Overview

Brief Summary

Tropical abalone or Haliotis asinina’s living tropical abalone.Haliotis asinina live on rocky coasts and rocky waters, these places are used as a place to stick. The spread of abalone is very limited. As usual abalone are not found in the estuaries. This is because the fluctuations in salinity with high turbidity levels and low DO concentrations.

Haliotis asinina has a distinctive characteristic, which is shaped like ears with brown colour into reddish. In the center of the shell forming a small circle located in the posterior. In addition, the anterior part, there are seven holes that serves as a place of respiration. Haliotis asinina is a nocturnal animal. By day Haliotis asinina prefers to hide in coral or rocks and in the evening began to move and find food. Haliotis asinina is a herbivore eating macroalgae (seaweeds) and microalgae (Corallina, Gracillaria, Laminaria and Ulva).

Species of abalone Haliotis asinina relatively small size with a shell length of commonly consumed is 6 cm. Size is quite small when compared with other species such as ezoawabi abalone (H. discus hannai) measuring up to 14 cm and (H. gigantea) measuring up to 25 cm. Both are well-known species in Japan and Korea, while in Europe, species of abalone Haliotis tuberculata has a shell length of 123 mm.

Jarayabhan and Paphavasit (1996) in Setyono (2005e); Capinpin et al., (1998) in Setyono (2005e) stated that there was no different body size between males and females in adulthood Haliotis asinina. The rate of progression of mortality in male and female abalone populations are relatively similar. This phenomenon tends uniformly to the other genus Haliotis. Nevertheless, in the waters of Lombok, Indonesia, Setyono (2005e) found that the size of the abalone shell length of males and females look different. Female abalone larger maximum size than males.

The study of the Haliotis asinina has been done in many countries, such as the Philippines (Capinpin et al., 1998 in Setyono, 2005d); Thailand (Jarayabhan and Paphavasit, 1996 in Setyono, 2005d); Australia (Jabreen et al., 2000 in Setyono, 2005d; Counihan et al., 2001) and Indonesia (Setyono, 2006). This is done because of Haliotis asinina is a species of abalone that became the world's attention, especially in the use of consumption, so Haliotis asinina become one of the commodities of high economic sea. In addition to its status as an economic commodity is high, in some areas Haliotis asinina is rarely found. Therefore, to maintain its existence, research and cultivation of Haliotis asinina should continue be done.

  • Riyadi, Slamet. 2008. Reproduction Aspects Of Abalone (Haliotis asinina Lin.) in Seribu Islands, DKI JAKARTA. Thesis, Faculty of Fisheries and Marine Science, Bogor Agricultural University.
  • Setyono, D.E.D 2005e. Size structure and morphometric information of the tropical abalone (Haliotis asinina L) in southern Lombok water.Proceedings of the National Seminar on Sustainable Aquaculture and Biology. page 399-404
  • Setyono, D.E.D. 2004b. Abalone (Haliotis asinina L): 1. A prospective species for aquaculture in Indonesia. Oseana. XXM (2): page 25-30
  • Setyono, D.E.D. 2004d. Broodstock conditioning of the tropical abalone (Haliotis asinina L) in the laboratory. Oseanologi dun Limnology in Indonesia. 36: page 1-14
  • Tahang, M., Imran, and Bangun. , 2006. Maintenance of snail abalone (Haliotis asinina L) with pen-culture method (step cage) and keramba cages. Ministry of Maritime Affairs and Fisheries. Indonesia. 30 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Luthfy Nizarul Fikry

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1 - 6
  Temperature range (°C): 25.491 - 26.803
  Nitrate (umol/L): 0.090 - 0.232
  Salinity (PPS): 34.975 - 35.070
  Oxygen (ml/l): 4.666 - 4.696
  Phosphate (umol/l): 0.131 - 0.172
  Silicate (umol/l): 1.005 - 3.928

