and the  unfavorable chemical balance of some seedbeds (51,52).

    Height growth of the young trees is rapid for about the first 20  years and slows thereafter. During the first several years,  natural seedlings grow faster than planted seedlings but not as  fast as suckers. High mortality characterizes young quaking aspen  stands regardless of origin. In both seedling and sucker stands  natural thinning is rapid, and trees that fall below the canopy  stop growing and die within a few years (78,93).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seed Production and Dissemination

Good seed crops are  produced every 4 or 5 years, with light crops in most intervening  years. Some open-grown clones may produce seeds annually,  beginning at age 2 or 3. The minimum age for large seed crops is  10 to 20; the optimum is 50 to 70. One 23-year-old quaking aspen  produced an estimated 1.6 million seeds (51,59,78). Seeds are  very light, 5,500 to 8,000 clean seeds per gram (156,000 to  250,000/oz).

    Seeds begin to be dispersed within a few days after they ripen and  seed dispersal may last from 3 to 5 weeks. The seeds, buoyed by  the long silky hairs, can be carried for many kilometers by air  currents. Water also serves as a dispersal agent (78,91).

    The viability of fresh fertile seeds is high (usually greater than  95 percent) but normally of short duration. Under favorable  conditions viability lasts only 2 to 4 weeks after maturity and  may be much less under unfavorable conditions. When air dried and  stored in polyethylene bags at -10° C (14° F), seed  retains high viability for at least I year. Seedlings are  sturdiest when germinated at 5° to 29° C (41° to  84° F) and grown at about 20° C (68° F). Ripe  quaking aspen seeds are not dormant, and germination occurs  within a day or two after dispersal if a suitably moist seedbed  is reached. Because germination declines rapidly after water  potential exceeds -4 bars (-.4 MPa), a water-saturated seedbed is  critical. Seeds germinate even when totally submerged in water or  in the absence of light (32,47,50,66,78,92).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering and Fruiting

Quaking aspen is primarily  dioecious. The pendulous flower catkins, 3.8 to 6.4 cm (1.5 to  2.5 in) long, generally appear in April or May (mid-March to  April in New England, May to June in central Rockies) before the  leaves expand (28,66,78,91). Local clonal variation provides  early and late flowering clones of each sex in most stands. In  addition, certain flowers bloom later than others, usually those  on the distal end of a given catkin or small catkins on spurlike  shoots (13). Maximum air temperatures above 12° C (54°  F) for a period of about 6 days appear to be the principal factor  governing timing of flowering. Flowers are pollinated by wind.  The fruiting catkins are about 10 cm (4 in) long when mature,  usually in May or June-about 4 to 6 weeks after flowering. Each  catkin may bear several dozen one-celled capsules, light green,  each nearly 6 min (0.25 in) long. Each capsule contains about 10  small brown seeds, each of which is surrounded by tufts of long,  white silky hairs. Although the flowers are typically unisexual,  10 to 20 percent of the predominantly female trees and 4 to 5  percent of the predominantly male trees bear perfect flowers.  Trees in a given clone, therefore, are usually either all male or  all female. Some studies in the eastern United States found  male-to-female ratios of about 3 to 1 in natural populations;   others have reported no deviation from an expected 1-to-1 ratio  (66,78). In the Colorado Rockies, male clones were more common at  high elevations and female clones were more common at low  elevations. Furthermore, female clones had faster radial growth  than male clones, especially at lower elevations. This runs  counter to the theory that the high metabolic cost of sexual  reproduction for females is compensated for by reduced vegetative  growth (36).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Growth and Yield

Quaking aspen is a small- to  medium-sized, fast-growing, and short-lived tree. Under the best  of conditions, however, it may attain 36.5 in (120 ft) in height  and 137 cm (54 in) in d.b.h. The current national champion is 114  cm (45 in) d.b.h. and 26 in (86 ft) tall near Fort Klamath, OR.  More typically, mature stands may range from 20 to 25 in (66 to  82 ft) tall and average 18 to 30 cm (7 to 12 in) d.b.h. A few  vigorous trees attain a maximum age of about 200 years (oldest  recorded is 226 years) in Alaska and the Rocky Mountain region  (28,42). Although individual ramets of a clone may be short  lived, the clone may be thousands of years old (46) and longer  lived than the oldest giant sequoia (Sequoiadendron  giganteum).

    The tallest quaking aspen are found in a belt bordering the  midcontinental prairie region at about latitude 55° N., and  in north-central Minnesota, northern Michigan, and in the  Southwest. Few quaking aspen exceed 26 or 27 in (85 to 90 ft) in  Alaska (38).

    Growth and decay are both generally slower in Alaska and the West  than in the East, hence pathological rotations are longer-80 to  90 years in Utah and 110 to 120 years for Colorado and Wyoming.  In northern Minnesota, the pathological rotation is about 55 to  60 years and even shorter in southern Wisconsin and Michigan  (35,69,70).

    Now and in the foreseeable future, most aspen will be extensively  managed (complete clearing for site preparation, no thinning) for  fiberboard, pulpwood, flakeboard, and some sawtimber. Aspen is  harvested either as whole-tree chips or as bolewood to a nominal  top size for pulpwood or sawtimber. Some of the very best stands  can be thinned to increase the production of large bolts (57,58).

    Site quality varies regionally, being highest in the Lake States,  followed by Alaska and the West. Biomass mean annual increment on  the better sites in the Lake States and Canada culminates at  about age 30 and at 4.4 to 4.8 mg/ha (2-2.2 tons/acre) dry weight  (16,60). Mature stands in Newfoundland typically carry 64 m²/ha  (280 ft²/acre) basal area. This amounts to 376 mg/ha (167  tons/acre) at age 90 years, or 4.2 mg/ha/yr (1.9 tons/acre/year)  (54). However, exceptionally good growth of quaking aspen is  possible in Arizona and in Colorado and southern Wyoming (44,70).  A natural triploid clone in Minnesota produced an annual yield of  14.6 m³/ha (208 ft³/acre) of bolewood over 38 years  (59).

    Aspen responds to intensive management. Production by thinned  stands for a 50-year rotation, including thinnings removed at  ages 10, 20, and 30, is about 511 m³/ha (7,300 ft³/acre),  or 10.2 m³/ha (146 ft³/acre) per year. This is about 42  percent greater than for similar, but unthinned, stands (58).  Quaking aspen growth can be further increased by fertilization  and irrigation (24,26,29,59,84). Sub-optimal fiber yield and the  threat of Armillaria mellea root rot limit the  practicality of rotations shorter than 1520 years (77).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

The vegetative cells of aspen, as well as those of nearly all  aspen hybrids, contain 19 pairs of chromosomes. A number of  triploid aspen (with three sets of chromosomes rather than the  normal two) have been located in Utah, the Lake States, and  Colorado. A few albino aspen seedlings have been observed, as  have two albino aspen suckers, which were thought to result from  a somatic mutation in aspen root tissue (30,37,78).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Populus tremuloides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTCTATTTCATCTTCGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATTTGGTAATTGGTTTGTTCCGATTCTGATAGGTGCACCTGACATGGCATTTCCACGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTACTCTTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCAGTTGATTTAGCAATTTTTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTTCAACATGCGTGGACCTGGAATGACTATGCATAGATTACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCTACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTTTGATCCCGCTGGAGGGGGGGACCCCATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Populus tremuloides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Huge distribution range (most of northern North America except Arctic areas) and great abundance, despite concerns about apparent failure to persist in some sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status, such as, state noxious status and wetland indicator values.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Still abundant in much of its range, although in some areas has been outcompeted by conifers following fire suppression, combined with aspen seedling/shoot consumption by unnaturally abundant deer and elk as well as livestock (cf. knotts, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Aspen invasion of grasslands especially at the prairie-forest border has increased primarily because of fire suppression (Buell 1959, Maini 1960, Blake 1963). In Saskatchewan, Maini (1960) found that the age of the oldest P. tremuloides corresponded to dates of post-settlement fire suppression. Aspen groves that were present in the prairie just prior to that time often were of small, brush-like trees instead of tall specimens. Increased wetland drainage probably also has encouraged invasion (Buell 1960)

Undisturbed clones expand into adjacent prairie when light, moisture and soil conditions are appropriate especially for vegetative growth (Maini 1966b). Vigorous root suckers emerge in the prairie at the periphery of a clone, where other woody plants also frequently invade the prairie. As these suckers grow, and crowns coalesce, aspen shades out desirable grassland species.

