Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range Description

Range extends from southern Colorado and Utah south through Arizona, New Mexico, western and central Texas in the United States, and much of Mexico to Guatemala, at elevations from near sea level to around 2,700 meters (8,700 feet) (Webb 1980, Rossman et al. 1996, Stebbins 2003). The distribution is spotty in many areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) The range extends from southern Colorado and Utah south through Arizona, New Mexico, western and central Texas, and much of Mexico to Guatemala, at elevations from near sea level to around 2,700 meters (8,700 feet) (Webb 1980, Rossman et al. 1996, Stebbins 2003). The distribution is spotty in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: SW USA (S Colorado, Utah, Arizona, Texas, New Mexico), Mexico (Aguascalientes, Tamaulipas), Guatemala  ocellatus: Edwards Plateau of SC Texas west to the Big Bend.  postremus: Mexico (Michoacan)  vicinus: Mexico (Michoacan)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 109 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Colorado Plateau Shrublands Habitat

This taxon can be found in the Colorado Plateau shrublands, as one of its North American ecoregions of occurrence. The Plateau is an elevated, northward-tilted saucer landform, characterized by its high elevation and arid to semi-arid climate. Known for the Grand Canyon, it exhibits dramatic topographic relief through the erosive action of high-gradient, swift-flowing rivers that have downcut and incised the plateau. Approximately 90 percent of the plateau is drained by the Colorado River and its tributaries, notably the lower catchment of the Green River.

A pinyon-juniper zone is extensive, dominated by a pygmy forest of Pinyon pine (Pinus edulis) and several species of juniper (Juniperus spp). Between the trees the ground is sparsely covered by grama, other grasses, herbs, and various shrubs, such as Big sagebrush (Artemisia tridentata) and Alder-leaf cercocarpus (Cercocarpus montanus).

A montane zone extends over large areas on the high plateaus and mountains, but is much smaller than the pinyon-juniper zone. The montane vegetation varies considerably, from Ponderosa pine in the south to Lodgepole pine and Aspen further north. Northern Arizona contains four distinct Douglas-fir habitat types. The lowest zone has arid grasslands but with many bare areas, as well as xeric shrubs and sagebrush. Several species of cacti and yucca are common at low elevations in the south.

Numerous mammalian species are found within the Colorado Plateau shrublands ecoregion, including the Black-tailed prairie dog (Cynomys ludovicianus); Long-eared chipmunk (Tamias quadrimaculatus); Utah prairie dog (Cynomys parvidens EN); Yellow-bellied marmot (Marmota flaviventris); and the Uinta chipmunk (Tamias umbrinus), a burrowing omnivore.

A large number of birds are seen in the ecoregion, with representative taxa: Chestnut-collared longspur (Calcarius ornatus NT); Greater sage grouse (Centrocercus urophasianus NT); Northern pygmy owl (Glaucidium gnoma); Cactus wren (Campylorhynchus brunneicapillus).

There are various snakes occurring within the Colorado Plateau, including: Black-necked garter snake (Thamnophis cyrtopsis), usually found in riparian zones; Plains Blackhead snake (Tantilla nigriceps); Black-tailed rattlesnake (Crotalus molossus), who seeks inactivity refuge in rock crevices, animal burrows and even woodrat houses. Other reptiles found here include the Common checkered whiptail (Cnemidophorus tesselatus).

There are only a limited number of anuran taxa on the Colorado Plateau; in fact, the comprehensive occcurrence list for the ecoregion is: Red-spotted toad (Anaxyrus punctatus); Canyon treefrog (Hyla arenicolor); Woodhouse's toad (Anaxyrus woodhousii); Couch's spadefoot toad (Scaphiopus couchii); Northern leopard frog (Lithobates pipiens); Plains spadefoot toad (Spea bombifrons); and Southwestern toad (Anaxyrus microscaphus). The Tiger salamander (Ambystoma tigrinum) is the sole salamander found on the Colorado Plateau shrublands.

