Overview

Comprehensive Description

The White Abalone (Haliotis sorenseni) is a large gastropod mollusk that is distributed off the west coast of North America throughout the Southern California Bight and northern Baja California, a range of 900 km. It is found in rocky subtidal ocean waters, inhabiting rocky reefs or solitary outcrops adjacent to the sand–rock interface at depths of 20 to 60 meters from Point Conception in California (U.S.A.) south to Punta Abreojos, Baja California (Mexico). It grows slowly and has a lifespan on the order of 35 to 40 years. A variety of factors (notably, overfishing in the 1970s and 1980s) have led to dramatic population declines and in 2001 the White Abalone became the first endangered marine invertebrate to be listed under the Endangered Species Act of 1976 (see additional information from the NOAA Fisheries Office of Protected Resources), although at least one study (Butler et al. 2006) has yielded the encouraging finding that more potential White Abalone habitat is available than previously believed. Adult White Abalone, like other abalone species, are dependent upon macroalgae as their main source of nutrition. In addition, drifting macroalgae (such as fragments of the kelp Macrocystis pyrifera) appear to play an important role in facilitating the dispersal of juvenile and young adult White Abalone, apparently moving them far greater distances than could be traversed by the larvae during their 5 day dispersal phase. (McCormick et al. 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (250-20,000 square km (about 100-8000 square miles)) Found in the Pacific Ocean at depths between 80 and 200 feet from Point Conception, California to Punta Eugenia, Baja California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North America (West Coast from Point Conception, CA, U.S.A., to Punta Abreojos, Baja California, Mexico)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Holotype for Haliotis sorenseni Bartsch, 1940
Catalog Number: USNM 535688
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): A. Sorensen
Locality: South Of Point Conception, California, United States, North Pacific Ocean
  • Holotype: Bartsch, P. 1940. Proc. U.S. Natl. Mus. 89(3094): 50.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Found at depths of greater than 26 meters amoungst rocky reefs with understory kelps (Davis et al., 1996). Juveniles hide in rocky crevices. It inhabits deeper water than the other California abalones.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

1 - 1000 individuals

Comments: Current population abundance is estimated at 2,540 individuals throughout the range (Hobday and Tegner in U.S. Fish and Wildlife Service 2000). In October of 1999 a survey near Santa Cruz, Anacapa, Santa Barbara, San Clemente and Santa Catalina Islands, and on Osborn, Farnsworth, Tanner and Cortez Banks found an average density of 0.00027 white abalone per square meter (U.S. Fish and Wildlife Service 2000). Surveys were conducted by Davis et al. (1996) in the vicinity of the Channel Islands in 1980-1981 and 1992-1993. In 1980-81 they found a mean density of 0.0021 per square meter over 10,000 square meters of suitable habitat; in 1992-93 they found a mean density of 0.0002 per square meter over 30,600 square meters of suitable habitat (i.e., 3 adults over 3 ha of suitable habitat). The equivalent search in the 1970's would have revealed an average density of 6,120-30,600 adults (Davis et al. 1996). No population estimates are available before commercial exploitation began in 1965.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

See Davis et al. (1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Haliotis sorenseni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCAGTCTTTTAATTCGGGCCGAACTTGGCCAGCCAGGAGCACTCTTGGGGGAC---GACCAACTCTATAACGTAATTGTAACAGCCCACGCTTTCGTAATAATCTTCTTCCTAGTTATACCACTAATAATTGGAGGATTTGGAAACTGACTGGTCCCTTTAATATTAGGGGCACCAGACATAGCCTTTCCCCGACTAAATAACATAAGATTCTGACTCCTTCCGCCATCCTTAACCTTACTCCTAACATCGGGCGCTGTAGAAAGTGGAGCGGGGACAGGCTGAACAGTCTATCCTCCCCTCTCTAGTAACCTTGCCCACGCAGGAGCATCAGTAGACTTAGCAATTTTCTCCCTACACCTAGCCGGAATCTCATCAATTTTAGGGGCAGTAAACTTTATTACTACAGTAATAAATATACGTGTAAAAGCACAGCCCCTAGAACGAATGCCATTATTTGTTTGATCAGTAAAAATTACCGCCATCCTACTACTCCTATCACTACCTGTTCTAGCAGGTGCCATTACAATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Haliotis sorenseni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Populations collapsed in the 1970's and it is now approaching extinction from natural causes after intense exploitation. Survival will depend on how many refugia exist and the reproductive success of these refugia.