Rate of invasion is related to disturbance, clone phenotype, slope, wind, moisture, drainage, soil texture and climate. Some examples of invasion rates include:

1. 11 m in 15 years upslope into a dry prairie from a ravine woods, parallel with wind direction (Wisconsin) (Chavannes 1940).

2. An average 1.5 m per year for 23 years in a low rolling prairie near the prairie forest border in Minnesota (Buell 1959).

3. 18 m in about 25 years following a peat-burn in a southern Wisconsin marsh (Vogl 1969).

Aspen persists in prairie regions because of its preference for full sun and its vigorous vegetative reproduction and clonal growth that is well-adapted to top removal (fire, cutting, browsing) and drought.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the terms: basal area, density, litter

It is somewhat unclear why some quaking aspen stands break up and die
while others remain stable.  The age at which quaking aspen clones begin
to die probably has a genetic component.  Site quality can also be a
major factor [143].  Is it well documented in the Great Lakes States
that environmental variables affect quaking aspen longevity [63,93].
Stands in this region may deteriorate* rapidly; more than half the trees
in a well-stocked stand may die in 6 years [63].  In Utah, however,
clone deterioration was found to occur over a number of generations of
sprouts [141].  Schier and Campbell [143] found that on the Wasatch
National Forest near Logan, Utah, concentrations of phosphorus and
percent silt were significantly lower on soils with deteriorating clones
than on soils with healthy clones.  Ten deteriorating clones and ten
healthy clones were studied.

*Deteriorating stands are defined as those stands with a low density of
stems that are younger and smaller in size, and with poorer form and
higher crown:stem ratios, than healthy stands [143].

Cryer and Murray [36] speculated that both soil type and disturbance are
important in quaking aspen stability.  As a quaking aspen stand matures,
a humus-rich (mollic) soil layer develops.  Quaking aspen thrive for a
time, but without disturbance gradually begin to age and deteriorate.
With deterioration, the soil loses organic matter and thickness.  With
loss of humus and litter, rapid percolation leaches the soil, which
becomes thinner, more acidic, and lower in nutrients.  Acidic,
low-nutrient soils support conifers more readily than quaking aspen.
Disturbances such as burning or clearcutting tend to maintain quaking
aspen.  If soil is already thin and acidic, however, clearcutting will
probably convert the site to conifers.  Quaking aspen on such sites has
been observed to sprout, grow to about 3 feet (0.9 m) in height, and
begin to die.  A deteriorating stand that is burned may be more likely
to revert to quaking aspen because burning increases soil pH and adds
organic carbon and nutrients to the soil.  However, fire will probably
not rejuvenate the stand if quaking aspen biomass is so low that burning
does not appreciably raise soil pH and nutrient levels.  Sucker vigor
will probably be low.

Range:  There is increasing concern that in the West, poor quaking aspen
regeneration is due, at least in part, to wildlife overbrowsing young
sprouts [67].  Where browsing pressure is heavy, ungulates may remove
quaking aspen regeneration before it grows above browseline.  To provide
for quaking aspen regeneration in such areas, enough quaking aspen must
be removed to create an unbrowsed surplus of new growth [122].  A few
areas of the West have such large elk populations that even after
large-scale wildfires, quaking aspen sprouts attained little height
growth because of intense browsing.  In such areas, quaking aspen
sprouts probably require protection from browsing [90].

Promoting quaking aspen:  Prescribed burning is one method of promoting
quaking aspen (see FIRE MANAGEMENT).  When prescribed burning is not
desired or feasible, clearcutting or bulldozing is recommended [77,177].

Clearcutting often results in a sucker stand of 50,000 to 100,000 stems
per hectare [17,35,49].  A basal area of less than 4 trees/sq m/ha is
recommended to promote sprouting [87,122].  Partial cuttings seriously
inhibit sprouting because apical dominance is retained in standing
stems, and shade from standing stems reduces vigor of the few suckers
that do appear [49].

Clearcutting in southeastern boreal forest:  Lavertu and others [98]
found that in balsam fir-northern white-cedar (Abies balsamea-Thuja
occidentalis) forest in Quebec, quaking aspen showed strong sprouting
response regardless of forest seral stage, number of quaking aspen
present before cutting, quaking aspen stem age, or quaking aspen root
density.  After clearcutting on sites that had burned 46, 74, 143, 167,
and 230 years earlier, quaking aspen sprouted vigorously even on the
site that had not burned for 230 years, had only a single, living
quaking aspen stem, and the lowest quaking aspen root density of all
five site types.  Initial sprouting densities were greater in younger
stands, but due to greater mortality of sprouts in younger stands,
differences in sprouting density between different-aged stands were not
significant 3 years after clearcutting.

Bulldozing:  Carefully done, whole-tree bulldozing can stimulate quaking
aspen suckering [177,178].  Operations that cause deep cutting or
compaction of soil will reduce sprouting [177].  Shepperd [178] obtained
good quaking aspen regeneration by pushing over whole trees using a
rubber-tire skidder with the blade positioned above ground level.  This
technique severed large roots to a distance of 3.3 to 5 feet (1-1.5 m)
from the stem.  Five years after treatment, quaking aspen suckers
averaged 37,888 per hectare when slash was removed and 10,131 per
hectare with slash intact.  In contrast, sites that were clearcut
averaged 17,544 stems per hectare (no slash) and 7,038 stems per hectare
(slash) [178].

Quaking aspen control:  On some sites, it may be desirable to convert
quaking aspen to another vegetation type.  Stand conversion may be
relatively easy on dry or poorly drained sites, or on sites were quaking
aspen is exposed to snow damage.  Quaking aspen production is usually
low on such sites to begin with, and such stands are prone to breakup.
On other sites, it may not be possible to eliminate quaking aspen, but
quaking aspen can probably be reduced [49].  Very small clearcuts reduce
quaking aspen abundance because sprouting response is weak after such
treatment [114].  Girdling also reduces abundance; sprouting occurs
after girdling, but shade provided by standing dead stems increases
sprout mortality.  Also, it is thought that girdling promotes decay of
the root system [147].  Use of glyphosate after cutting has been shown
to control quaking aspen regeneration for some time [122,123].

In Quebec, quaking aspen in a quaking aspen-paper birch stand
originating after a 1944 fire was partially controlled by removing
overtopping quaking aspen when the stand was 7 and 14 years of age.
Stocking varied as follows at postfire year 34 [96].

