Overview

Brief Summary

Biology

This ant often builds its nest in soil, in tree stumps or under stones or logs, and it frequently nests beneath paving stones in gardens (4). It may occasionally invade the nests of other species of ants (1). Colonies number around 5, 500 individuals (1). A wide range of food is eaten, including seeds, flower nectar, flies and other small insects, which are killed and taken back to the nest. Small black ants also 'milk' aphids, collecting drops of sweet honeydew exuded by the aphids. Aphids may even be taken into the nest (2). Winged reproductive males and females engage in a mass mating flight in hot, humid weather during July and August (2). Males die after mating, and females establish new colonies. A queen mates only once, storing sufficient sperm inside her body to last her lifetime. The mating flight ensures that the species disperses well, and also increases the chance that males and females from different nests will mate, avoiding inbreeding, as the winged reproductive adults of different colonies in one area fly at the same time (3). After finding a suitable location, the queen begins to produce eggs. The resulting 'workers' are non-reproductive females, who take over the care of the colony. After hatching, the larvae initially feed on unhatched eggs; they are then fed by the workers on a regurgitated fluid (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This is the commonest ant seen in Britain. Workers (non-reproductive females) are blackish-brown in colour and covered in small hairs (2). Winged reproductive females (queens) are almost twice as big as the workers (3), are darker in colour and have a large pair of clear wings, which are shed after mating (2). Males also possess wings and are much smaller than queens (2). The larvae are legless grubs, and the pupae are protected inside a white silk cocoon (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Taxonomic History

1 subspecies

Formica nigra Linnaeus, 1758 PDF: 580 (w.) EUROPE. AntCat AntWiki

Taxonomic history

Combination in Lasius: Fabricius, 1804: 415; in Donisthorpea: Donisthorpe, 1915f: 200; in Formicina (Donisthorpea): Emery, 1916a PDF: 240; in Acanthomyops: Forel, 1916 PDF: 460; in Lasius: Menozzi, 1921 PDF: 32; Müller, 1923b PDF: 124; Kuznetsov-Ugamsky, 1929a PDF: 26; Wilson, 1955a PDF: 59.
Senior synonym of Lasius pallescens: Mayr, 1861 PDF: 49; of Lasius nigerrima: Emery, 1892c PDF: 162; of Lasius alienoniger, Lasius emeryi, Lasius nitidus, Lasius minimus, Lasius transylvanica and material of the unavailable name Lasius pilicornis referred here: Wilson, 1955a PDF: 59; of Lasius alienoniger: Kutter, 1977c: 14.
Current subspecies: nominal plus Lasius niger pinetorum.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Various open habitats, common in urban areas
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Throughout SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The small black ant is found throughout Europe, and also occurs in Japan and North Africa. In the UK, this species has a broad distribution, but is absent from certain areas of Scotland (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1886:
 [[ worker ]] et [[ queen ]] recoltes a Hakodate, Japon, par M. Hilgendorf (Musee de Berlin). Ces exemplaires sont absolument identiques a ceux d'Europe. — Comme cette espece si commune est deja connue comme habitant toute l'Europe, le Turkestan, le nord de l'Afrique, Madere et les Etats-Unis, on peut bien admettre maintenant qu'elle habite tout l'hemisphere nord jusqu'a environ 30 degres de latitude au sud.
 

Forel, A., 1890:
 Tébessa (jardins).
 

Smith, F.:
  Syst. Piez. 415,1. Formica minor, Ray , Hist. Ins. 69.
  Swamm. Bill. Nat. t. 16, f. 1 - 11. The small black Ant, Gould, Eng. Ants, ii. 5. La Fourmi toute noire, Geoff. Ins. Par. ii. 429, 6. Hab. - Britain, Banks.
 

Emery, C., 1893:
 — Canaria, Tenerife (M. Noualhier). Forme typique a scapes et tibias tres poilus.
 Ces deux especes sont tres communes en Europe; la deuxieme a ete trouvee aussi dans le nord de l'Afrique, ou elle a ete probablement importee d'Europe.
 