Graphical representation

Depth range (m): 1 - 6

Temperature range (°C): 25.491 - 26.803

Nitrate (umol/L): 0.090 - 0.232

Salinity (PPS): 34.975 - 35.070

Oxygen (ml/l): 4.666 - 4.696

Phosphate (umol/l): 0.131 - 0.172

Silicate (umol/l): 1.005 - 3.928
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Haliotis asinina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAGTCGGAACTGCACTAAGCCTTCTAATTCGTGCAGAGCTCGGCCAGCCCGGCGCACTCCTCGGAGAC---GATCAACTCTACAATGTTATTGTAACAGCCCATGCCTTCGTCATAATTTTCTTCTTAGTTATACCTTTAATAATTGGAGGATTCGGAAACTGACTAGTTCCTTTAATACTTGGAGCACCTGACATAGCCTTCCCACGACTAAACAACATGAGATTCTGACTACTCCCCCCATCCCTTACCCTACTTCTAACATCCGGGGCTGTCGAGAGTGGTGCGGGAACAGGATGAACTGTATACCCGCCCCTATCGAGCAACTTAGCCCACGCCGGTGCATCAGTAGATCTCGCTATTTTCTCCCTACACTTAGCCGGAATCTCCTCAATTCTAGGAGCCGTTAATTTTATTACAACAGTAATGAATATACGAGTAAAAGCCCAGCCCCTAGAACGAATACCTCTATTTGTCTGATCCGTAAAAATCACAGCCATTCTTCTTCTACTCTCCCTCCCGGTACTTGCCGGCGCAATTACGATACTACTAACCGACCGTAATTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Haliotis asinina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museums and Art Galleries of the Northern Territory
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ass's ear abalone

A frontal view of a live Haliotis asinina, out of the water.

The ass's-ear abalone (Haliotis asinina) is a fairly large species of sea snail, a tropical gastropod mollusk in the family Haliotidae, the abalones, also known as ormers or paua. Both the common name and the scientific name are based on the shape of the shell, which is long, narrow and curved, resembling the shape of a donkey's ear.

Shell description[edit]

The maximum shell length of this species is up to 12 cm,[2][3] but it more commonly grows up to about 9 cm.[3] The shell of Haliotis asinina has a distinctly elongated contour, in clear resemblance to a donkey ear, hence the common name. Its outer surface is smooth and almost totally covered by the mantle in life, making encrustations of other animals (such as barnacles) quite uncommon in comparison to other abalones.[3] The shell of H. asinina presents 5 to 7 ovate open holes on the left side of the body whorl. These holes collectively make up what is known as the selenizone which form as the shell grows. Its spire is somewhat conspicuous, with a mostly posterior apex. The color may variate between green olive or brown externally, with distinct roughly triangular patches. As is the case in many other abalones, the interior surface of the shell is strongly iridescent, with shades of pink and green.[3]

Distribution[edit]

This is an Indo-West Pacific species. It is common in the Pacific islands, southern Japan and northern Australia.[3]

Ecology[edit]

Habitat[edit]

This abalone dwells in shallow water coral reef areas of the intertidal and sublittoral zones, commonly reaching a depth around 10 m.[2][3] Though this species is quite abundant, aggregates of H. asinina are considered to be uncommon.[3]

Feeding habits[edit]

These large animals are nocturnal. They graze amongst turf algae and inhabit the undersides of boulders and coral bommies.[4]

Life cycle[edit]

Several major transitions in shell pattern and morphology can be observed during the life of Haliotis asinina. The species has a pelagobenthic life cycle that includes a minimal period of three to four days in the plankton. Biomineralisation begins shortly after hatching, with the fabrication of the larval shell (protoconch) over about a 10 hour period. The initial differentiation of biomineralising cells is likely to include a localised thickening of the dorsal ectoderm followed by an invagination of cells to form the shell gland. The shell gland then evaginates to form the shell field which expands through mitotic divisions to direct the precipitation of calcium carbonate (CaCO3) via the secretion of organic molecules. In this way the larval shell (protoconch) is formed. The construction of the haliotid protoconch is complete following torsion. These structures allow the veliger larva to completely retract into a protective environment and rapidly fall out of the water column.:[4]

The next phase of biomineralisation does not commence until the competent veliger larva contacts an environmental cue that induces metamorphosis. The protoconch remains developmentally inert until the animal contacts a specific cue that initiates the process of metamorphosis.[4]