_______________________________________________________________________________
         Treatment            |                   Stocking
______________________________|________________________________________________
control (no treatment)        |  5% paper birch; 90% aspen;  5% mixed hardwoods
Aug. 1951 cut & Nov. 1958 cut | 90% paper birch; 10% aspen
Nov. 1951 cut & Nov. 1958 cut | 44% paper birch; 41% aspen; 15% mixed hardwoods
Nov. 1951 cut & May 1959      | 
  herbicide (injection in     | 32% paper birch; 63% aspen;  5% mixed hardwoods
____aspen only)_______________|________________________________________________
  • 35.  Crouch, Glenn L. 1981. Regeneration on aspen clearcuts in northwestern        Colorado. Res. Note RM-407. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station. 5 p.  [3381]
  • 36.  Cryer, Douglas H.; Murray, John E. 1992. Aspen regeneration and soils.        Rangelands. 14(4): 223-226.  [19078]
  • 49.  Doucet, Rene. 1989. Regeneration silviculture of aspen.  The Forestry        Chronicle. Feb: 23-27.  [6112]
  • 63.  Graham, Samuel A.; Harrison, Robert P., Jr.; Westell, Casey E., Jr.        1963. Aspens: Phoenix trees of the Great Lakes Region. Ann Arbor, MI:        The Univeristy of Michigan Press. 272 p.  [26670]
  • 67.  Greenway, S. Hawk. 1990. Aspen regeneration: a range management problem.        Rangelands. 12(1): 21-23.  [11778]
  • 77.  Hinds, Thomas E.; Shepperd, Wayne D. 1987. Aspen sucker damage and        defect in Colorado clearcut areas. Res. Paper RM-278. Fort Collins, CO:        U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest        and Range Experiment Station. 12 p.  [3732]
  • 87.  Jones, John R. 1976. Aspen harvesting and reproduction. In: Utilization        and marketing as tools for aspen management in the Rocky Mountains:        Proceedings of the symposium; 1976 September 8-9; Fort Collins, CO. Gen.        Tech. Rep. RM-29. Fort Collins, CO: U.S. Department of Agriculture,        Forest Service, Rocky Mountain Forest and Range Experiment Station:        30-34.  [26854]
  • 90.  Kay, Charles E. 1993. Aspen seedlings in recently burned areas of Grand        Teton and Yellowstone National Parks. Northwest Science. 67(2): 94-104.        [21653]
  • 93.  Kittredge, Joseph, Jr. 1938. The interrelations of habitat, growth rate,        and associated vegetation in the aspen community of Minnesota and        Wisconsin. Ecological Monographs. 8(2): 152-246.  [10356]
  • 96.  LaBonte, George A.; Leso, Robert J. 1990. Cleaning paper birch in a        birch-aspen stand in Maine: a 34 year case history. Northern Journal of        Applied Forestry. 7: 22-23.  [26668]
  • 98.  Lavertu, Denis; Mauffette, Yves; Bergeron, Yves. 1994. Effects of stand        age and litter removal on the regeneration of Populus tremuloides.        Journal of Vegetation Science. 5: 561-568.  [26666]
  • 114.  Ohmann, Lewis F.; Grigal, David F.; Brander, Robert B. 1976. Biomass        estimation for five shrubs from northeastern Minnesota. Res. Pap.        NC-133. St. Paul, MN: U.S. Department of Agriculture, Forest        Service,North Central Forest Experiment Station. 11 p.  [20786]
  • 122.  Perala, Donald A. 1977. Manager's handbook for aspen in the north        central states. Gen. Tech. Rep. NC-36. St. Paul, MN: U.S. Department of        Agriculture, Forest Service, North Central Forest Experiment Station. 30        p.  [5632]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 141.  Schier, George A. 1975. Deterioration of aspen clones in the middle        Rocky Mountains. INT-170. Ogden, UT: U.S. Department of Agriculture,        Forest Service, Intermountain Forest and Range Experiment Station. 14 p.        [5328]
  • 143.  Schier, George A.; Campbell, Robert B. 1978. Aspen sucker regeneration        following burning and clearcutting on two sites in the Rocky Mountains.        Forest Science. 24(2): 303-308.  [3657]
  • 147.  Schier, George A.; Smith, Arthur D. 1979. Sucker regeneration in a Utah        aspen clone after clearcutting, partial cutting, scarification, and        girdling. INT-253. Ogden, UT: U.S. Department of Agriculture, Forest        Service, Intermountain Forest and Range Experiment Station. 6 p.  [3917]
  • 177.  Jones, John R.; Shepperd, Wayne D. 1985. Harvesting. In: DeByle, Norbert        V.; Winokur, Robert P., eds. Aspen: ecology and management in the        western United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S.        Department of Agriculture, Forest Service, Rocky Mountain Forest and        Range Experiment Station: 219-222.  [11924]
  • 178.  Shepperd, Wayne D. 1996. Response of aspen root suckers to regeneration        methods and post-harvest protection. Res. Pap. RM-RP-324. Fort Collins,        CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain        Forest and Range Experiment Station. 8 p.  [26839]
  • 17.  Shields, Paul W. 1981. Opportunities for wildlife Habitat management in        aspen. In: DeByle, Norbert V., ed. Situation management of two        intermountain species: aspen and coyotes; 1981 April 23-24; Logan, UT.        UMC 52. Logan, UT: Utah State University, College of Natural Resources:        69-76.  [11897]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

Contact your local Natural Resources Conservation Service (formerly Soil Conservation Service) office for more information. Look in the phone book under ”United States Government.” The Natural Resources Conservation Service will be listed under the subheading “Department of Agriculture.”

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The thin, soft bark of quaking aspen makes it susceptible to many diseases and insect infestations as well as mechanical and fire damage. Fires may kill trees or cause basal scars that serve as entry points for wood-rotting fungi, which are common in older stands. The wood decays easily. Fires may also kill surface roots that could reduce sucker regeneration.

The poplar borer beetle, one of the most common wood borers of aspen, weakens trees by boring galleries in the trunk near the lower portion of the crown. Outbreaks of forest tent caterpillar may last 4-5 years and result in serious defoliation -- cold weather in the spring shortly after the eggs hatch and above-average fall temperatures can cause a rapid decline in caterpillar populations by killing eggs and larvae. Overgrazing by livestock or big-game animals disturbs roots and compacts soil, limiting sucker formation. Heavy grazing of young sucker stands by cattle for three years in a row may destroy them.

Quaking aspen can be propagated by seed, following cold stratification. Germination of fresh seed may be 80-95%, but viability lasts only 2-4 weeks under favorable natural conditions (low temperature and humidity). Seeds dried for 3 days and stored at cool temperatures may retain good viability for up to a year.

The species roots poorly from woody stem cuttings, but newly initiated (softwood) shoots can usually be induced to root by dipping in IBA (indolebutyric acid) or other commercially available rooting powders. A more preferred method uses root sprouts. Collect dormant lateral roots in early spring -- plant root cuttings 1-2 in diameter and 3-5 centimeters long in vermiculite and place in the greenhouse for 6 weeks. Excise the young sucker shoots and root in perlite/vermiculite (2-3 weeks, using IBA), misting frequently. Transplant the developing plants to peat/vermiculite mix and grow at 15-25º C. Or, the root cuttings may be planted directly into the perlite mix, with the top of the cutting just below the media surface.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

More info for the terms: cover, shrub

Mountain slopes covered by quaking aspen provide high yields of
good-quality water.  Quaking aspen intercepts less snow than conifers,
so snowpack is often greater under quaking aspen [44].

Well-stocked quaking aspen stands provide excellent watershed
protection.  The trees, the shrub and herbaceous understories, and the
litter of quaking aspen stands provide nearly 100 percent soil cover.
Soil cover and the intermixture of herbaceous and woody roots protect
soil except during very intense rains [44].

Quaking aspen is valued for its aesthetic qualities at all times of the
year.  The yellow, orange, and red foliage of autumn particularly
enhances recreational value of quaking aspen sites [85].

Quaking aspen is widely used in ornamental landscaping [85].
  • 44.  DeByle, Norbert V. 1985. Water and watershed. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 153-160.  [11917]
  • 85.  Johnson, Craig W.; Brown, Thomas C.; Timmons, Michael L. 1985. Esthetics        and landscaping. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 185-188.        [26856]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

More info for the terms: litter, restoration, tree

Aspens (Trepidae) are unique in their ability to stabilize soil and
watersheds.  Fire-killed stands are promptly revegetated by root sprouts
(suckers).  The trees produce abundant litter that contains more
nitrogen, phosphorus, potash, and calcium than leaf litter of most other
hardwoods.  The litter decays rapidly, forming a nutrient-rich humus
that may amount to 25 tons per acre (oven-dry basis).  The humus reduces
runoff and aids in percolation and recharge of ground water.  Litter and
humus layers reduce evaporation from the soil surface.  Compared to
conifers, more snow accumulates under quaking aspen and snowmelt begins
earlier in the spring.  Soil under quaking aspen thaws faster and
infiltrates snow more rapidly than soil under conifers [23].

Wide adaptability of quaking aspen makes it well-suited for restoration
and rehabilitation projects on a wide range of sites.  Seedlings
transplanted onto disturbed sites have shown good establishment [33].
Seedlings have some advantages over vegetative cuttings.  In large-scale
greenhouse production, quaking aspen seedlings are more economical to
establish and grow [57].  Seedlings grow a taproot and secondary roots
quickly, while quaking aspen cuttings can be slow to establish an
adequate root system [145].  Also, genetic diversity is greater among
seedlings than cuttings [146].  Seed stored at 4 degrees Fahrenheit (-20
deg C) has retained viability for at least 2 years.  Fung and Hamel [57]
and Schier and others [145] provide procedures for collecting and
processing quaking aspen seed.

The major advantage of using quaking aspen cuttings is that clones with
desirable traits can be selected as parent stock.  Quaking aspen
vegetative cuttings are difficult to root, however [123,146].  Stem
cuttings are especially difficult to root unless taken from young
sprouts.  Root cuttings taken from young sprouts are generally most
successful.  Schier and others [146] provide information on growing
quaking aspen cuttings in the greenhouse.

