Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Ernestia laevigata is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Eumea linearicornis is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Nemoraea pellucida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Phorocera obscura is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Phryno vetula is endoparasitoid of larva of Orthosia cerasi
Remarks: Other: uncertain

Animal / parasitoid / endoparasitoid
larva of Tachina fera is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Tachina lurida is endoparasitoid of larva of Orthosia cerasi

Animal / parasitoid / endoparasitoid
larva of Wagneria gagatea is endoparasitoid of larva of Orthosia cerasi

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthosia cerasi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGCAATTGACTTATTCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAATATAAGTTTTTGGTTATTACCCCCCTCTTTAACCTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCTCCCCTTTCATCTAACATTGCTCATGGGGGAAGATCTGTTGATTTAGCCATCTTTTCCTTACACTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATCACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTTGGTATTACTGCATTCTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATGCTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orthosia cerasi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Quaker

Orthosia cerasi
(Fabricius, 1775)

The Common Quaker (Orthosia cerasi) is a moth of the family Noctuidae. Some authors prefer the synonym Orthosia stabilis (Denis & Schiffermüller 1775). It is distributed throughout Europe and is also found in Turkey, Israel, Transcaucasia, Russia and eastern Siberia.

This is a variable species, the ground colour of the forewings ranging from greyish to orangey brown, sometimes with a broad dark band. The most distinctive features are two large stigmata, each edged by a narrow pale line, with a similarly coloured subterminal line. The hindwings are drab grey or brown. The wingspan is 34–40 mm. This moth flies at night in March and April [1] and is attracted to light and sugar.

The larva is bright green with yellow markings and feeds on various trees and shrubs including apple, buckthorn, elm, oak, pear, poplar and willow as well as various Prunus species.[1] The species overwinters as a pupa.

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

References

  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!