Ward, P. S., 2005:
 

Forel, A., 1904:
 Chine occidentale (Sze-tschwan, fl. Pasyn-kou, pres de Tschzumse, 2 [[ queen ]], 19. VII; vallee de Maon-jukou, 1 [[ queen ]], 20. VII. 1893. Potanin!); Ussuri merid. (Sidemi, 4 [[ worker ]], 20 - 30. VII. 1897. Jankovsku!); Region transcaspienne (As'- chabad, 1 [[ queen ]], 1896. Ahkger!); Transcaucasie (Borzom, Likani, attires par la lumiere electr., 3 [[ queen ]], 8 [[ male ]], 12. VII. 1901. R. Schmidt!; Gouv. Kutais, Artvin, 2 [[ worker ]], 23. VI. 1898. Derjugin!).
 

Forel, A., 1894:
 Pas de longs poils epais, couches, jaunes sur l'abdomen.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lasius niger var. alienoniger Forel, 1874: Forel 1892 , Atanassov 1936 , 1952 (see Notes below)

 

Records

 

(Map 55): Bulgaria ( Agosti and Collingwood 1987a , Atanassov and Dlusskij 1992 , Seifert 1992 ); Western Predbalkan: Krapets vill. [ Atanassov 1936 (as Lasius alieno niger )]; Central Predbalkan: Dermantsi vill. (Lukovit) [ Atanassov 1934 , 1936 (as Lasius alieno niger )]; Western Stara Planina Mts: Chepan (Dragoman) ( Borisova et al. 2005 ); Eastern Stara Planina Mts: Sliven ( Forel 1892 ); Zemen Gorge: Skakavitsa waterfall ( Atanassov 1936 ); Vitosha Mt. [ Atanassov 1952 (as Lasius niger L. var. alieno-niger Forel), Hlaváč et al. 2007 ]; Sofia Basin: Sofia [ Atanassov 1936 (as Lasius alieno niger ), Antonova 2004 , 2005 , Lapeva-Gjonova 2004b , Lapeva-Gjonova and Atanasova 2004 , Antonova and Penev 2006 , 2008 , Hlaváč et al. 2007 ], the surroundings of Sofia near Vladaya vill. ( Antonova and Penev 2006 , 2008 ); Plana Mt.: Pasarel vill. ( Vagalinski and Lapeva-Gjonova in press ); Podbalkan Basins: Rose valley ( Atanassov et al. 1955 ); Lozenska Planina Mt. ( Vassilev and Evtimov 1973 ): near German monastery ( Antonova and Penev 2008 ); Belasitsa Mt. ( Atanassov 1964 ); Krupnik-Sandanski-Petrich Valley: around Mitino vill., Petrich plain ( Atanassov 1964 ); Rila Mt.: the valley of Rilska river [ Forel 1892 (as Lasius niger Rasse alienus var. alieno-niger)]; Western Rhodopi Mts: Asenovgrad [ Forel 1892 (as Lasius niger Rasse alienus var. alieno-niger)], Devin, Peshtera, Batak ( Lapeva-Gjonova in press (a) ); Southern Black Sea coast: Burgas, Sozopol [ Forel 1892 (as Lasius niger Rasse alienus var. alieno-niger)], Veselie vill. ( Forel 1892 ).

 

Notes:

 

Some of the above mentioned records most probably include also closely related Lasius platythorax . Lasius niger alienoniger Forel, 1874 has been considered by different authors to be a separate species or a junior synonym of Lasius niger , but Seifert (1992) proposed it should be considered as incertae sedis in Lasius (for details see Bolton 1995 , Bolton et al. 2006 ).

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

— Canaria, Tenerife (M. Noualhier). Forme typique a scapes et tibias tres poilus.

 

Ces deux especes sont tres communes en Europe; la deuxieme a ete trouvee aussi dans le nord de l'Afrique, ou elle a ete probablement importee d'Europe.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ worker ]] et [[ queen ]] recoltes a Hakodate, Japon, par M. Hilgendorf (Musee de Berlin). Ces exemplaires sont absolument identiques a ceux d'Europe. — Comme cette espece si commune est deja connue comme habitant toute l'Europe, le Turkestan, le nord de l'Afrique, Madere et les Etats-Unis, on peut bien admettre maintenant qu'elle habite tout l'hemisphere nord jusqu'a environ 30 degres de latitude au sud.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tébessa (jardins).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Himalaya (Smythies); 6,000 ' a 9,000 '.