Case examples - Riparian:  In riparian and lodgepole pine (Pinus
contorta) zones of Lost Canyon near Fresno, California, restoration was
needed after a hydroelectric plant pipe broke, scouring part of the
canyon.  Quaking aspen seedlings showed 99.2 percent survival (or 357
live seedlings) and had a mean height of 10.6 inches (26.6 cm) 1 year
after transplant [33].

Strip-mined sites:  Some old strip-mined sites in Pennsylvania, Ontario,
and elsewhere have not revegetated due to extreme acidity of the soil.
Quaking aspen is one of the first native tree species to volunteer on
these soils after application of lime [81,168].   

Mine spoils:  Quaking aspen transplants were successfully established on
phosphate mine spoils in southeastern Idaho that received only 18 inches
(450 mm) of annual precipitation [145].
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 33.  Chan, Franklin J.; Wong, Raymond M. 1989. Reestablishment of native        riparian species at an altered high elevation site. In: Abell, Dana L.,        technical coordinator. Proceedings of the California riparian systems        conference: Protection, management, and restoration for the 1990's; 1988        September 22-24; Davis, CA. Gen. Tech. Rep. PSW-110. Berkeley, CA: U.S.        Department of Agriculture, Forest Service, Pacific Southwest Forest and        Range Experiment Station: 428-435.  [13771]
  • 57.  Fung, Martin Y. P.; Hamel, Barbara A. 1993. Aspen seed collection and        extraction. Tree Planters' Notes. 44(3): 98-100.  [23354]
  • 81.  Hughes, H. Glenn. 1990. Ecological restoration: fact or fantasy on        strip-mined lands in western Pennsylvania?. In: Hughes, H. Glenn;        Bonnicksen, Thomas M., eds. Restoration '89: the new management        challenge: Proceedings, 1st annual meeting of the Society for Ecological        Restoration; 1989 January 16-20; Oakland, CA. Madison, WI: The        University of Wisconsin Arboretum, Society for Ecological Restoration:        237-243.  [14699]
  • 123.  Perala, D. A. 1990. Populus tremuloides Michx.  quaking aspen. In:        Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics        of North America: Volumbe 2, Hardwoods. Agriculture Handbook 654.        Washington, DC: U.S. Department of Agriculture, Forest Service: 555-569.        [26857]
  • 145.  Schier, George A.; Jones, John R.; Winokur, Robert P. 1985. Vegetative        regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 29-33.        [11905]
  • 146.  Schier, George A.; Shepperd, Wayne D.; Jones, John R. 1985.        Regeneration. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen:        ecology and management in the western United States. Gen. Tech. Rep.        RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest        Service, Rocky Mountain Forest and Range Experiment Station: 197-208.        [11921]
  • 168.  Winterhalder, Keith. 1990. The trigger-factor approach to the initiation        of natural regeneration of plant communities on industrially-damaged        lands at Sudbury, Ontario. In: Hughes, H. Glenn; Bonnicksen, Thomas M.,        eds. Restoration '89: the new management challenge: Proceedings, 1st        annual meeting of the Society for Ecological Restoration; 1989 January        16-20; Oakland, CA. Madison, WI: The University of Wisconsin Arboretum,        Society for Ecological Restoration: 215-226.  [14697]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Value

More info for the terms: cover, shrub

Wild and domestic ungulates use quaking aspen for summer shade, and
quaking aspen provides some thermal cover for ungulates in winter
[42,35,152].  Seral quaking aspen communities provide excellent hiding
cover for moose, elk, and deer [42,161].  Deer use quaking aspen stands
for fawning grounds in the West [94].  Ungulates generally do not use
quaking aspen much in winter.  Perala [122] reported that in the Great
Lake States, pure quaking aspen stands provided white-tailed deer with
relatively poor insulation and protection from winter winds compared to
adjacent stands of conifers.

Quaking aspen provides good hiding and thermal cover for many small
mammals [152].  Snowshoe hare use it for hiding and resting cover in
summer [42,43].  Beaver use quaking aspen branches for dams and lodges.

A variety of bird species use quaking aspen for hiding, nesting, and
roosting cover [42].  Sapling and pole-size stands provide especially
good winter cover for birds [23].  Snow tends to accumulate earlier and
deeper in quaking aspen than in adjacent conifer stands, and ruffed
grouse use the deep snow for burrowing cover in winter [122].  Dense
stands of fairly small diameter stems ( less than 6 inches [15cm]) provide the
best protection from predators.  Overall cover value for ruffed grouse
is enhanced in stands containing several size classes [70].
       
Over 4 years, 22 to 65 pairs of breeding birds were found in 10 acres (4
ha) of quaking aspen in northern Utah.  Species nesting in quaking aspen
included the broad-tailed hummingbird, northern flicker, house wren,
American robin, warbling vireo, yellow-rumped warbler, junco, western
wood pewee, and lazuli bunting [39].  The following other species also
nest in mature quaking aspen communities [42]:

       canopy nesters -  pewees, vireos, western tanager, Cassin's finch,
         least flycatcher
       ground nesters -  hermit thrush, Townsend`s solitaire, dark-eyed junco,
         white-crowned and Lincoln`s sparrows, veery, ovenbird, nighthawk,
         Connecticut and mourning warblers
       shrub nesters - flycatchers (Empidonax spp.), rose-breasted and
         black-headed grosbeaks, chipping, clay-colored, and song sparrows,
         yellow and MacGillivray`s warblers, rufous-sided and
         green-sided towhees, black-billed cuckoo
       cavity nesters - chickadees, nuthatches, woodpeckers, owls,
         sapsuckers, hairy and downy woodpeckers

General cover value of quaking aspen has been rated as follows [48]:

                       CO       MT       ND       OR       UT       WY
Pronghorn             ----     ----     Poor     ----     Poor     Poor
Elk                   Fair     Good     ----     ----     Good     Good
Mule deer             Fair     Good     Poor     ----     Good     Good
White-tailed deer     Fair     Good     Fair     ----     ----     Good
Small mammals         ----     Good     ----     ----     Good     Good
Small nongame birds   Good     Good     Good     ----     Good     Good
Upland game birds     Poor     Good     Good     ----     Good     Good
Waterfowl             ----     ----     ----     ----     Poor     Poor
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 35.  Crouch, Glenn L. 1981. Regeneration on aspen clearcuts in northwestern        Colorado. Res. Note RM-407. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station. 5 p.  [3381]
  • 39.  DeByle, Norbert V. 1981. Songbird populations and clearcut harvesting of        aspen in northern Utah. Res. Note INT-302. Ogden, UT: U.S. Department of        Agriculture, Forest Service, Intermountain Forest and Range Experiment        Station. 7 p.  [5398]
  • 42.  DeByle, Norbert V. 1985. Wildlife. In: DeByle, Norbert V.; Winokur,        Robert P., eds. Aspen: ecology and management in the western United        States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station: 135-152.  [11916]
  • 43.  DeByle, Norbert V. 1985. Animal impacts. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 115-123.  [11914]
  • 48.  Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information        network (PIN) data base: Colorado, Montana, North Dakota, Utah, and        Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior,        Fish and Wildlife Service. 786 p.  [806]
  • 70.  Gullion, Gordon W.; Svovoda, Franklin J. 1972. The basic habitat        resource for ruffed grouse. In: Aspen: Symposium proceedings; [Date of        conference unknown]
  • 94.  Kovalchik, Bernard L. 1987. Riparian zone associations: Deschutes,        Ochoco, Fremont, and Winema National Forests. R6 ECOL TP-279-87.        Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific        Northwest Region. 171 p.  [9632]
  • 122.  Perala, Donald A. 1977. Manager's handbook for aspen in the north        central states. Gen. Tech. Rep. NC-36. St. Paul, MN: U.S. Department of        Agriculture, Forest Service, North Central Forest Experiment Station. 30        p.  [5632]
  • 152.  Shepperd, Wayne D. 1986. Silviculture of aspen forests in the Rocky        Mountains and Southwest. RM-TT-7. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station. 38 p.  [5098]
  • 161.  U.S. Department of Agriculture, Forest Service. 1937. Range plant        handbook. Washington, DC. 532 p.  [2387]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nutritional Value

Overall energy and protein values of quaking aspen are rated "fair"
[48].  Nutritional content of quaking aspen browse varies seasonally, by
plant part, and by clone [11,40,159].  Protein content drops as the
growing season progresses [42,179].  On a Utah site, average leaf
protein dropped from 17 percent in early June to 3 percent at
abscission.  Clonal variation in leaf protein ranged from 13.4 to 20.9
percent in June and from 10.1 to 14.6 percent in September.  Average
twig protein dropped from 17 percent in spring to 6 to 7 percent in
winter.  Twig nitrogen, phosphorus, and potassium levels dropped from
spring to winter, but twig calcium, magnesium, sodium, and fat levels
increased.  Phosphorus values in September averaged only 58 percent of
those in June [159].

