Overview

Comprehensive Description

Biology/Natural History: These worms are most often commensals on painted seastars Evasterias troschelii, but it may sometimes be found on other species of seastar or may be freeliving. Alternate hosts include Leptasterias aequalis, Leptasterias hexactis, Orthasterias koehleri, Stylasterias forreri, Luidia foliata, Pisaster ochraceous, and Solaster dawsoni. They are attracted by the smell of their host, at least as long as the host is uninjured. Usually only one individual occurs on a host at a time (they are antagonistic to one another), but up to 4 have been found. They feed on detritus

Members of Family Polynoidae, unlike most other errant polychaetes, have parapodia specialized for walking rather than as paddles. Their longitudinal muscles, which caused lateral undulations in other polychaetes, are poorly developed and they don't undulate much. As a result, although they can walk efficiently they are poor swimmers.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with all Polynoids, this species is mostly benthic, few if any of the segments are longer than wide when contracted, the dorsal surface has clearly visible elytra, and all of the neurosetae are simple. Arctonoe fragilis has more than 18 pairs of elytra which have extensively ruffled or folded edges, leave a large gap between them down the center of the body, and are not on every segment posterior to segment 38, but are on every other segment near the posterior end of the body. The point of attachment of the elytrum is often white. The species has no prominent nuchal fold. The prostomium has a pair of palps, a pair of tentacles, and 3 pair of antennae, the lateral pair of which are inserted slightly ventral to the edge of the prostomium, notosetae are present, and there is no dark band across the body behind the head on segments 7 and 8. Two pairs of black eyes on the upper side of the prostomium. Usually pale colored, similar to the seastar Evasterias troschelii which is its most common host. Width to 1 cm and length to 8.5 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Alaska peninsula to San Francisco Bay, CA (uncommon in CA)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Arctonoe pulchra and Arctonoe vittata have elytra whose margins are smooth or only slightly ruffled, plus Arctonoe vittata has a dark band across segments 7 and 8 behind the head.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 27 - 73

Graphical representation

Depth range (m): 27 - 73
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to 275 m

Habitat: Mostly symbiotic on the seastar Evasterias troschelii

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonoe fragilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTATACTTTATTTTTGGTACTTGGTCAGGCTTATTAGGAACTTCTATAAGTCTCCTAATTCGAGCAGAACTTGGCCAACCAGGATCTCTTCTAGGAAGAGATCAACTCTATAATACAATTGTTACTGCTCATGCTTTTTTAATAATTTTCTTTTTAGTTATACCCGTACTTGTAGGGGGATTTGGTAATTGATTAATCCCTCTTATATTAGGTGCCCCAGATATAGCATTTCCACGGTTAAATAATATAAGATTTTGATTACTCCCCCCATCTCTAATTCTTCTTCTATCCTCAGGAGCTGTAGAAAAGGGAGTTGGGACCGGTTGAACAGTATACCCCCCTCTATCCTCTAATATTGCTCATGCTGGCCCTTCTGTTGATTTAGCTATTTTTTCCCTTCACATTGCTGGAGTTTCTTCAATTTTGGGGGCCTTAAATTTTATTACTACTGTTATTAATATACGCTATAAAGGCCTACGTTTGGAGCGAGTTCCTTTATTTGTCTGGGCGGCTAAAGTAACTGCAATTTTATTATTATTATCCCTCCCAGTATTGGCAGGAGCTATTACTATACTATTAACAGATCGTAATTTAAATACTGCTTTCTTTGATCCTGCTGGGGGTGGTGATCCTGTTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctonoe fragilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!