 

[[ worker ]]: - L.: 3 a 3, 5 mill. Sillon frontal distinct. Stature de le L. alienus . D'un brun jaunatre pale, y compris l'abdomen; pattes et antennes d'un jaune a peine brunatre. Dans son catalogue, Dalla Torre identifie cette variete au L. lasioides Emery . Je ne puis guere admettre cette synonymie, car le type du L. lasioides que je possede a un sillon frontal bien moins distinct, une couleur plus foncee et une pilosite plus forte.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Himalaya (Smythies); 6,000 ' a 9,000 '.

 

[[ worker ]]: - L: 3, 6 a 4, 2 mill. Sillon frontal tres distinct. Beaucoup plus large et plus robuste que lu precedent. Plus robuste et plus grand que la forme typique d'Europe. Pubescence un peu plus grossiere, comme chez le L. alienus . D'un brun assez fonce, avec les joues, les mandibules, les scapes, la base des funicules, les tarses, une partie du dessous de la tete et les articulations des pattes d'un jaunatre sale plus ou moins rougeatre on brunatre (chez le L. brunneus , i. st., la couleur est d'un rouge brunatre avec l'abdomen brun).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pas de longs poils epais, couches, jaunes sur l'abdomen.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

[[ worker ]]. L. 3 a 3,5 mill. Pilosite dressee du corps, des pattes et des scapes, ainsi que la grandeur des yeux identiques au niger typique. Mais la sculpture est plus faible, surtout sur la tete, qui est luisante, ponctuee, l'epistome meme tres luisant, plus luisant encore que chez le flavus . Les mandibules sont aussi luisantes et tres faiblement sculptees. La couleur varie d'un jaune brunatre aussi clair que chez les exemplaires fonces du Lasius flavus d'Europe a un brun plus clair que celui des exemplaires les plus clairs des Lasius niger et alienus , a peu pres comme chez les formes bruneo-emarginatus et brunneus , mais uniforme (le thorax n'etant pas plus clair que l'abdomen et la tete), et plus luisant

 

Du reste identique au L. niger . Les variations de couleur de cette forme rappellent celles de l´alieno-flavus Bingham, do l'Inde septentrionale, mais la pilosite, les yeux plus grands et la taille plus grande l'en distinguent.

 

Buchara oriental (Schugnan, fl. Gunt, Sardym, 10 [[ worker ]], 16. VIII; Kara-gurum-Mazar, 3 [[ worker ]], 24. VII; Roschan, Col de Mardzanai, 4 [[ worker ]], 19. VIII. 1897. Kaznakov!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Transcaucasie (Borzom, Likani, attires par la lumiere electr., l [[ male ]], 1 [[ queen ]], 12. VII; Gouv. Elisabethpol, Geok-tapa, 14 [[ worker ]], 26. VII. 1901. R. Schmidt!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Transcaucasie orient. (Gouv. Baku, gorge de Bum, 1 [[ worker ]], 1892. Schelkovnikov!); Region transcaspienne (As'chabad, 1 [[ queen ]], 1896. Ahnger!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chine occidentale (Sze-tschwan, fl. Pasyn-kou, pres de Tschzumse, 2 [[ queen ]], 19. VII; vallee de Maon-jukou, 1 [[ queen ]], 20. VII. 1893. Potanin!); Ussuri merid. (Sidemi, 4 [[ worker ]], 20 - 30. VII. 1897. Jankovsku!); Region transcaspienne (As'- chabad, 1 [[ queen ]], 1896. Ahkger!); Transcaucasie (Borzom, Likani, attires par la lumiere electr., 3 [[ queen ]], 8 [[ male ]], 12. VII. 1901. R. Schmidt!; Gouv. Kutais, Artvin, 2 [[ worker ]], 23. VI. 1898. Derjugin!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

- [[ worker ]].

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syst. Piez. 415,1. Formica minor, Ray , Hist. Ins. 69.

