Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Athrycia curvinervis is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Eurithia anthophila is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Eurithia consobrina is endoparasitoid of larva of Lacanobia oleracea

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Brassica oleracea
Other: minor host/prey

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live fruit of Lycopersicon esculentum
Other: major host/prey

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Dianthus caryophyllus garden hybrids

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Cucumis sativus

Animal / parasitoid / endoparasitoid
larva of Lydella stabulans is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Siphona cristata is endoparasitoid of larva of Lacanobia oleracea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lacanobia oleracea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lacanobia oleracea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGTAATTGACTTGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCTCCTTCTTTAACTTTACTTATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTACTATTATTATCCTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGTGGAGGTGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bright-line Brown-eye

"Brown-eyes" redirects here. For other uses, see Brown eyes (disambiguation).

The Bright-line Brown-eye (Lacanobia oleracea) is a moth of the family Noctuidae. It is a common species throughout Europe, but is also found in North Africa, temporate Asia, the Near East and Middle East, northern India, China, Korea and Japan.

Caterpillar
Pupa

This species' common name is usefully descriptive: The forewings are dark reddish-brown marked with a prominent light orange-brown stigma and a bright white subterminal line. The hindwings are grey, darker towards the termen. The wingspan is 34–44 mm. They are attracted to light, sugar and nectar-rich flowers.

The larva is green or brown with black and yellow stripes down the side. It feeds on a wide range of plants.[1] and is occasionally a pest of cultivated tomatoes. The species overwinters as a pupa.

Flight from latter half of June to July. Occasional second generation from end of August to first half of September.[2]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!