Mean composition of quaking aspen terminal shoots, collected in March
and April in Soldotna, Alaska, was as follows [149]:

     dry matter (%)                       43.6
     gross energy (kcal/g)                 5.1
     crude protein (%)                     7.9
     neutral-detergent fiber (%)          54.9
     acid-detergent fiber (%)             40.1
     lignin (%)                           10.5
     ash (%)                               1.9
     in-vitro digestibility for moose (%)  42.0
  • 11.  Bartos, Dale L.; Johnston, Robert S. 1978. Biomass and nutrient content        of quaking aspen at two sites in the western United States. Forest        Science. 24(2): 273-280.  [16913]
  • 40.  DeByle, N. V. 1985. Environment of Populus tremuloides. In: Proceedings        of the 1985 Society of American Foresters National Convention; 1985 July        28 - July 31; Fort Collins, CO. Bethesda, MD: Society of American        Foresters: 87-91.  [222]
  • 42.  DeByle, Norbert V. 1985. Wildlife. In: DeByle, Norbert V.; Winokur,        Robert P., eds. Aspen: ecology and management in the western United        States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station: 135-152.  [11916]
  • 48.  Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information        network (PIN) data base: Colorado, Montana, North Dakota, Utah, and        Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior,        Fish and Wildlife Service. 786 p.  [806]
  • 149.  Schwartz, Charles C.; Regelin, Wayne L.; Franzmann, Albert W. 1988.        Estimates of digestibility of birch, willow, and aspen mixtures in        moose. Journal of Wildlife Management. 52(1): 33-37.  [4535]
  • 159.  Tew, Ronald K. 1970. Seasonal variation in the nutrient content of aspen        foliage. Journal of Wildlife Management. 34(2): 475-478.  [3771]
  • 179.  Canon, S. K.; Urness, P. J.; DeByle, N. V. 1987. Habitat selection,        Foraging behavior, and dietary nutrition of elk in burned aspen forest.        Journal of Range Management. 40(5): 443-438.  [3453]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

Quaking aspen is palatable to all browsing livestock and wildlife
species [38,23,42,84,161,169].  The buds, flowers, and seeds are
palatable to many bird species including numerous songbirds and ruffed
and sharp-tailed grouse [42,168].

Palatability of quaking aspen for livestock and wildlife species has
been rated as follows [48]:

                       CO       MT       ND       OR       UT       WY
Cattle                Fair     Fair     Fair     ----     Fair     Fair
Domestic sheep        Fair     Good     Good     ----     Fair     Good
Horses                Fair     Fair     Fair     ----     Fair     Fair
Pronghorn             ----     ----     Poor     ----     Fair     Fair
Elk                   Good     Fair     ----     ----     Good     Good
Mule deer             Good     Fair     Fair     ----     Good     Good
White-tailed deer     Good     Fair     Fair     ----     ----     Good
Small mammals         ----     Fair     ----     ----     Fair     Good
Small nongame birds   ----     Fair     Fair     ----     Fair     Fair
Upland game birds     ----     Good     Good     ----     Fair     Good
Waterfowl             ----     ----     ----     ----     Poor     Poor
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 38.  DeByle, Norbert V. 1979. Potential effects of stable versus fluctuating        elk populations in the aspen ecosystem. In: Boyce, Mark S.; Hayden-Wing,        Larry D, eds. North American elk, ecology, behavior and management.        Laramie, WY: University of Wyoming: 294.  [3458]
  • 42.  DeByle, Norbert V. 1985. Wildlife. In: DeByle, Norbert V.; Winokur,        Robert P., eds. Aspen: ecology and management in the western United        States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station: 135-152.  [11916]
  • 48.  Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information        network (PIN) data base: Colorado, Montana, North Dakota, Utah, and        Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior,        Fish and Wildlife Service. 786 p.  [806]
  • 84.  Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed        deer, Odocoileus virginianus, on a burn in boreal forest. Canadian        Field-Naturalist. 99(2): 240-245.  [4513]
  • 161.  U.S. Department of Agriculture, Forest Service. 1937. Range plant        handbook. Washington, DC. 532 p.  [2387]
  • 168.  Winterhalder, Keith. 1990. The trigger-factor approach to the initiation        of natural regeneration of plant communities on industrially-damaged        lands at Sudbury, Ontario. In: Hughes, H. Glenn; Bonnicksen, Thomas M.,        eds. Restoration '89: the new management challenge: Proceedings, 1st        annual meeting of the Society for Ecological Restoration; 1989 January        16-20; Oakland, CA. Madison, WI: The University of Wisconsin Arboretum,        Society for Ecological Restoration: 215-226.  [14697]
  • 169.  Youngblood, Andrew P. 1981. Aspen community type classifications in the        Intermountain West. In: DeByle, Norbert V., ed. Symposium        proceedings--situation management of two Intermountain species: aspen        and coyotes. Volume 1. Aspen; 1981 April 23-24; Logan, UT. Logan, UT:        Utah State University, College of Natural Resources: 40-57.  [10437]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

More info for the terms: density, forbs, hardwood, mesic, tree

Quaking aspen forests provide important breeding, foraging, and resting
habitat for a variety of birds and mammals.  Wildlife and livestock
utilization of quaking aspen communities varies with species composition
of the understory and relative age of the quaking aspen stand.  Young
stands generally provide the most browse.  Quaking aspen crowns can grow
out of reach of large ungulates in 6 to 8 years [116].  Although many
animals browse quaking aspen year-round, it is especially valuable
during fall and winter, when protein levels are high relative to other
browse species [159].

Large wild ungulates:  Elk browse quaking aspen year-round in much of
the West, feeding on bark, branch apices, and sprouts [38,42,102].  In
some areas, elk use it mainly in winter [116].  In northwestern Wyoming,
elk begin browsing quaking aspen as soon as they move onto winter ranges
in November and continue to use it through March [6].

Quaking aspen is important forage for mule and white-tailed deer.  Deer
consume the leaves, buds, twigs, bark, and sprouts [42,102,158].  New
growth on burns or clearcuts is especially palatable to deer [42,43].
Deer in many areas use quaking aspen year-round [23], although in some
western states, deer winter below the aspen zone [42,43].  Quaking aspen
communities are described as the major "deer-producing forest type" in
the north-central United States [31].  In the Great Lakes States,
quaking aspen is primary browse for white-tailed deer and moose [23].
Stands less than 30 years of age provide optimum forage for deer in
Minnesota [31].  In some locations, sprouts provide key summer forage
for deer after herbaceous species have cured [42,43].  Quaking aspen is
one of the most important items in the summer diet of mule deer on the
Kaibab National Forest of Arizona [159,161], and comprises up to 27
percent of the summer diet of mule deer in parts of central Utah [113].
However, it is relatively unimportant deer browse in parts of South
Dakota [159].  Mule deer in Utah have been observed consuming large
amounts of quaking aspen leaves after autumn leaf fall [42,161].

Quaking aspen is valuable moose browse for much of the year [23].  Moose
utilize it on summer [42] and winter ranges [23,42,135].  Quaking aspen,
paper birch (Betula papyrifera), and willows (Salix spp.) make up more
than 95 percent of the winter hardwood browse utilized by moose on
Alaska's Kenai Peninsula [149].  Relatively high levels of moose use
have been reported from early summer through late fall in Minnesota [84]
and Idaho [135].  Young stands generally provide the best quality moose
browse [42].  However, researchers in Idaho found that in winter, moose
browsed mature stands of quaking aspen more heavily than nearby
clearcuts dominated by quaking aspen sprouts [135].

Bison once favored quaking aspen-grassland transition zones in Manitoba
and Saskatchewan [32,102].  However, little is known about the historic
importance of quaking aspen browse to bison.  Meagher [105] found that
woody plants made up only 1 percent of the diet of bison in Yellowstone
National Park, and she did not list quaking aspen as one of the woody
species bison used.

Bears:  Black and grizzly bears feed on forbs and berry-producing shrubs
in quaking aspen understories.  Quaking aspen forests in Alberta provide
excellent denning and foraging sites for black bear [42].

