Overview
Comprehensive Description
Taxonomic History
Taxonomic history
| Junior synonym of Lasius niger: Wilson, 1955a PDF: 60; Yamauchi, 1979 PDF: 152. |
| Revived from synonymy and raised to species: Seifert, 1992b: 30. |
Source:
AntWeb
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lasius japonicus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACTATTTTTTCTCTTCATATTGCTGGTATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAAAAATTTTTCTATCGATAAAATTCCTTTACTTGTATGATCAATTTTAATTACTGCAATTTTATTACTTTTATCCCTCCCAGTTCTTGCAGGA---GCTATCACTATACTTCTAACTGACCGTAATCTTAATACTTCATTCTTTGACCCATCTGGTGGTGGTGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGACACCCTGAAGTTTATATCTTAATTCTCCCTGGATTTGGACTAATTTCCCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTTCATGGTACA---AAAATCAATAATAATTCTTCCTTATGATGAGCAATGGGATTTATCTTCTTATTCACCATAGGAGGTTTAACAGGAGTAATACTTTCAAATTCATCAATTGATATTATTCTCCATGACACTTATTACGTAGTTGCTCACTTTCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCTAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTCTTCTTAAATATTCAATTTATTTGTATATTCCTTGGAGTCAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Lasius japonicus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