 

Swamm. Bill. Nat. t. 16, f. 1 - 11. The small black Ant, Gould, Eng. Ants, ii. 5. La Fourmi toute noire, Geoff. Ins. Par. ii. 429, 6. Hab. - Britain, Banks.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Although found in a wide range of habitats, this ant is perhaps most familiar as a garden species (4). It also occurs in scrubland and wet areas. It can only survive in grasslands providing that there are either stones or mounds of the yellow meadow ant (Lasius flavus) present (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / guest
larva of Clytra laeviuscula is a guest in nest of Lasius niger s.s.

In Great Britain and/or Ireland:
Animal / predator
Lasius niger s.s. is predator of larva (early instart) of Chrysolina graminis
Remarks: Other: uncertain

Animal / honeydew feeder
Lasius niger s.s. feeds on honeydew Aphis ochropus

Animal / honeydew feeder
Lasius niger s.s. feeds on honeydew Aphis gentianae

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Animal / guest
nymph of Alydus calcaratus is a guest in nest of Lasius niger s.l.

Animal / sequestrates
queen (newly mated) of Lasius mixtus takes over nest of Lasius niger s.l.

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius niger s.l.

Animal / predator
larva of Microdon analis is predator of pupa of Lasius niger s.l.

Animal / predator
larva of Microdon mutabilis is predator of pupa of Lasius niger s.l.

In Great Britain and/or Ireland:
Animal / inquiline
Platyarthrus hoffmannseggi is inquiline in nest of Lasius niger s.l.
Other: major host/prey

Animal / associate
adult of Systellonotus triguttatus is associated with Lasius niger s.l.
Remarks: season: late 5-mid 8

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28 years Observations: Like in other species of ants, there are major differences in longevity between queens and workers. Workers normally live up to 1-2 years while queens have can live up to 28 years (Parker et al. 2004).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasius niger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATTTTTTCTCTTCATATTGCTGGAATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAAAAATTTTTCTATCGATAAAATTCCCTTACTTGTATGATCAATTTTAATCACTGCAATTTTATTACTTTTATCCCTCCCAGTTCTTGCAGGA---GCTATCACTATACTTCTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCTGGTGGTGGTGATCCTATTTTATACCAACATCTCTTCTGATTTTTTGGCCACCCTGAAGTTTATATCTTAATTCTCCCTGGATTTGGGCTAATTTCCCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCATCATATATTTACTATTGGTTTAGACGTTGATACTCGAGCATATTTCACCTCTGCAACTATAATTATTGCTATTCCAACTGGAATCAAAATTTTTAGATGAATTACT---ACTCTTCATGGTACA---AAAATCAATAATAATTCTTCCTTATGATGAGCAATAGGATTTATCTTCTTATTCACCATAGGAGGTTTAACAGGAGTGATACTTTCAAATTCATCAATTGATATTATTCTCCATGACACTTATTACGTAGTTGCTCACTTTCATTACGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCTAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTCTTCTTAAATATTCAATTTATTTGTATATTCCTTGGAGTCAATTTAACATTTTTTCCTCAACATTTTTTAGGTTTAAGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lasius niger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Widespread and very common (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This ant is not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black garden ant

Black garden ant with a spider's chelicerae

The black garden ant (Lasius niger) is a formicine ant, the type species of the subgenus Lasius, found all over Europe and in some parts of North America and Asia. The European species was split into two species; L. niger is found in open areas, while L. platythorax is found in forest habitats.[1] It is monogynous, meaning colonies have a single queen.

AttributeDescription
CasteMonogyn
Queen phenotype7–9 mm long, colour black
Worker phenotype3–5 mm long, colour dark brown almost black
Soldier phenotypeN/A
Nest buildingNests underground, commonly under stones, but also in rotten wood
NutritionNectar, small insects, seeds, will farm aphids

Lasius niger colonies can reach in size up to around 15,000 workers but 4,000–7,000 is around average. A Lasius niger queen can live for around 12 years.

Lasius niger is host to a number of temporary social parasites of the Lasius mixtus group including Lasius mixtus and Lasius umbratus.