Intrinsic Vulnerability: Unknown

Environmental Specificity: Unknown

Other Considerations: Based on the size distribution of shells found by Davis et al. (1996) they suggest recruitment failure is responsible for the population collapse and that recruitment failure is likely due to low population densities, but disease could also be a contributing factor. In October 1999 the Abalone Restoration Consortium (a group of academic, government, and non-government biologists) used a two person submersible to search for abalones on the ocean floor around the Channel Islands National Park. Hour long trips to search and map findings were scheduled. Searches were video taped. Information gained is to be used for a captive breeding program and to further ellucidate habitat type, presence of abalone and associated animals, and abalone food availability for restoration efforts (USGS 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 11/16/2005
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: North America (West Coast from Point Conception, CA, U.S.A., to Punta Abreojos, Baja California, Mexico)


Population detail:

Population location: North America (West Coast from Point Conception, CA, U.S.A., to Punta Abreojos, Baja California, Mexico)
Listing status: E

For most current information and documents related to the conservation status and management of Haliotis sorenseni , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 50-70%

Comments: Recent analysis by Hobday and Tegner (in U.S. Fish and Wildlife Service, 2000) report an overall decrease in abundance of over 99 percent since the 1960's. Commercial landings data show a peak in 1972 followed by a collapse by 1981. See U.S. Fish and Wildlife Service (2000) and Davis (1996) for further information.

Global Long Term Trend: Decline of >90%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Subjected to intense commercial and recreational exploitation from 1969-1977. Its continued survival is threatened by poor reproductive success due to size and fragmentation of existing populations. This species is also hightly susceptible to withering syndrome, a rickettsial disease of abalone (Friedman et al., 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: The commercial and recreational fishery in California was closed on March 1, 1996. A captive breeding program is in place at Proteus SeaFarms in Oxnard, California, but so far they only have males. It is not known if Mexico has taken any protection measures (U.S. Fish and Wildlife Service 2000). Prior to the listing of white abalone under the ESA, the State of California closed the white abalone fishery in 1996 and subsequently closed all abalone fisheries in central and southern California in 1997. Measures taken during the late 1970s and 1980s to regulate the abalone fishery included prohibiting fishing during a portion of the spawning season, bag limits for recreational fishermen, limited entry, and permit fees. The white abalone was designated as a candidate for listing under the Endangered Species Act (ESA) in 1997 for the California region south to Baja California, Mexico. In August 1998, NMFS initiated a review of the biological status of white abalone. A petition from the Center for Biological Diversity to list the white abalone as endangered and designate critical habitat was received on April 29, 1999, and a subsequent petition from the Marine Conservation Biology Institute was received on May 15, 1999. A finding that the petitioned action was warranted was published in the Federal Register on September 24, 1999. NMFS completed its status review of the species in March of 2000. NMFS published aproposed rule to list the white abalone as endangered on May 5, 2000. NMFS published afinal rule listing the white abalone as an endangered species on May 29, 2001. The white abalone is the only mollusk listed under the ESA by NMFS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Oxytetracycline has been shown to effectively eliminate rickettsial infections and depletion occurred over a prolonged period providing protection to rickettsial challenge in abalone with a mean of over 72 ppm in digestive tissue (Friedman et al., 2007). The White Abalone Restoration Consortium developed a four-step restoration plan: (1) locate surviving white abalone by surveying historical habitat; (2) collect brood stock; (3) breed and rear a new generation of juveniles and ultimately, brood stock; and (4) reestablish refugia of self-sustaining brood stocks in the wild.

The commercial and recreational fishery in California was closed on March 1, 1996. A captive breeding program is in place at Proteus SeaFarms in Oxnard, California, but so far they only have males. It is not known if Mexico has taken any protection measures (U.S. Fish and Wildlife Service 2000). Prior to the listing of white abalone under the ESA, the State of California closed the white abalone fishery in 1996 and subsequently closed all abalone fisheries in central and southern California in 1997. Measures taken during the late 1970s and 1980s to regulate the abalone fishery included prohibiting fishing during a portion of the spawning season, bag limits for recreational fishermen, limited entry, and permit fees. The white abalone was designated as a candidate for listing under the Endangered Species Act (ESA) in 1997 for the California region south to Baja California, Mexico. In August 1998, NMFS initiated a review of the biological status of white abalone. A petition from the Center for Biological Diversity to list the white abalone as endangered and designate critical habitat was received on April 29, 1999, and a subsequent petition from the Marine Conservation Biology Institute was received on May 15, 1999. A finding that the petitioned action was warranted was published in the Federal Register on September 24, 1999. NMFS completed its status review of the species in March of 2000. NMFS published aproposed rule to list the white abalone as endangered on May 5, 2000. NMFS published afinal rule listing the white abalone as an endangered species on May 29, 2001. The white abalone is the only mollusk listed under the ESA by NMFS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White abalone

The white abalone, scientific name Haliotis sorenseni, is a species of large sea snail, a marine gastropod mollusk in the family Haliotidae, the abalones.

The white abalone is an endangered species in the United States; it may now have the smallest population of all eight of the abalone species on the west coast of North America.