Lagomorphs:  Rabbits and hares feed on quaking aspen in summer and
winter [42,43].  In winter, snowshoe hare and cottontail rabbits eat
quaking aspen buds, twigs, and bark [42,43].  Quaking aspen is one of
the most important and nutritious summer browse species for rabbits in
Alberta [42], and is a preferred winter food of snowshoe hare in
Manitoba [20].  Pikas also feed on quaking aspen buds, twigs, and bark
[158].  Lagomorphs may girdle suckers or even mature trees [23,102].  In
some parts of Canada, fairly high quaking aspen mortality has been
attributed to rabbits and hares [20,102].

Rodents and shrews:  Small rodents such as squirrels, pocket gophers,
mice, and voles feed on quaking aspen during at least part of the year
[43,88,158].  Mice and voles frequently consume quaking aspen bark below
snow level, and can girdle suckers and small trees [23,43,88,152].  The
southern red-backed vole, deer mouse, and white-footed mouse are
dominant small mammals in quaking aspen communities of northern
Minnesota and upper Michigan.  Small mammal populations in quaking aspen
generally fluctuate widely with stand age and annual variation in animal
population size.  Highest densities typically occur in mature quaking
aspen stands.  Field mice (Peromyscus spp.), for example, are most
abundant in mature quaking aspen communities [129].  The red-backed
vole, however, is most abundant in sapling stands, somewhat less
abundant in mature stands, and least common in clearcuts.

Quaking aspen provides food for porcupine in winter and spring
[23,42,43].  In winter, porcupine eat the smooth outer bark of the upper
trunk and branches.  Porcupine girdling of quaking aspen has killed
large tracts of merchantable trees in Minnesota.  In spring, porcupine
eat quaking aspen buds and twigs [43].

Beaver consume the leaves, bark, twigs, and all diameters of quaking
aspen branches [43].  They use quaking aspen stems for constructing dams
and lodges [42,102].  At least temporarily, beaver can eliminate quaking
aspen from as far as 400 feet (122 m) from waterways [6,23].  An
individual beaver consumes 2 to 4 pounds (1-2 kg) of quaking aspen bark
daily, and it is estimated that as many as 200 quaking aspen stems are
required to support one beaver for a 1-year period [42,43].

Birds:  Quaking aspen communities provide important feeding and nesting
sites for a diverse array of birds [39].  Bird species using quaking
aspen habitat include sandhill crane, western wood pewee, six species of
ducks, blue, ruffed, and sharp-tailed grouse, band-tailed pigeon,
mourning dove, wild turkey, red-breasted nuthatch, and pine siskin.
Quaking aspen is host to a variety of insects that are food for
woodpeckers and sapsuckers [42].  Generally, moist to mesic quaking
aspen sites have greater avian species diversity than quaking aspen
stands on dry sites [40,42].

Many bird species utilize quaking aspen communities of only a particular
seral stage.  Research at a northern Utah site suggests that blue
grouse, yellow-rumped warbler, warbling vireo, dark-eyed junco, house
wren, and hermit thrush prefer mature quaking aspen stands.  The
MacGillivray's warbler, chipping and song sparrows, and lazuli bunting
occur in younger stands [39,42].  Bluebirds, tree swallow, pine siskin,
yellow-bellied sapsucker, and black-headed grosbeak favor quaking aspen
community edges [39].

Ruffed grouse:  Through most of its range, ruffed grouse depends on
quaking aspen for foraging, courting, breeding, and nesting sites
[23,42,70].  It uses quaking aspen communities of all ages.  Favorable
ruffed grouse habitat includes quaking aspen stands of at least three
different size classes [23,70].  Young (2- to 10-year-old) stands
provide important brood habitat, and 10- to 25-year-old stands are
favored overwintering and breeding areas [122].  Quaking aspen leaves
and buds are readily available in abundant quantities in stands greater
than 25 years of age, and such older stands are used for foraging
[70,122].

Ruffed grouse chicks find protection in dense, young aspen suckers as
early as 1 year after fire or other disturbance [70].  Pole-size stands
appear to offer the best breeding habitat and may support one breeding
bird per 3 to 4 acres (1.2-1.6 ha).  Breeding generally does not occur
in stands exceeding 25 years of age or with a density less than
approximately 2,000 stems per acre [23].

Quaking aspen buds, catkins, and leaves provide an abundant and
nutritious, year-long food source for ruffed grouse [23,70].  Vegetative
and flower buds are the primary winter and spring foods of the ruffed
grouse.  Ruffed grouse eat 6 times more quaking aspen buds than buds
from all other species combined [70].  It is estimated that ruffed
grouse can consume more than 45 quaking aspen buds per minute and can
satisfy their daily winter food needs in as little as 15 to 20 minutes
[23].  Ruffed grouse generally begin feeding on staminate flower buds
from several weeks prior to the period of snow accumulation, and continue
well into early spring [23,70].  Male ruffed grouse feed on staminate
catkins until at least early May [70].  Nesting hens consume large
quantities of new quaking aspen leaves early in the spring [23,70].
Ruffed grouse consume quaking aspen leaves throughout the summer [23],
and the leaves are considered to be the second most important food
source during the fall.  Ruffed grouse appear to prefer certain clones.
Buds from some clones may be up to 30 percent richer in protein than
buds from neighboring clones [70].

Livestock:  Most classes of domestic livestock use quaking aspen.
Domestic sheep and cattle browse the leaves and twigs [158,161].
Domestic sheep browse quaking aspen more heavily than cattle [158,161].
It is estimated that domestic sheep consume 4 times more quaking aspen
sprouts than cattle.  Heavy livestock browsing can adversely impact
quaking aspen growth and regeneration [42,43,161].
  • 6.  Barmore, William J., Jr.; Taylor, Dale; Hayden, Peter. 1976. Ecological        effects and biotic succession following the 1974 Waterfalls Canyon Fire        in Grand Teton National Park. Research Progress Report 1974-1975.        Unpublished report on file at: U.S. Department of Agriculture, Forest        Service, Intermountain Fire Sciences Laboratory, Missoula, MT. 99 p.        [16109]
  • 20.  Bird, Ralph D. 1930. Biotic communities of the aspen parkland of central        Canada. Ecology. 11(2): 356-442.  [15277]
  • 23.  Brinkman, Kenneth A.; Roe, Eugene I. 1975. Quaking aspen: silvics and        management in the Lake States. Agric. Handb. 486. Washington, DC: U.S.        Department of Agriculture, Forest Service. 52 p.  [5107]
  • 31.  Byelich, John D.; Cook, Jack L.; Blouch, Ralph I. 1972. Management for        deer. In: Aspen: Symposium proceedings; [Date of conference unknown]
  • 32.  Campbell, Celina; Campbell, Ian D.; Blyth, Charles B.; McAndrews, John        H. 1994. Bison extirpation may have caused aspen expansion in western        Canada. Ecography. 17(4): 360-362.  [25941]
  • 38.  DeByle, Norbert V. 1979. Potential effects of stable versus fluctuating        elk populations in the aspen ecosystem. In: Boyce, Mark S.; Hayden-Wing,        Larry D, eds. North American elk, ecology, behavior and management.        Laramie, WY: University of Wyoming: 294.  [3458]
  • 39.  DeByle, Norbert V. 1981. Songbird populations and clearcut harvesting of        aspen in northern Utah. Res. Note INT-302. Ogden, UT: U.S. Department of        Agriculture, Forest Service, Intermountain Forest and Range Experiment        Station. 7 p.  [5398]
  • 40.  DeByle, N. V. 1985. Environment of Populus tremuloides. In: Proceedings        of the 1985 Society of American Foresters National Convention; 1985 July        28 - July 31; Fort Collins, CO. Bethesda, MD: Society of American        Foresters: 87-91.  [222]
  • 42.  DeByle, Norbert V. 1985. Wildlife. In: DeByle, Norbert V.; Winokur,        Robert P., eds. Aspen: ecology and management in the western United        States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station: 135-152.  [11916]
  • 43.  DeByle, Norbert V. 1985. Animal impacts. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 115-123.  [11914]
  • 70.  Gullion, Gordon W.; Svovoda, Franklin J. 1972. The basic habitat        resource for ruffed grouse. In: Aspen: Symposium proceedings; [Date of        conference unknown]
  • 84.  Irwin, Larry L. 1985. Foods of moose, Alces alces, and white-tailed        deer, Odocoileus virginianus, on a burn in boreal forest. Canadian        Field-Naturalist. 99(2): 240-245.  [4513]
  • 88.  Jones, John R.; DeByle, Norbert V. 1985. Fire. In: DeByle, Norbert V.;        Winokur, Robert P., eds. Aspen: ecology and management in the western        United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station: 77-81.  [11910]
  • 102.  Maini, J. S. 1968. Silvics and ecology of Populus in Canada. In: Maini,        J. S.; Cayford, J. H., eds. Growth and utilization of poplars in Canada.        Departmental Publication No. 1205. Ottawa, ON: Department of Forestry        and Rural Development: 20-69.  [6500]
  • 105.  Meagher, Mary M. 1973. The bison of Yellowstone National Park.        Scientific Monograph Series 1. [Denver, CO]
  • 113.  Mueggler, W. F. 1985. Forage. In: DeByle, Norbert V.; Winokur, Robert        P., eds. Aspen: ecology and management in the western United States.        Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station: 129-134.  [11915]
  • 116.  Patton, David R.; Jones, John R. 1977. Managing aspen for wildlife in        the Southwest. Gen. Tech. Rep. RM-37. Fort Collins, CO: U.S. Department        of Agriculture, Forest Service, Rocky Mountain Forest and Range        Experiment Station. 7 p.  [5410]
  • 122.  Perala, Donald A. 1977. Manager's handbook for aspen in the north        central states. Gen. Tech. Rep. NC-36. St. Paul, MN: U.S. Department of        Agriculture, Forest Service, North Central Forest Experiment Station. 30        p.  [5632]
  • 129.  Probst, John R.; Rakstad, Donald S. 1987. Small mammal communities in        three aspen stand-age classes. Canadian Field-Naturalist. 101(3):        362-368.  [4529]
  • 135.  Ritchie, Brent W. 1978. Ecology of moose in Fremont County, Idaho.        Wildlife Bulletin No. 7. Boise, ID: Idaho Department of Fish and Game.        33 p.  [4482]
  • 149.  Schwartz, Charles C.; Regelin, Wayne L.; Franzmann, Albert W. 1988.        Estimates of digestibility of birch, willow, and aspen mixtures in        moose. Journal of Wildlife Management. 52(1): 33-37.  [4535]
  • 152.  Shepperd, Wayne D. 1986. Silviculture of aspen forests in the Rocky        Mountains and Southwest. RM-TT-7. Fort Collins, CO: U.S. Department of        Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment        Station. 38 p.  [5098]
  • 158.  Stubbendieck, J.; Hatch, Stephan L.; Hirsch, Kathie J. 1986. North        American range plants. 3rd ed. Lincoln, NE: University of Nebraska        Press. 465 p.  [2270]
  • 159.  Tew, Ronald K. 1970. Seasonal variation in the nutrient content of aspen        foliage. Journal of Wildlife Management. 34(2): 475-478.  [3771]
  • 161.  U.S. Department of Agriculture, Forest Service. 1937. Range plant        handbook. Washington, DC. 532 p.  [2387]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