Contents

Appearance

  • Workers - Lasius niger worker will be dark glossy black and will be around 3-5mm long, as the colony gets older it has been known for workers to increase in size over generations.
  • Queen - The queen will also be a glossy black colour but will appear to have slight brown stripes on her abdomen. The queen can reach 6-9mm in length and will be smaller as a new queen. When a queen is fertilised she removes her wings and digests her wing muscles as food over the winter.
  • Drones - Drones are only produced by queens when the nuptial flights are approaching. They appear with a dark glossy body with a different shape to the workers, almost resembling a wasp appearance they have wing muscles which stand out to the rest of the body. They are 5-7mm long and have delicate wings.

Life cycle

Mating flights

Ants mate on the wing, so "flying ants" are males and immature queens. Mating / nuptial flights of Lasius niger usually occur around June to September throughout the species' range; in North America flights usually occur during the autumn, whereas in Europe they generally take place during the hot summer months of July and August. Flights can contain thousands of winged males and females.[2]

Disparities between local weather conditions can cause nuptial flights to be out of phase amongst widespread populations of L. niger. During long-lasting, hot summers, flights can take place simultaneously across the country, but overcast weather with local patches of sunshine results in a far less synchronised emergence of alates (winged individuals).

Once the queens have mated they will land and discard their wings and begin to find a suitable place to dig a tunnel. Meanwhile the males generally only live for a day or two after the mating flights and will then die.

New nest

Once the tunnel has been completed, a queen will block the entrance and retreat to the bottom. Subsequently, the queen will begin to dig out a small chamber; this will serve as the founding chamber of the new colony. Generally, a queen will begin to lay eggs immediately after the construction of the chamber; the eggs will hatch after 8–10 weeks. Until the eggs hatch and grow to maturity, a Lasius niger queen will not eat, relying on the protein of her wing muscles to be broken down and digested. In some cases, a Lasius niger queen may eat her own eggs in order to survive.

Egg to ant

Lasius niger have 4 stages of development egg, larva, cocoon and adult. Lasius niger lay tiny, white kidney shaped eggs with a smooth sticky surface which helps them to be carried in a group instead of one by one. After hatching Lasius niger proceed onto the larva stage resembling tiny maggots. The larva need to be fed by the queen (or workers in the case of an established colony) if they are to mature, as they feed the larva grow shedding their skin, doing so usually three times in total. With each molt the larva grow hooked hairs which allows them to be carried in groups. When Lasius niger larva reach the last molt they are generally too big to be carried as part of a group and so are carried singularly. Once the larva grows big enough it spins a cocoon around itself. To aid this process a queen (or workers) may bury the larva so that it can spin its cocoon undisturbed, and begins a process of metamorphosis. Once the process is complete the Lasius niger worker emerges from the cocoon, at this stage Lasius niger is completely white but will darken over the course of an hour until it has turned black.

Colony established

The first worker ants that emerge are very small compared to later generations. At this point the workers immediately begin to expand the nest and care for the queen and brood, they eventually remove the seal from the entrance to the nest and begin to forage above ground. This is a crucial time for the colony as they need to gather food quickly to support future growth and particularly to feed the starved queen, who would have lost around 50% of her body weight. From this point on the queen's egg laying output will increase significantly, becoming the queen's sole function. The later generations of worker ants will be bigger, stronger and more aggressive, reason being dependent on the amount of nutrition Lasius niger receives at the larva stage. The initial brood being fed only by the scarce resources available to a queen will be much smaller than brood supported by a team of foraging and nursing workers. Provided workers are able to find food at this stage the colony will see an exponential rise in population. After several years once the colony is well established the queen will lay eggs that will become queens and males. Black ants often make large nests with extensive tunnel connections.

As a pest

In the garden

This type of ant is a problem for some gardeners. They will farm aphids for the honeydew they excrete by bringing them inside the nest and bringing them back out again when necessary. The ants will also eat ripe fruits, especially fruits like strawberries that lack a thick protective skin. Often they can be found on discarded chewing gum. Lasius niger also feed on insects and spiders, and other small invertebrates. In Ireland they are usually referred to as pismires, an archaic term for an ant.

In the home

Black garden ants often explore their surroundings quite extensively during early summer months in an effort to increase the food supply to their queen and her young, and also as a way of testing new ground in preparation for the nests' summer flight. In some cases, these explorations lead to a burrowing through mortar and brick.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!