Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Most of temperate and boreal (but not arctic) eastern Canada and eastern and central USA south into Texas and Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Pretty much any place with trees, especially red or silver maples or box elders (all Acer spp.), including forests and backyards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: For such an extremely abundant moth, the foodplants are remarkably poorly documented and include such plants as tobacco, lawn grass, various maples, scrub oak, and others. It appears the eggs are laid among the buds of early flowering trees like red maple or elms, and that the larvae start in these buds and flowers. Older larvae are usually encountered on low plants or in the forest litter so apparently the larvae fall with the remains of these early flowers and then eat whatever they can find, even dead leaves if necessary, but probably mostly young leaves of herbs, seedlings, and low shrubs. They do not seem to eat other caterpillars.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: The moths fly in the fall, mostly September in the far north, late September into January in southern New Jersey and southward. Some in late August in Canada. Adults are usually most conspicuous around the time of peak fall color through leaf fall when they are easily seen flying low among trees or thickets around sunset, and may swarm on bait at and just after dusk. Adults also fly later on warm nights. Eggs overwinter and hatch in spring, bimodally in southern New Jersey mostly in early-mid March and early April. Larvae mature in about mid or late May in southern New Jersey, later northward and earlier southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sunira bicolorago

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 67 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATNTTTTATTTTTGGAATTTGAGCAGGAATNGTAGGAACATCACTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCCTTAATATTAGGAGCTCCTGATATAGCATTCCCCCGATTAAATAATATAAGTTTTTGATTACTCCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGGGCAGGAACAGGATGAACAGTATACCCCCCTCTTTCATCTAATATTGCTCACGGTGGAAGATCTGTGGATTTAGCTATTTTTTCTCTACACTTAGCTGGAATTTCTTCCATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCACTATTTATTTGAGCTGTAGGAATTACAGCATTTCTATTATTATTGTCATTGCCTGTTTTAGCTGGAGCTATTACCATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGGGGGGGAGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sunira bicolorago

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 68
Specimens with Barcodes: 102
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This is possibly the most common forest noctuid in most of eastern North America, and it is not really confined to forests. It certainly occurs almost anyplace red maple does, but it it not nearly that restricted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Relatively stable to decline of 50%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Agrochola bicolorago

The Bicolored Sallow or Shield-backed Cutworm (Agrochola bicolorago) is a moth of the Noctuidae family. It is found in the eastern half of the United States (except southern Florida) and Canada.

The wingspan is 28–38 mm. Adults are on wing from August to December in the south and from September to November in the north.

The larvae feed on cabbage, cherry, crabapple, dock, elm, grass, maple, peach, plum, oak, tobacco and willow.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!