More info for the terms: fuel, resistance

Quaking aspen is one of the most important timber trees in the East.
Its wood is used primarily for particleboard, especially waferboard and
oriented strandboard, and for pulp.  In the Great Lakes States, quaking
aspen is the preferred species for making oriented strandboard.  Quaking
aspen fibers are well suited for making fine paper.  Some quaking aspen
is used for lumber.  Quaking aspen lumber is used for making boxes,
crates, pallets, and furniture.  A small but growing volume is made into
studs.  Quaking aspen wood is little used in the West, except in
Colorado, where it is used for pulp and particleboard [125].  Specialty
products from quaking aspen wood include excelsior, matchsticks, and
tongue depressors.  Quaking aspen pellets are used for fuel [125,170].

The wood of quaking aspen is light, soft, and straight grained.  It has
good dimensional stability and it turns, sands, and holds glue and paint
well.  It has relatively low strength, however, and is moderately low in
shock resistance.  Both sapwood and heartwood have low decay resistance
and are difficult for preservatives to penetrate [125,170].  Quaking
aspen wood warps with conventional processing, but saw-dry-rip
processing controls warping [101].
  • 125.  Perala, Donald A.; Carpenter, Eugene M. 1985. Aspen: An American wood.        FS-217. Washington, DC: U.S. Department of Agriculture, Forest Service.        8 p.  [4122]
  • 101.  Maeglin, Robert R. 1990. Structural lumber from aspen: using the        saw-dry-rip (SDR) process. In: Adams, Roy D.,, ed. Aspen symposium '89:        Proceedings of symposium; 1989 July 25-27; Duluth, MN. Gen. Tech. Rep.        NC-140. St. Paul, MN: U.S. Department of Agriculture, Forest Service,        North Central Forest Experiment Station: 283-287.  [26853]
  • 170.  Youngquist, John A.; Spelter, Henry. 1990. Aspen wood products        utilization: impact of the Lake States composites industry. In: Adams,        Roy D., ed. Aspen symposium '89: Proceedings of symposium; 1989 July        25-27; Duluth, MN. Gen. Tech. Rep. NC-140. St. Paul, MN: U.S. Department        of Agriculture, Forest Service, North Central Forest Experiment Station:        91-102.  [26858]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

The preference is full sun, moist to dry-mesic conditions, and a relatively loose soil containing sandy loam or silty loam. However, this tree also adapts to soil containing gravel or clay. Hot dry weather during the summer is stressful to this tree. Growth and development are fairly rapid during the first 20 years of life, after which this tree grows more slowly. An individual tree is relatively short-lived (up to 50 years), however a clonal colony of Quaking Aspen can persist for hundreds and perhaps thousands of years. The tiny seeds remain viable for only 1-2 weeks.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Special Uses

Aspen provides habitat for a wide variety of wildlife needing  young forests, including hare, black bear, deer, elk, ruffed  grouse, woodcock, and a number of smaller birds and animals.  Ruffed grouse use all age classes of aspen-sapling stands for  brooding, pole stands for overwintering and breeding, and older  stands for nesting cover and winter food (53,55,67,68).

    Aspen forests allow more water or ground water recharge and  streamflow than do conifer forests. This is primarily due to  lower seasonal water losses to interception and transpiration by  aspen compared to conifers (34). Clearcutting the aspen  type may increase streamflow by as much as 60 percent during the  first year. Subsequently, water yields gradually decline to  preharvest levels and stabilize when maximum leaf area is  attained at about age 10 to 25 (53).

    The aspen type is esthetically appealing. The light bark and  autumn colors are a pleasing contrast to dark conifers. In the  West in particular, the type is used by recreationists during all  seasons of the year.

    Aspen stands produce abundant forage-as much as 1100 to 2800 kg/ha  (1,000 to 2,500 lb/acre) in the Rockies annually, or three to six  times more than typical conifer stands. These amounts are  comparable to forage production on some grasslands. Although the  type is sought after for summer sheep and cattle range in the  West, its use for grazing in the East is much more limited (28).

    Aspen stands, because of low fuel accumulations, are low in  flammability and make excellent firebreaks. Violent crown fires  in conifers commonly drop to the ground and sometimes are even  extinguished when they reach an aspen stand (28).

    Whole-tree aspen chips can be processed into nutritious animal  feed ("Muka") or biomass fuels (82). Aspen could be  grown for such purposes in dense sucker stands on biological  rotations of 26 to 30 years (16).

    Wood products from aspen include pulp, flakeboard, particleboard,  lumber, studs, veneer, plywood, excelsior, shingles, novelty  items, and wood flour. Aspen makes particularly good sauna  benches and playground structures because the wood surface does  not splinter.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

D. A. Perala

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Industry: Quaking aspen is an important fiber source, especially for pulp, flake-board, and other composite products. The wood is light and soft with little shrinkage (see Wheeler 2000) and is used for pallets, boxes, veneer, and plywood. Higher grades are used for other solid wood products, such as paneling, furniture components, and flooring. The wood characteristics make it useful in miscellaneous products, including excelsior, animal bedding, matchsticks, toys, beehives, tongue depressors, spoons, and ice cream sticks. It makes good playground structures because the surface does not splinter, although the wood warps and susceptible to decay.

Conservation: Quaking aspen is valued for its white bark and brilliant fall color, especially when clustered. The species been widely used in landscaping but is best in sites away from structures that might be damaged by the aggressive roots. The trees provide good visual screening and noise abatement.

