Overview

Comprehensive Description

Biology/Natural History: Usually lives symbiotically with Cryptochiton stelleri, Diodora aspera, or the seastar Dermasterias imbricata. Also may be found on Henricia leviuscula, Luidia foliata, Pteraster tesselatus, Solaster stimpsoni, Solaster dawsoni, Haliotis kamtschkana, and the terebellid worms Thelepus crispus and Neoamphitrite robusta. Polynoids such as Arctonoe are carnivores, but do not feed on the animals with which they are symbiotic. Frequently they nip of the heads of small tube-dwelling polychaetes as their host moves around. Individuals taken from their hosts will generally prefer their same host species over other species they are symbiotic with. They seem to locate their host by using chemoreceptors on their three prostomial antennae, with further recognition by contact with the peristomial palps. Small juvenile worms are found mainly in the summer. Generally only one worm inhabits a given host, suggesting that this species may fight over hosts as does A. pulchra. When Pisaster ochraceous attacks Diodora aspera in which this species is living, the worm moves around the pallial groove of the limpet to the side the seastar is attacking from, reaches out, and bites the tube feet or ambulacral area of the seastar. This frequently results in the seastar withdrawing from its attack.

Members of Family Polynoidae, unlike most other errant polychaetes, have parapodia specialized for walking rather than as paddles. Their longitudinal muscles, which caused lateral undulations in other polychaetes, are poorly developed and they don't undulate much. As a result, although they can walk efficiently they are poor swimmers.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with all Polynoids, this species is mostly benthic, few if any of the segments are longer than wide when contracted, the dorsal surface has clearly visible elytra, and all of the neurosetae are simple. Arctonoe vittata has at least 30 pairs of elytra which leave a broad gap down the dorsal side of the animal (photo). Elytra are on segments 2, 4, 5, then every other segment to 23, 26, 29, then every other segment to the end of the body. The edges of the elytra are smooth. It has no prominent nuchal fold and the lateral prostomial antennae are inserted slightly ventral to the edge of the prostomium, may have few or sometimes no notosetae. Has two types of neurosetae: those above the acicula have blunt, bifid tips, while those below the acicula are thicker and have falcate, pointed tips. The species is usually ivory colored with several transverse stripes, especially a broad dark band (brown, reddish-brown, or blackish) across segments 7 and 8. Can be up to 10 cm long, but usually is shorter.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Bering Strait south to Ecuador; Japan

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This is the only Arctonoe commensal scaleworm that has the broad dark band across the back. A. pulchra is usually orange and may have fewer elytra, which nearly meet dorsally. A. fragilis has frilly edges to the elytra.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 237.5
  Temperature range (°C): 0.440 - 10.151
  Nitrate (umol/L): 5.322 - 11.516
  Salinity (PPS): 31.893 - 32.179
  Oxygen (ml/l): 6.561 - 7.943
  Phosphate (umol/l): 0.943 - 1.583
  Silicate (umol/l): 15.658 - 30.624

Graphical representation

Depth range (m): 0 - 237.5

Temperature range (°C): 0.440 - 10.151

Nitrate (umol/L): 5.322 - 11.516

Salinity (PPS): 31.893 - 32.179

Oxygen (ml/l): 6.561 - 7.943

Phosphate (umol/l): 0.943 - 1.583

Silicate (umol/l): 15.658 - 30.624
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Middle intertidal to 275 m

Habitat: Symbiotic with many invertebrates, including sea stars, terebellid polychaetes, gastropods such as Diodora aspera, and Cryptochiton stelleri.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonoe vittata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTCTATACTTTATTTTTGGTACTTGATCAGGCTTATTAGGAACTTCTATAAGTCTCCTAATTCGAGCAGAACTTGGCCAACCAGGGTCTCTTCTAGGAAGAGATCAACTCTATAATACAATTGTTACTGCTCATGCTTTTTTAATAATTTTCTTTTTAGTTATACCCGTACTTGTAGGGGGGTTTGGTAATTGGTTAATCCCTCTTATACTAGGCGCCCCAGATATAGCATTTCCACGGTTAAATAATATAAGATTTTGATTACTCCCCCCATCTCTAATTCTTCTTCTATCCTCAGGAGCTGTAGAAAAGGGAGTTGGGACCGGTTGAACGGTATACCCTCCTCTATCCTCTAATATTGCTCATGCTGGTCCTTCTGTTGATTTAGCTATTTTTTCCCTTCACATTGCTGGAGTTTCTTCAATTTTGGGGGCCTTAAATTTTATTACTACTGTTATTAATATACGCTATAAAGGCCTACGTTTGGAGCGAGTTCCTTTATTTGTCTGAGCGGCTAAAGTAACTGCAATTTTATTATTATTATCCCTTCCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACTGCTTTCTTTGATCCTGCTGGTGGTGGTGATCCTGTTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arctonoe vittata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!