Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Athrycia curvinervis is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Eurithia anthophila is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Eurithia consobrina is endoparasitoid of larva of Lacanobia oleracea

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Brassica oleracea
Other: minor host/prey

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live fruit of Lycopersicon esculentum
Other: major host/prey

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Dianthus caryophyllus garden hybrids

Foodplant / open feeder
caterpillar of Lacanobia oleracea grazes on live leaf of Cucumis sativus

Animal / parasitoid / endoparasitoid
larva of Lydella stabulans is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Lacanobia oleracea

Animal / parasitoid / endoparasitoid
larva of Siphona cristata is endoparasitoid of larva of Lacanobia oleracea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lacanobia oleracea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGTAATTGACTTGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCTCCTTCTTTAACTTTACTTATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTACTATTATTATCCTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGTGGAGGTGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lacanobia oleracea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bright-line brown-eye

"Brown-eyes" redirects here. For other uses, see Brown eyes (disambiguation).

The bright-line brown-eye (Lacanobia oleracea) is a moth of the family Noctuidae. It is a common species throughout Europe, but is also found in North Africa (Morocco and Algeria), temperate North Asia and Central Asia, Asia Minor, Syria, and Turkestan, northern India, China, Korea and Japan.

Caterpillar
Pupa

This species' common name is usefully descriptive: The forewings are dark reddish-brown marked with a prominent light orange-brown stigma and a bright white subterminal line. The hindwings are grey, darker towards the termen. The wingspan is 34–44 mm. They are attracted to light, sugar and nectar-rich flowers.

Technical description and variation[edit]

See glossary for terms used

Forewing red brown clouded with darker; veins grey, whitish towards termen: reniform stigma orange in its upper part, dark fuscous below; orbicular round, white-edged, sometimes very small; submarginal line finely white, toothed on veins 3, 4 to termen; hindwing dull whitish, pale fuscous towards termen; the veins dark;-the ground colour varies on one side to black brown, ab. obscura Spul, and on the other to rufous, ab. rufa Tutt ; ab. variegata Aust, from Morocco, is paler, reddish yellow.[1]

The larva is green or brown dotted with white with black and yellow spiracular lines down the side with darker edging.The tubercles are black.It feeds on a wide range of plants.[2] and is occasionally a pest of cultivated tomatoes. The species overwinters as a pupa.

Flight from latter half of June to July. Occasional second generation from end of August to first half of September.[3]

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
  3. ^ Lacanobia reference

External links[edit]

Reading[edit]

  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!