Aspen stands are good firebreaks, often dropping crown fires in conifer stands to the ground when they reach aspens and even sometimes extinguishing the fire because of the small amount of flammable accumulation. They allow more ground water recharge than do conifer forests and they also play a significant role in protecting against soil erosion. They have been used in restoration of riparian habitats.

Wildlife: Young quaking aspen provides food and habitat for a variety of wildlife: black bear, deer, beaver, porcupine, elk, moose, ruffed grouse and many smaller birds and animals, including small mammals such as mice, voles, shrews, chipmunks, and rabbits. Bark, buds, new sprouts, twigs from the tops of fallen or logged trees, and fallen leaves all are wildlife foods.

Ethnobotanic: Native Americans used Populus bark (including aspen) as a food source. They cut the inner bark into strips, dried and ground it into meal to be mixed with other starches for bread or mush. Catkins were eaten raw, and the cambium was eaten raw or in a soup.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Populus tremuloides

Populus tremuloides is a deciduous tree native to cooler areas of North America, one of several species referred to by the common name Aspen. It is commonly called quaking aspen,[1][2] trembling aspen,[1][2] American aspen,[2] Quakies,[1] mountain or golden aspen,[3] trembling poplar,[3] white poplar,[3] popple,[3] and even more names.[3] The trees have tall trunks, up to 25 m (82 ft) tall, with smooth pale bark, scarred with black. The glossy green leaves, dull beneath, become golden to yellow, rarely red, in autumn. The species often propagates through its roots to form large groves.

The Quaking Aspen is the most widely distributed tree in North America, being found from Canada to central Mexico.[4] It is the defining species of the aspen parkland biome in the Prairie Provinces of Canada.

Contents

Name

The quaking or trembling of the leaves that is referred to in the common names is due to the flexible flattened petioles. The specific epithet, tremuloides, means similar to Populus tremula, the European aspen. Some species of Populus have petioles flattened partially along their length, while the aspens and some other poplars have them flattened from side to side along the entire length of the petiole.

Description

Aspen trees at the base of Maroon Bells near Aspen, Colorado

A tall, fast growing tree, usually 20–25 m (66–82 ft) at maturity, with a trunk 20–80 cm (0.66–2.6 ft) in diameter; records are 36.5 m (120 ft) in height and 1.37 m (4.5 ft) in diameter.

The bark is relatively smooth greenish-white to gray and is marked by thick black horizontal scars and prominent black knots.

The leaves on mature trees are nearly round, 4–8 centimetres (1.6–3.1 in) in diameter with small rounded teeth, and a 3–7 centimetres (1.2–2.8 in) long, flattened petiole. Young trees (including root sprouts) have much larger—10–20 centimetres (3.9–7.9 in) long—nearly triangular leaves.

The flowers are catkins 4–6 centimetres (1.6–2.4 in) long, produced in early spring before the leaves; it is dioecious, with male and female catkins on different trees. The fruit is a 10-centimetre (3.9 in) long pendulous string of 6-millimetre (0.24 in) capsules, each capsule containing about ten minute seeds embedded in cottony fluff, which aids wind dispersal of the seeds when they are mature in early summer.

Distribution

The northern limit is determined by its intolerance of permafrost. It occurs across Canada in all provinces and territories, with the possible exception of Nunavut. In the United States, it can be found as far north as the southern slopes of the Brooks Range in Alaska, and it occurs at low elevations as far south as northern Nebraska and central Indiana. In the western United States, this tree rarely survives at elevations lower than 1,500 feet (460 m) due to the mild winters experienced below that elevation, and is generally found at 5,000–12,000 feet (1,500–3,700 m). It grows at high altitudes as far south as Guanajuato, Mexico

Shrub-like dwarf clones exist in marginal environments too cold and dry to be hospitable to full-size trees, for example at the species' upper elevation limits in the White Mountains.

Trembling aspen at sunset

Ecology

Individual clonal colonies can be discerned during the autumn, as seen on this mountainside in the Matanuska Valley in Alaska.

It propagates itself primarily through root sprouts, and extensive clonal colonies are common. Each colony is its own clone, and all trees in the clone have identical characteristics and share a single root structure. A clone may turn color earlier or later in the fall than its neighbouring aspen clones. Fall colors are usually bright tones of yellow; in some areas, red blushes may be occasionally seen. As all trees in a given clonal colony are considered part of the same organism, one clonal colony, named Pando, is considered the heaviest[5] and oldest[1] living organism at six million kilograms and approximately 80,000 years old. Aspens do produce seeds, but seldom grow from them. Pollination is inhibited by the fact that aspens are either male or female, and large stands are usually all clones of the same sex. Even if pollinated, the small seeds (three million per pound) are only viable a short time as they lack a stored food source or a protective coating.[6]

Dieback

Beginning in 1996, individual North American scientists noticed an increase in dead or dying aspen trees. As this accelerated in 2004, word spread and a debate over causes began. No insect, disease, or environmental condition is yet specifically identified as a joint cause. Trees adjacent to one another are often stricken or not. In other instances, entire groves have died.

Many areas of the Western US have experienced increased diebacks which are often attributed to ungulate grazing and wildfire suppression. At high altitudes where grasses can be rare, ungulates can browse young aspen sprouts and prevent those young trees from reaching maturity. As a result, some aspen groves close to cattle or other grazing animals, such as deer or elk, have very few young trees and can be invaded by conifers, which are not typically browsed. Another possible deterrent to aspen regeneration is widespread wildfire suppression. Aspens are vigorous resprouters and even though the above-ground portion of the organism may die in a wildfire, the roots, which are often protected from lethal temperatures during a fire, will sprout new trees soon after a fire. Disturbances such as fires seem to be a necessary ecological event in order for aspens to compete with conifers, which tend to replace aspen over long, disturbance-free intervals. The current dieback in the American West may have roots in the strict fire suppression policy in the United States.[citation needed]

Because of the vegetative regeneration method of reproduction used by the aspen, where an entire group of trees are essentially clones, there is a concern that something that hits one will eventually kill all of the trees, presuming they share the same vulnerability. A conference was held in Utah in September 2006 to share notes and consider investigative methodology.[7]

Populus tremuloides 8163.jpg

Uses

Aspen bark contains a substance that was extracted by Native Americans and the pioneers of the American West as a quinine substitute.[6]

Like other poplars, aspens make poor fuel wood, as they dry slowly, rot quickly, and do not give off much heat. Yet they are still widely used in campgrounds because they are cheap and plentiful and not widely used in building lumber. Pioneers in the North American west used them to create log cabins and dugouts, though they were not the preferred species.

The leaves of the Quaking Aspen and other species in the genus Populus serve as food for caterpillars of various moths and butterflies. See List of Lepidoptera that feed on poplars.

In Canada, it is used mainly for pulp products such as books, newsprint, and fine printing paper. Aspen is especially good for panel products such as oriented strand board and waferboard. Its lumber is light in weight and is used for furniture, boxes and crates, core stock in plywood, and wall panels.

Between logging for fuel, building, and pulp, and clearing for agriculture, the area of aspens declined dramatically in the nineteenth and twentieth centuries.

Notes

  1. ^ a b c d Quaking Aspen by the Bryce Canyon National Park Service
  2. ^ a b c "USDA GRIN taxonomy". http://www.ars-grin.gov/cgi-bin/npgs/html/taxon.pl?29424.
  3. ^ a b c d e "technology transfer fact sheet: Populus spp.". Forest Products Laboratory: R&D USDA. Madison, Wisconsin: United States Department of Agriculture Forest Service, Center for Wood Anatomy Research. http://www.fpl.fs.fed.us/documnts/TechSheets/HardwoodNA/pdf_files/popaspeneng.pdf. Retrieved 20 September 2010.
  4. ^ "Aspen, Quaking (Populus tremuloides)". Arbor Day Foundation. http://www.arborday.org/treeguide/treedetail.cfm?id=122.
  5. ^ Genetic Variation and the Natural History of Quaking Aspen, Jeffry B. Mitton; Michael C. Grant, BioScience, Vol. 46, No. 1. (Jan., 1996), pp. 25-31.
  6. ^ a b Ewing, Susan. The Great Alaska Nature Factbook. Portland: Alaska Northwest Books, 1996.
  7. ^ Kelley, Katie (26 September 2006). "Emblem of the West Is Dying, and No One Can Figure Out Why". The New York Times. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!