Overview

Distribution

non-marine origin (but recorded from the sea)
  • Gibson, D.I. (2001). Acanthocephala, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 176-177
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus lucii endoparasitises anterior intestine of Anguilla anguilla

Animal / parasite / endoparasite
encapsulated cystacanth of Acanthocephalus lucii endoparasitises haemocoel of Asellus aquaticus
Other: sole host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthocephalus lucii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATGTATATAGTATTTGGTTTGTGGGGAGGGTTAGTGGGCGTATCATTGAGTTTAATTATTCGGTTGGAGTTAGGTGCTAGGGGGGTTTGGCTTGGGGATGAATATCTGTATAACATGGTTGTAACAACCCATGGGGTGATAATAGTATTCTTTTTGGTGATGCCCTTTATGATGGGTGGTTTTGGCAATTGGATATTACCTGTGATACTAGGACTAAGGGATATAACACTTCCACGGTTAAATAACCTCAGATTCTTGATATTAGTTTTAGCTTTGGGGTTAAGTGGTCTGTCTATAGTTGTATTAGGTGGTGCATCCGGGTGAACAATATACCCACCACTAATGTTAGGTGGTTACAGACCAAGGGCAGCAGTTGATTTAATAGTTTTAAGTTTGCATATTGTAGGGTAGTCCTCTATTTTTGGGGCTATCAATTTTATTGTGACATTATACAGGTATGCATTACAGGGTGGGGGTTTATTACAAACCCCCACCCTCTTTTAGTCTGAGCAGAGATTGTGGCTGCTGGGTTGGTGCTTTTAACAGTTCCAGTCCTAGCAGCAGCTTTAACAATGGTTTTGATAGATCGTAATTTAGGGACAAGGTATTTTGACCCATGTGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthocephalus lucii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!