Contents

Distribution

A map of the distribution of the White abalone, Haliotis sorenseni

Historically the white abalone ranged from Point Conception, California to Baja California, Mexico, and was found especially on the offshore islands.[1]

In the most northerly part of the California range, white abalone were reported as being more common along the mainland coast. However, in the middle portion of the California range, they were noted to occur more frequently at the offshore islands, especially San Clemente and Santa Catalina Islands. At the more southerly end of the range, in Baja California, Mexico, white abalone were reported to occur more commonly along the mainland coast, but were also found at a number of islands including Isla Cedros and Isla Natividad.[1]

It remains unknown whether this distribution pattern was a result of lack of suitable habitat along the mainland coast in the mid portion of the range, or was instead due to overfishing in these more accessible mainland regions.[1]

Since the mid-1990s, extremely low numbers of isolated survivors have been identified along the mainland coast in Santa Barbara County and at some of the offshore islands and banks in the middle portion of the range, indicating the current range of white abalone in California may be similar to what it was historically.[1]

No recent information on current range is available for Baja California. The white abalone population in Mexico is thought to be depleted based on commercial fishery data, but the status of the species in Mexico remains largely unknown.[1]

Description

Two White Abalones. Left: dorsal view; Right: ventral view, showing the large muscular foot

Shell

The white abalone usually has between 3-5 open holes (respiratory pores) in its shell. These holes collectively make up what is known as the selenizone which form as the shell grows. The shell is oval-shaped, very thin and deep. White abalone can grow to about 10 inches long (25 cm), but are usually 5-8 inches (13–20 cm).[1]

Anatomy

The shell tentacles are lacy, beige and yellow-green in color. The bottom of its foot is orange, and the epipodium (a sensory structure and extension of the foot that bears tentacles) is a mottled orange tan.[1]

Ecology

Habitat

The white abalone is the deepest dwelling of eight species of California abalones, living at depths from 80 to 200 feet.[1] White abalone are found in open low and high relief rock or boulder habitat that is interspersed with sand channels. Sand channels may be important for the movement and concentration of drift macroalgae, and a variety of red algae, upon which white abalone are known to feed.[1]

Feeding habits

The white abalone is known to be a herbivore, grazing mainly on macroalgae, such as Laminaria farlowii and Agarum fimbriatum, and also several species of red algae.[1]

Life cycle

Like many gastropods, white abalone have a complex life cycle involving larval stages. Fertilized eggs hatch into larvae; these larvae eventually metamorphose into the adult form and settle from the plankton to a hard substrate.[1] As broadcast spawning gastropods, white abalone reproduce by releasing their eggs and sperm into the surrounding water. If fertilized, the eggs hatch after only one day, but high concentrations of sperm are required in order for an egg to be fertilized. Therefore, aggregations of adult male and female abalone are necessary for successful fertilization to occur.[1]

California Commercial White Abalone Haliotis sorenseni Landings for 1972–1992. The price exponentially increased as catch decreased.[2] Even taking fishing effort into account, the volume of abalones fished is inversely proportional to the price (power regression model, F40,2 = 139.96; p < 0.0001).[2]
open squares - commercial catch per unit effort
left y axis - thousands of pounds of shell per vessel
filled circles - price of Haliotis sorenseni
right y axis - US$ per pound.

Human use

The white abalone is said to have one of the most tender and flavorful meats of all the abalone species. It was not discovered until 1940. Scripps Institution of Oceanography biologists conducted surveys of white abalone deep water habitat in the early 1970s, finding high concentrations of about one white abalone per square yard. Such densities were comparable to abundance of shallower species of abalone found in previously unfished or protected areas. Unfortunately, the high demand for the species led to a "boom-and-bust" fishery, which decimated the populations of this species in seven years.

Considered a delicacy in California, white abalones, the rarest of the six abalone species, have declined by over 99.99% due to increasing overfishing, in part illegal – the fishery was closed in 1996 – while at the same time, prices have escalated. Although white abalones were the first marine invertebrate on the United States Federal List of Endangered Species in 2001, the species could nevertheless become extinct within a decade unless extraordinary recovery measures are implemented.[2] Currently, white abalone is being maricultured in order to produce young that can be placed back in the ocean, in hopes of bringing this species back to secure population levels before it becomes extinct.

References

Sources
Notes
  1. ^ a b c d e f g h i j k l m "NOAA Fisheries - White Abalone (Haliotis sorenseni)". National Oceanic and Atmospheric Administration (USA). Retrieved 2009-10-21. 
  2. ^ a b c d Courchamp F., Angulo E., Rivalan P., Hall R. J., Signoret L., Bull L. & Meinard Y. (2006) "Rarity Value and Species Extinction: The Anthropogenic Allee Effect". PLoS Biology 4(12): e415. doi:10.1371/journal.pbio.0040415
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!