Overview

Comprehensive Description

Taxonomic History

Lasius hayashi Yamauchi & Hayashida, 1970 PDF: 510, figs. 1, 5, 7, 8, 11 (w.q.m.) JAPAN. AntCat AntWiki

Taxonomic history

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasius hayashi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATTTTTTCTCTTCATATTGCTGGAATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAAAAATTTTTCTATTGATAAAATTCCCTTACTTGTTTGATCAATTTTAATCACTGCAATTTTATTACTATTATCCCTTCCAGTTCTTGCAGGA---GCTATTACTATACTTCTAACTGACCGTAATCTTAATACTTCATTTTTTGACCCATCTGGCGGTGGAGATCCTATTTTATATCAACATCTCTTCTGATTTTTTGGGCACCCTGAAGTTTATATTTTAATTCTCCCTGGATTTGGGCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTGGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCACCATATATTTACTATTGGTTTAGATGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATCATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTCCACGGTACA---AAAATCAATAATAATTCTTCCTTATGATGAGCAATAGGATTTATCTTCTTATTCACCATAGGAGGTTTAACAGGAGTAATACTTTCAAATTCATCAATTGATATTATTCTCCATGACACTTATTACGTAGTAGCTCATTTTCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCCAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTTTTCTTAAATATTCAATTTATTTGTATATTCTTCGGAGTCAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius hayashi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!