Overview

Brief Summary

Brief Summary

The parasitic nematode worms known as human pinworms (Enterobius vermicularis, formerly known as Oxyuris vermicularis) infect humans worldwide, although pinworm infection (enterobiasis) seems to be more common in temperate than in tropical countries. Another putative species, Enterobius gregorii, has been reported from Europe, Africa, and Asia, but it appears that this is not actually a distinct species in which case this name would be just a junior synonym of E. vermicularis (Hasegawa et al. 1998; Nakano et al. 2006). Children and individuals living in crowded conditions are more commonly infected. In the United States, this is the most common helminth ("worm") infection of humans, with an estimated 40 million infected people. (Centers for Disease Control Parasites and Health Website)

Human pinworm eggs are deposited on the human host's perianal folds. Self-infection occurs by transferring infective eggs to the mouth with hands that have scratched the perianal area. Person-to-person transmission can also occur through handling of contaminated clothes or bed linens. Enterobiasis (pinworm infection) may also be acquired from surfaces in the environment that are contaminated with pinworm eggs (e.g., curtains, carpeting). A small number of eggs may become airborne and inhaled. These would be swallowed and follow the same development as ingested eggs. Following ingestion of infective eggs, the larvae hatch in the small intestine and the adults establish themselves in the colon (large intestine). The time interval from ingestion of infective eggs to oviposition by the adult females is about one month. The life span of the adults is about two months. Gravid females migrate nocturnally outside the anus and oviposit while crawling on the skin of the perianal area. The larvae contained inside the eggs develop and the eggs become infective in 4 to 6 hours under optimal conditions. Retroinfection, or the migration of newly hatched larvae from the anal skin back into the rectum, may occur but the frequency with which this happens is unknown. (Centers for Disease Control Parasites and Health Website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Enterobius vermicularis is found worldwide, having infected humans since as far back as we can trace. It is not confined to any one biome.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian ; antarctica ; oceanic islands

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As a nematode, Enterobius vermicularis has a cylindrical body, and a cuticle with three main outer layers made of collagen and other compounds, secreted by the epidermis. The cuticle layer protects the nematode so it can invade digestive tracts of animals. The worms molt four times, the first two before hatching, and then before their adult stage.

Males are 2-5 mm long by 0.1-0.2 mm wide and have a curled tail, where females are 8-13 mm long by 0.3-0.5 mm wide with a pointed tail. This pointed, or "pin" shaped tail is how E. vermicularis received its common name: pin worms. Females are also distinguished by their alae, or wing-like, anterior expansions of the body wall. Both sexes have three lips surrounding the circular mouth.

Eggs are elongate and characteristically flattened on one side, measuring 50-60 µm by 20-30 µm. The eggs have five membranes: one inner, lipoidal layer, three middle layers known as membrana lucida, and one outer, albuminous membrane which coats the egg. This membrane makes the eggs sticky and therefore itchy to the host, which is important in the life cycle. The larvae differ from adults only in that they are smaller and coiled.

As a member of the Secernentea, Enterobius vermicularis has a specialized tubular excretory system system with three canals. The canals are arranged to form an "H".

Range length: 13 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Enterobius vermicularis are at home in every biome that is home to humans, around the world. They develop and reproduce in the intestines of humans. Eggs are expelled outside the human body to find a new host.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adult E. vermicularis live in the lumen of the transverse and descending colon. Humans are its only host. They feed on blood and tissue cells in the host's intestine. Food boluses move from the worm's mouth to its intestine through the esophagus, which consists of three esophageal regions. These regions create a type of peristalis, forcing the bolus downward. Extracellular digestion begins within the intestine, and the digestive cycle is completed intracellularly. Enterobius vermicularis, like all nematodes, feed more than is necessary and wastes much of what is brought in.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Humans are this parasites only host.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

These parasites are usually not preyed on directly, but are ingested from host to host. Larval mortality is high as most of the parasites do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Nematodes within the Secernentea have phasmids, which are unicellular glands. Phasmids likely function as chemoreceptors. Females may produce pheromones to attract males.

Nematodes in general have papillae, setae and amphids, which are the main sense organs. Setae detect motion (mechanoreceptors), while amphids detect chemicals (chemoreceptors).

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Humans become infected when ingesting the worm's eggs. The eggs travel down to the host's intestines, molting twice. The juveniles remain in the egg until they've developed to their third stage. The eggs hatch and the worms migrate to the large intestine. Most all adult structures except certain reproductive parts are found in the young just after hatching. The worms molt before becoming become adults. As adults, the worms will not molt, but can grow in size. When reaching the right host, it takes one month for eggs to develop into females and begin egg production.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
2 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females may produce a pheromone to attract males. The male coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold the females during copulation. Nematode sperm are amoeboid-like and lack flagella.

