Overview

Comprehensive Description

Taxonomic History

Taxonomic history

Schenck, 1852 PDF: 59 (w.); Hauschteck, 1962 PDF: 219 (k.); Hung, 1969 PDF: 456 (k.).
Senior synonym of Lasius belgarum: Wilson, 1955a PDF: 150; Seifert, 1988a PDF: 150; of Lasius hirtiscapus: Wilson, 1955a PDF: 150; Seifert, 1990 PDF: 11; of Lasius affinoumbratus, Lasius aphidicola, Lasius epinotalis, Lasius exacutus, Lasius nyaradi, Lasius osakana, Lasius silvestrii and material of the unavailable names Lasius mixtoaffinis, Lasius mixtobicornis referred here: Wilson, 1955a PDF: 150; of Lasius mixtoumbratus: Wilson, 1955a PDF: 150; Kutter, 1977c: 14.
See also: Stitz, 1939: 291; Bernard, 1967a PDF: 363; Kutter, 1977c: 232; Yamauchi, 1979 PDF: 168; Seifert, 1988a PDF: 150; Atanassov & Dlussky, 1992: 245; Radchenko, 2007: 34.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Various habitats
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

38. Lasius umbratus HNS (Nylander, 1846)

Figs. 139-142.

Formica umbrata Nylander HNS , 1846b: 1048.

Worker. Clear yellow to reddish yellow; funiculus segments 2 to 4 slightly longer than wide . Scape elliptical in cross section. Petiole tapering to dorsal crest which is usually emarginate. Body surface and appendages covered in adpressed silvery pubescence. Longest hairs on gaster 0.06 mm to 0.11 mm, about half maximum hind tibial width. Erect hairs on genae, scapes and tibiae numerous. Length: 3.8-5.5 mm.

Figs. 136-138. Lasius fuliginosus (Latr.) HNS . - 136: queen in profile; 137: head of worker in dorsal view; 138: head of male in dorsal view. Scale: 1 mm.

Queen . Reddish brown. Head broader than maximum width of alitrunk. Funiculus segments longer than broad. Petiole sides curved, tapering to dorsal crest which is more or less emarginate. Pubescence and body hairs as in worker. Head width: 1.65-1.80 mm. Length: 6.8-8.0 mm.

Male. Dark brown to brownish black. Head broad with denticulate mandibles. Petiole somewhat tapering. Body surface including frons with rugose microsculpture and generally thick pubescence. Eyes with outstanding hairs. Tibial and scape hairs variable often sparse. Length: 4.0-4.8 mm.

Distribution. Local in Denmark and Southern Fennoscandia up to 62°. Throughout British Isles to Central Scotland. - Range: throughout Europe, widely distributed and not uncommon.

Biology. This species nests under boulders, in tree stumps and at the base of old trees. Workers are subterranean and seldom or never seen above ground. Flight period from mid August to late September. Single queens found colonies by invasion of and adoption in Lasius niger, HNS L. alienus HNS or occasionally L. brunneus HNS nests. In late summer dealate queens often wander over the surface of L. niger HNS nests, sometimes carrying a dead L. niger HNS worker as a prelude to securing adoption.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 101-102, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lasius umbratus (Nylander HNS 1846b)

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Throughout SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 57): Bulgaria ( Atanassov and Dlusskij 1992 ); Sofia Basin: Sofia ( Forel 1892 , Lapeva-Gjonova and Atanasova 2004 ); Ograzhden Mt. ( Atanassov 1964 ); Western Rhodopi Mts: Dospat ( Lapeva-Gjonova in press (a) ); Eastern Rhodopi Mts: Dedets vill. (Zlatograd) ( Lapeva-Gjonova 2004a ).

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Crimee (Karasan, pres d'Aluschta, 1 [[ male ]], 16. V; Aluschta, 1 [[ queen ]]; 2 [[ male ]], 13. V. 1900. N. Kuznecov!).,

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / sequestrates
queen (newly mated) of Lasius fuliginosus takes over nest of Lasius umbratus

In Great Britain and/or Ireland:
Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius niger s.l.

Animal / sequestrates
queen (newly mated) of Lasius umbratus takes over nest of Lasius alienus s.l.

Plant / resting place / within
nest of Lasius umbratus may be found in trunk (base) of Trees

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Lasius umbratus preys on:
various

Based on studies in:
USA: North Carolina (Forest, Plant substrate)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasius umbratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATTTTTTCCCTTCATATCGCTGGGATCTCCTCTATTTTAGGAGCTATTAATTTTATTTCAACCATTATAAATATACACCATAAAAATTTTTCTATCGATAAAATACCTTTACTTGTATGATCAATTTTAATTACTGCAATTTTATTACTTTTATCTCTCCCAGTTCTTGCAGGA---GCTATTACAATACTTCTAACTGATCGTAATCTTAATACTTCATTCTTTGATCCATCAGGTGGGGGAGACCCTATTTTATATCAACATCTTTTCTGATTTTTCGGACATCCAGAAGTTTATATTTTAATTCTTCCCGGATTTGGATTAATTTCCCATATCATTATAAATGAAAGTGGAAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCCCTTATAGCAATTGGATTTTTAGGATTTGTTGTTTGAGCTCATCATATATTTACTATTGGCCTAGATGTCGATACTCGTGCTTATTTTACTTCAGCAACTATAATTATTGCCATTCCAACAGGAATTAAAATTTTTAGATGAATTACT---ACCCTTCATGGAACA---AAAATCAATAATAATTCTTCTTTATGATGAACAATAGGATTTATTTTTCTATTCACTATAGGAGGTCTTACAGGAGTAATACTTTCTAACTCATCAATTGATATCATTCTTCATGATACCTATTACGTAGTTGCTCATTTTCATTATGTA---TTATCAATAGGAGCAGTATTTGCTATTATTGCTAGATTTATCCATTGATTTCCTTTAATAACTGGTTTCTCTTTAAACAATTTTTTTCTAAATATTCAATTTATTTGTATGTTCACAGGAGTAAATTTAACATTTTTTCCTCAACATTTTTTAGGCTTAAGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius umbratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lasius umbratus

Lasius umbratus is a parasitic ant. The queens of this species seek out a Lasius niger worker ant, to first kill in order to gain the worker ant's scent and then to discreetly sneak inside a Lasius niger nest. Once inside the Lasius umbratus queen finds the Lasius niger queen, and kills her. The worker ants will care for the new queen's larvae and slowly the colony will become one of Lasius umbratus.[2] 'Umbratus' is Latin for the word 'ghost'.

They are sometimes confused with Lasius flavus (yellow meadow ant) but unlike L. flavus they forage for food on the surface.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Chthonolasius.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!