Ecology

Habitat

Depth range based on 346 specimens in 1 taxon.
Water temperature and chemistry ranges based on 242 samples.

Environmental ranges
  Depth range (m): 0 - 410
  Temperature range (°C): 4.944 - 17.229
  Nitrate (umol/L): 2.761 - 23.955
  Salinity (PPS): 32.618 - 35.574
  Oxygen (ml/l): 4.147 - 6.394
  Phosphate (umol/l): 0.501 - 1.571
  Silicate (umol/l): 2.387 - 16.914

Graphical representation

Depth range (m): 0 - 410

Temperature range (°C): 4.944 - 17.229

Nitrate (umol/L): 2.761 - 23.955

Salinity (PPS): 32.618 - 35.574

Oxygen (ml/l): 4.147 - 6.394

Phosphate (umol/l): 0.501 - 1.571

Silicate (umol/l): 2.387 - 16.914
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aphroditella hastata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTATATTTTATTTTTGGTACTTGATCAGGCCTCCTTGGTACATCAATAAGTCTACTAATTCGTGCTGAATTAGGCCAACCCGGAGCCTTACTAGGAAGAGACCAATTATACAACACAATCGTAACCGCTCATGCTTTTCTAATAATTTTCTTTCTTGTAATACCAGTTCTAATTGGCGGATTTGGCAATTGATTAATCCCACTTATATTAGGAGCGCCAGACATAGCTTTTCCTCGTCTAAATAACATAAGATTCTGACTTTTACCCCCCTCCCTAACTCTACTACTCGCCTCGGCTGCAGTAGAAAAAGGGGTTGGTACCGGATGAACAGTATATCCCCCACTATCATCTAATATTGCCCATGCAGGCCCCTCTGTAGATTTAGCTATTTTCTCCCTACATATTGCAGGGGCCTCTTCCATCCTTGGAGCCCTAAATTTTATTACTACCGTAATTAATATACGATGAAAAGGTCTACGTCTAGAACGTGTTCCTCTATTTGTATGATCTGCAAAAATTACAGCCATTCTACTACTTCTTTCCTTACCAGTACTTGCTGGAGCAATCACTATACTATTAACTGACCGAAATTTAAATACTGCTTTCTTTGACCCTTCAGGGGGTGGGGATCCAATCCTTTATCAACACCTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aphroditella hastata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!