Overview
Distribution
Arctic Ocean, Atlantic, Belgian Exclusive Economic Zone, Canada, Canadian part of the Arctic Ocean, Cobscook Bay, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Manicouagan, North East Atlantic, North West Atlantic, Portuguese Exclusive Economic Zone, Réunion Exclusive Economic Zone, Saint Lawrence River, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Bellan, G. (2001). Polychaeta, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 214-231
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1429
-
Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=3072
-
IMERS
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9162
-
Faulwetter, Sarah (2010). Check-list of marine Polychaeta from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=142069
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Mark, S., Provencher, L., Albert, E. et Nozères, C. 2010. Cadre de suivi écologique de la zone de protection marine Manicouagan (Québec) : bilan des connaissances et identification des composantes écologiques à suivre. Rapp. tech. can. sci. halieut. aquat. 2914 : xi + 121 p
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=150858
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
-
Bigot, L., Conand, C., Amouroux, J.M., Frouin, P., Bruggemann, H., Grémare, A. 2006. Effects of industrial outfalls on tropical macrobenthic sediment communities in Reunion Island (Southwest Indian Ocean). Marine Pollution Bulletin, 52: 865–880.
http://www.marinespecies.org/polychaeta/aphia.php?p=sourcedetails&id=164079
Trusted
northern Gaspe Waters, upstream and downstream part of middle St. Lawrence estuary, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: Eastern Bradelle Valley), lower St. Lawrence estuary, Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); lower North Shore; Cobscook Bay to Cape Cod
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Physical Description
Type Information
Type for Ampharete cirrata Webster & Benedict, 1887
Catalog Number: USNM 457
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): H. Webster
Locality: Eastport, Maine, United States, North Atlantic Ocean
Catalog Number: USNM 457
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): H. Webster
Locality: Eastport, Maine, United States, North Atlantic Ocean
- Type:
Trusted
Ecology
Habitat
bathyal, infralittoral and circalittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Known from rocky shores.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
Trusted
Depth range based on 455 specimens in 1 taxon.
Water temperature and chemistry ranges based on 73 samples.
Environmental ranges
Depth range (m): 0 - 1351
Temperature range (°C): -1.363 - 23.797
Nitrate (umol/L): 0.534 - 22.690
Salinity (PPS): 27.179 - 38.824
Oxygen (ml/l): 3.837 - 8.702
Phosphate (umol/l): 0.081 - 2.182
Silicate (umol/l): 1.193 - 51.234
Graphical representation
Depth range (m): 0 - 1351
Temperature range (°C): -1.363 - 23.797
Nitrate (umol/L): 0.534 - 22.690
Salinity (PPS): 27.179 - 38.824
Oxygen (ml/l): 3.837 - 8.702
Phosphate (umol/l): 0.081 - 2.182
Silicate (umol/l): 1.193 - 51.234
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 73 samples.
Environmental ranges
Depth range (m): 0 - 1351
Temperature range (°C): -1.363 - 23.797
Nitrate (umol/L): 0.534 - 22.690
Salinity (PPS): 27.179 - 38.824
Oxygen (ml/l): 3.837 - 8.702
Phosphate (umol/l): 0.081 - 2.182
Silicate (umol/l): 1.193 - 51.234
Graphical representation
Depth range (m): 0 - 1351
Temperature range (°C): -1.363 - 23.797
Nitrate (umol/L): 0.534 - 22.690
Salinity (PPS): 27.179 - 38.824
Oxygen (ml/l): 3.837 - 8.702
Phosphate (umol/l): 0.081 - 2.182
Silicate (umol/l): 1.193 - 51.234
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Ampharete acutifrons
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
NNAACAATATACTTTATCAGAGGGATTTGAGGGGGGCTTCTTGGTACTATACTTAGTCTAATTATTCGTGTTGAACTTGGGCAACCTGGCTCATTCTTAGGAAGAGACCAGCTCTACAACACTATTGTTACTGCTCATGCGTTTCTGATAATTTTTTTCTTAGTAATACCAGTTTTTATTGGGGGGTTTGGTAATTGATTACTACCGTTGATACTAGGTGCACCTGATATATCTTTTGCTCGGCTGAACAATCTAAGTTTTTGGTTGGTTCCGCCTGCTTTATTCATGCTACTTTGCTCTTTTTTAGTTGAAAAGGGAGCTGGAACTGGGTGGACAGTTTATCCTCCTTTATCGAGAAACATTGCACATTCAGGAGCTTCAGTTGATTTTGCTATTTTTTCTCTCCATTTAGCAGGTATTTCCTCAATTTTAGGATCGATTAACTTTATTACAACTATTATCAACATGCGAGTTGAGGGGTTGCGTTTAGAGCGGATAAGGTTGTTTGTTTGAGCTATTCATGTTACTGTCTACTTGCTTTTAGCATCTCTCCCAGTTTTGGCTGCTGCAATTACGATACTATTAACAGATCGGAATTTTAACACTGCTTTTTTTGACCCATCTGGAGGTGGGGATCCAATTTTGTATGAACATTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Ampharete acutifrons
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
