Overview

Comprehensive Description

Biology/Natural History: This species is attracted by the smell of its host (if the host is uninjured), but can learn to live with a new species. Its body color is usually close to that of its host. It eats detritus. Adults are territorial and will try to drive other individuals off their host. They may injure or kill one another in fights over a host.

Members of Family Polynoidae, unlike most other errant polychaetes, have parapodia specialized for walking rather than as paddles. Their longitudinal muscles, which caused lateral undulations in other polychaetes, are poorly developed and they don't undulate much. As a result, although they can walk efficiently they are poor swimmers.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As with all Polynoids, this species is mostly benthic, few if any of the segments are longer than wide when contracted, the dorsal surface has clearly visible elytra, and all of the neurosetae are simple. Arctonoe pulchra has at least 20 pairs of elytra, elytra are on segments 2, 4, 5, then every other segment to 23, 26, 29, then every other segment to the end of the body. The edges of the elytra are smooth (photo), and they nearly meet along the animal's dorsal midline. It has no prominent nuchal fold and the lateral prostomial antennae are inserted slightly ventral to the edge of the prostomium, may have few or sometimes no notosetae. The neurosetae are falcate, with pointed tips, and hooked. Most individuals are brick red, and the species has no dark band across segments 7 and 8. Up to 7 cm long.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean, USA
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Gulf of Alaska to Baja California, Mexico; uncommon in California

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Arctonoe vittata has a band of dark pigment extending across segments 7 and 8. Arctonoe fragilis has ruffled or folded margins on the elytra.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 50 - 150
  Temperature range (°C): 9.107 - 9.107
  Nitrate (umol/L): 9.815 - 9.815
  Salinity (PPS): 32.654 - 32.654
  Oxygen (ml/l): 5.588 - 5.588
  Phosphate (umol/l): 1.205 - 1.205
  Silicate (umol/l): 16.608 - 16.608

Graphical representation

Depth range (m): 50 - 150
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Lower intertidal to 275 m

Habitat: Symbiotic with several invertebrates including sea stars such as Solaster stimpsoni, Pteraster tesselatus, Luidia foliata, and Dermasterias imbricata, sea cucumbers such as Parastichopus californicus and P. parvimensis, and other animals such as Cryptochiton stelleri, Diodora aspera, Megathura crenulata and terebellid polychaetes such as Loimia montagui.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arctonoe pulchra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTCTATACTTTATTTTTGGTACTTGATCTGGTCTGTTGGGAACTTCTATAAGGCTCCTAATTCGAGCAGAACTTGGACAACCAGGATCTCTTCTGGGAAGAGATCAACTCTATAACACAATTGTTACTGCTCATGCTTTTTTAATAATTTTCTTTTTAGTTATACCAGTTCTTGTTGGAGGGTTTGGTAATTGGTTAATTCCTCTAATATTAGGTGCCCCAGATATGGCATTTCCGCGGTTAAATAATATAAGATTTTGATTACTACCCCCCTCTCTAATCCTACTTTTATCTTCAGGAGCTGTAGAAAAGGGAGTTGGAACCGGTTGAACGGTATACCCCCCTCTATCCTCTAATATTGCCCATGCTGGCCCTTCTGTTGATTTAGCGATTTTTTCCCTTCACATCGCTGGGGTTTCCTCAATTTTAGGCGCATTAAATTTTATTACTACTGTTATTAATATACGCTATAAAGGCCTACGTTTGGAACGAGTTCCTTTATTTGTTTGAGCGGCTAAAGTGACTGCAATTTTATTATTATTATCCCTTCCAGTGCTAGCAGGAGCTATCACTATATTATTAACAGATCGTAATTTAAATACTGCTTTCTTTGATCCTGCTGGTGGTGGTGACCCTGTTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arctonoe pulchra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!