The postlarval shell (teleoconch) is laid down rapidly following metamorphosis with marked variation in the rate of its production between individuals. The transition from protoconch to teleoconch (juvenile/adult shell) is clearly visible at metamorphosis, and suggests the action of a different biomineralising secretome. The early postlarval shell is more robust and opaque than the larval shell but has no pigmentation. While the initial teloconch is not pigmented, it is textured and opaque such that postlarval shell growth is easily discerned from the larval shell.[4]

The juvenile Haliotis asinina teloconch rapidly develops a uniform maroon colouration several weeks after metamorphosis, similar to the crustose coralline algae (CCA) that the larva has settled upon. At about 1 mm in size, further changes in the morphogenetic program of the mantle are reflected in the shell. Structurally, a pronounced series of ridges and valleys and a line of respiratory pores (tremata) have appeared. Furthermore, it is at this stage of development that the first recognisable tablets of nacre can be detected. Colourmetrically, the uniform maroon background is now interrupted by oscillations of a pale cream colour, and is punctuated by a pattern of dots (that only occur on ridges) which are blue when overlying a maroon field and orange when overlying a cream field. This shell pattern may enhance the juvenile's ability to camouflage on the heterogeneous background of the CCA they inhabit at this stage of development.[4]

This pattern is gradually lost with growth, as the shell becomes thicker and more elongate. At 10 to 15 mm, this ornate colouration pattern begins to fade, with maroon and cream fields apparently blending to give a brown background. Blue and orange dots however persist on the ridges.[4]

With further growth, the ridge-valley structure fades to give rise to a smooth adult shell, with irregular brown-green triangles on a light brown background. These large scale morphological changes are accompanied by mineralogical and crystallographic changes. Well defined tablets of nacre are present in shells larger than approximately 5 mm which are absent or poorly resolved in shells 1 mm or less. In larger shells, a ventral cap of CaCO3 that underlies the tablets of aragonitic nacre continues to thicken.[4]

Overall, ontogenetic changes in Haliotis asinina shell pigmentation and structure match changes in the habitats occupied during development.[4]

The growth rate of Haliotis asinina is the fastest of all the abalones.[5] Individuals reach sexual maturity in one year.[5]

Anatomy[edit]

Photo of 5 mm long juvenile with the shell removed.
Drawing shows that mantle (in gray) covers the majority of the dorsal surface of the animal.[6] The gills (g), digestive gland (dg), adductor muscle (am), epipodial tentacles (ept), right mantle lobe (rml), eyespot (es), cephalic tentacles (ct) and left mantle lobe (lml) are indicated.

Human uses[edit]

The flesh of Haliotis asininus is edible, and it is usually collected for food and also for its shell in South East Asian countries.[3]

References[edit]

This article incorporates CC-BY-2.0 text (but not under GFDL) from reference.[4]

  1. ^ Haliotis asinina Linnaeus, 1758.  Retrieved through: World Register of Marine Species on 29 March 2010.
  2. ^ a b Haliotis asinina Donkey's ear abalone. Sealifebase.org accessed 10 July 2009.
  3. ^ a b c d e f g h Poutiers J. M. (1998). Gastropods in:FAO Species Identification Guide for Fishery Purposes: The living marine resources of the Western Central Pacific Volume 1. Seaweeds, corals, bivalves and gastropods. Rome, FAO, 1998. page 385.
  4. ^ a b c d e f g h i Jackson D. J., Wörheide G. & Degnan B. M. (2007). "Dynamic expression of ancient and novel molluscan shell genes during ecological transitions". BMC Evolutionary Biology 7: 160. doi:10.1186/1471-2148-7-160.
  5. ^ a b Lucas T., Macbeth M., Degnan S. M., Knibb W. R. & Degnan B. M. (2006). "Heritability estimates for growth in the tropical abalone Haliotis asinina using microsatellites to assign parentage". Aquaculture 259(1-4): 146-152, abstract.
  6. ^ Jackson D. J., McDougall C., Green K., Simpson F., Wörheide G. & Degnan B. M. (2006). "A rapidly evolving secretome builds and patterns a sea shell". BMC Biology 4: 40. doi:10.1186/1741-7007-4-40.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!