Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Ernestia laevigata is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Eumea linearicornis is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Nemoraea pellucida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Phorocera obscura is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Phryno vetula is endoparasitoid of larva of Orthosia cerasi
Remarks: Other: uncertain

Animal / parasitoid / endoparasitoid
larva of Tachina fera is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Tachina lurida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Wagneria gagatea is endoparasitoid of larva of Orthosia cerasi

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthosia cerasi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGCAATTGACTTATTCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGTTTTTGGTTATTACCCCCCTCTTTAACCTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCTCCCCTTTCATCTAACATTGCTCATGGGGGAAGATCTGTTGATTTAGCCATCTTTTCCTTACACTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATCACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTTGGTATTACTGCATTCTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATGCTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orthosia cerasi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common Quaker

Orthosia cerasi
(Fabricius, 1775)

The Common Quaker (Orthosia cerasi) is a moth of the family Noctuidae. Some authors prefer the synonym Orthosia stabilis (Denis & Schiffermüller 1775). It is distributed throughout Europe and is also found in Turkey, Israel, Transcaucasia, Russia and eastern Siberia.

This is a variable species, the ground colour of the forewings ranging from greyish to orangey brown, sometimes with a broad dark band. The most distinctive features are two large stigmata, each edged by a narrow pale line, with a similarly coloured subterminal line. The hindwings are drab grey or brown.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 34–40 mm. Forewing reddish grey, more or less dusted with dark: inner and outer lines blackish, indistinct; orbicular and reniform stigmata ringed with ochreous;submarginal line ochreous preceded by a fuscous or rufous shade; claviform mostly unmarked; veins towards termen pale : hindwing grey, the fringe paler. The species varies according to the amount of red present; — ab. pallida Tutt is pale grey, sometimes with an ochreous flush; — obliqua Vill. is darker grey with markings clearer; — suffusa Tutt is an equally well marked blackish grey form; of these grey forms the second only obliqua Vill. is common; on the other hand when the red tints predominate we get the form rufa Tutt, which is also rare; - in junctus Haw. the upper stigmata, usually separate, are coherent; this accidental connection occurs in all the forms occasionally: — in ab. rufannulata Haw. the stigmata are edged with, and the submarginal line is coloured rufous instead of ochreous.[1]

Biology[edit]

This moth flies at night in March and April [1] and is attracted to light and sugar.

Larva green thickly dotted with yellowish white; all the lines yellowish white; anal segment with a yellowish white cross bar; head green, with black spots.It feeds on various trees and shrubs including apple, buckthorn, elm, oak, pear, poplar and willow as well as various Prunus species.[2] The species overwinters as a pupa.

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!