Overview

Distribution

Arctic Ocean, Atlantic, Belgian Exclusive Economic Zone, Canada, Canadian part of the Arctic Ocean, Cobscook Bay, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Manicouagan, North East Atlantic, North West Atlantic, Portuguese Exclusive Economic Zone, Réunion Exclusive Economic Zone, Saint Lawrence River, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

northern Gaspe Waters, upstream and downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: Eastern Bradelle Valley), lower St. Lawrence estuary, Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); lower North Shore; Cobscook Bay to Cape Cod
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Ampharete cirrata Webster & Benedict, 1887
Catalog Number: USNM 457
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): H. Webster
Locality: Eastport, Maine, United States, North Atlantic Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 455 specimens in 1 taxon.
Water temperature and chemistry ranges based on 73 samples.

Environmental ranges
  Depth range (m): 0 - 1351
  Temperature range (°C): -1.363 - 23.797
  Nitrate (umol/L): 0.534 - 22.690
  Salinity (PPS): 27.179 - 38.824
  Oxygen (ml/l): 3.837 - 8.702
  Phosphate (umol/l): 0.081 - 2.182
  Silicate (umol/l): 1.193 - 51.234

Graphical representation

Depth range (m): 0 - 1351

Temperature range (°C): -1.363 - 23.797

Nitrate (umol/L): 0.534 - 22.690

Salinity (PPS): 27.179 - 38.824

Oxygen (ml/l): 3.837 - 8.702

Phosphate (umol/l): 0.081 - 2.182

Silicate (umol/l): 1.193 - 51.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ampharete acutifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNAACAATATACTTTATCAGAGGGATTTGAGGGGGGCTTCTTGGTACTATACTTAGTCTAATTATTCGTGTTGAACTTGGGCAACCTGGCTCATTCTTAGGAAGAGACCAGCTCTACAACACTATTGTTACTGCTCATGCGTTTCTGATAATTTTTTTCTTAGTAATACCAGTTTTTATTGGGGGGTTTGGTAATTGATTACTACCGTTGATACTAGGTGCACCTGATATATCTTTTGCTCGGCTGAACAATCTAAGTTTTTGGTTGGTTCCGCCTGCTTTATTCATGCTACTTTGCTCTTTTTTAGTTGAAAAGGGAGCTGGAACTGGGTGGACAGTTTATCCTCCTTTATCGAGAAACATTGCACATTCAGGAGCTTCAGTTGATTTTGCTATTTTTTCTCTCCATTTAGCAGGTATTTCCTCAATTTTAGGATCGATTAACTTTATTACAACTATTATCAACATGCGAGTTGAGGGGTTGCGTTTAGAGCGGATAAGGTTGTTTGTTTGAGCTATTCATGTTACTGTCTACTTGCTTTTAGCATCTCTCCCAGTTTTGGCTGCTGCAATTACGATACTATTAACAGATCGGAATTTTAACACTGCTTTTTTTGACCCATCTGGAGGTGGGGATCCAATTTTGTATGAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ampharete acutifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!