Copulation occurs between adults in the large intestine, and each female produces about 10,000 eggs. The female migrates to the perianal skin at night, spurred by the drop in body temperature of the host. She will only oviposit on the perianum, because air seems to be an ovipositing stimulant. The expulsion of eggs is so forceful that the eggs are sent airborne, and can be spread out over the perianum. After ovipositing, the female often dies, but occasionally returns (or attempts to return) to the intestine. The male dies soon after fertilization of the female. The life cycle of E. vermicularis is about two months long.

Enterobius vermicularis is common among children because thumb-sucking is common at this age. Transmission is usually: a child somehow ingests eggs (probably from sheets or clothes of another child); juveniles hatch in small intestine; adults migrate into large intestine; females migrate to perianal area and oviposit; child scratches perianal area (to relieve itching caused by female migration and sticky eggs) and eggs imbed under child's fingernails; child sucks thumb and ingests more eggs. Infection is possible by inhalation of airborne eggs, but it is rare.

Average number of offspring: 10,000.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Parental Investment: pre-fertilization (Provisioning)

  • Donowitz, L. 1999. Infection Control in the Child Care Center and Preschool. Philadelphia: Lippincott, Williams & Wilkins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Enterobius vermicularis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBNM686-09|NC_011300|Enterobius vermicularis| GTTTCTTGATTGGAGAGAACAAGACATAAAGATATTGGAGTAATATATTTTTTAGTTGGAGTTTGGTCAGGTTTGGTGGGAAGGGGGTTA---TCTTTTTTAATTCGTTTGGAGTTAGGTAAACCGGGGGTTTTTTGAGGTGAGTCTGGACAGTTATATAATGTTGTTTTAACTATACATGCTATAATAATGATTTTTTTTATGGTTATACCTATTTTAATGGGTGGTTTTGGTAATTTTATAGTTCCTATGATG---TTGAAGTCACCTGATATGAGTTTTCCTCGTTTGAATAATTTAAGGCTTTGATTGTTGGTTTCTTCTTTATTTTTGATAATGGTTAGGATGTTTGTTGATAGTGGGTCTGGTACAAGTTGGACTTTGTATCCTACTTTGAGG---ACGATTGGGCATACTGGTGGGGCTGTAGATTTAGTTTGT---TTTGGGTTACATGTGGCTGGGGTGAGTTCAATTTTGGCTTCTATTAATTTTGTTGTGACTATTTTTAATTTACGTTCTAGATGTGAGAATTTGGAGTATATGGGTTTATTTGTTTGGTGTATTGGTGTAACTTCTTTTTTATTGTTGGTTTCTTTACCTGTGTTGGCTGGG---GCTTTAACTATAATTATTTTTGATCGTAATTTTAATACTTCTTTTTTTAATCCTAGAGGTGGGGGTAGTGTTATTATATATCAACATTTGTTTTGATTTTTTGGTCATCCTGAGGTTTATATTCTTATTTTGCCTGCTTTCGGGATTGTCAGCCATAGAATTTTGTGTTTAACTGGTAAAAAG---GAGGTGTTTGGTCATTTGGGTATAATTTATGCTATTATTTCTATTGGTTTAATTGGTAGTGTGGTATGGGGCCATCATATGTTTACTATTGGTTTTG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Enterobius vermicularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Thirty-three percent of American children are infected with E. vermicularis and it may be one of the most common human parasitic infections in the world. Classic symptoms are perianal and vaginal itching caused by the migration of the female and the stickiness of her eggs. Scarring occasionally occurs and most individuals remain asymptomatic. Severe cases of heavy infestation have been known to cause sleeplessness, weight loss, hyperactivity, grinding of teeth, abdominal pain, and vomiting. E. vermicularis are not vectors of any know pathogens.

Occasionally, after a female oviposits on the perianal skin, she will migrate into a female host's vagina, instead of back into the anus. This produces irritative symptoms such as vulvovaginitis. In heavily infected females, migration into the vagina may cause a mucoid vaginal discharge. Enterobius vermicularis infestation of the uterus can cause bleeding from the vagina, which may be mistaken for menstruation. This infestation has caused postmenopausal women to believe they've began to menstruate again and prepubescent girls to believe they've begun to menstruate.

Enterobius vermicularis infestation is not necessarily one of poor hygiene -- most every human will have at least one infection in their lifetime. Total prevention has been described as neither realistic nor possible. The most effective deterrent to infection is to cut fingernails short, to wash hands thoroughly after using the bathroom and before preparing food, and to wash bed sheets and towels in hot water.

Negative Impacts: injures humans (causes disease in humans )

  • Al-Rufaie, H., G. Rix, P. Clemente, T. Al-Shawaf. 1998. Pinworms and postmenopausal bleeding. Journal of Clinical Pathology, 51(5): 401-402.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!