The Colorado River fish fauna display distinctive adaptive radiations. The Humpback chub (Gila cypha), for example, is a highly specialized minnow that lives in the upper Colorado. It adapted to the water’s fast current and its extremes of temperature and flow rate. Dams and water diversion, however, have created a series of placid, stillwater lakes and side streams, and the Humpback chub may not be able to adapt to these altered conditions. The species, along with other native Colorado River fishes including the Bonytail (Gila elegans), Squawfish (Ptychocheilus lucius), and the Flannelmouth sucker (Catostomus latipinnis), may not survive much further in time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
This snake occurs in a wide range of habitats, from desert flats, dry grasslands, and tropical lowlands to pine-oak habitats and cloud forest in mountains; in the southwestern United States it is often in the vicinity of permanent and intermittent streams, spring seepages, and irrigation canals, usually in canyons, foothills, or mountains (Stebbins 2003). It inhabits rocky hillsides and limestone ledges, and wooded ravines and cedar brakes, in the Texas Hill Country (Tennant 1984). In Mexico, habitats include tropical barrancas, thorny scrub forest, tropical deciduous forest, and upper arid or mixed boreal-tropical cloud forest (Rossman et al. 1996). This snake wanders far from water into adjacent grassland, desert, woodland, and shrubland, but mostly it is restricted to the vicinity of consistent water sources in the arid southwest (Jones 1990).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: This snake occurs in a wide range of habitats, from desert flats, dry grasslands, and tropical lowlands to pine-oak habitats and cloud forest in mountains; in the southwestern United States it is often in the vicinity of permanent and intermittent streams, spring seepages, and irrigation canals, usually in canyons, foothills, or mountains (Stebbins 2003). It inhabits rocky hillsides and limestone ledges, and wooded ravines and cedar brakes, in the Texas Hill Country (Tennant 1984). In Mexico, habitats include tropical barrancas, thorny scrub forest, tropical deciduous forest, and upper arid or mixed boreal-tropical cloud forest (Rossman et al. 1996). This snake wanders far from water into adjacent grassland, desert, woodland, and shrubland, but mostly it is restricted to the vicinity of consistent water sources in the arid Southwest (Jones 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats frogs, toads, tadpoles, salamanders, lizards, and crustaceans (Stebbins 1985, Tennant 1984). Opportunistic forager. Forages mainly along stream banks and at pools, and at or near the water's surface (Jones 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by many occurrences or subpopulations. Webb (1980) mapped over 200 collection sites across the entire range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but certainly exceeds 10,000 and probably exceeds 100,000. This snake is often common in suitable habitat (Woodin 1953, Minton 1959, Tennant 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active from April to October in north (Hammerson 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Gives birth to 3-25 young (usually less than 10), June- August.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thamnophis cyrtopsis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTCCTGCTTCTATCCTCATCCTATGTAGAAGCCGGTGCCGGCACCGGCTGAACAGTGTACCCACCCCTTTCAGGGAACCTGGTACACTCTGGCCCCTCAGTAGACCTG---GCGATCTTCTCCCTACACCTAGCAGGCGCCTCGTCCATCCTGGGAGCAATCAACTTCATCACAACATGTATTAACATAAAACCAAAATCCATACCAATATTCAATATCCCCTTGTTCGTCTGGTCAGTCTTAATTACCGCCATTATACTACTGTTAGCCCTACCAGTACTAGCGGCA---GCGATTACTATACTATTAACCGACCGAAACATCAACACCTCATTTTTTGATCCGTCTGGGGGCGGAGACCCGGTTTTATTCCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTATATATTCTTATCCTACCCGGATTCGGCATTATTTCAAGCATTATCACATTCTATACCGGAAAAAAA---AACACATTCGGATACACAAGTATAATTTGAGCAATAATATCCATCGCAATCTTAGGTTTTGTAGTATGAGCACACCACATATTCACCGTCGGCCTGGATATTGACAGCCGAGCCTACTTCACAGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thamnophis cyrtopsis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Hammerson, G.A.

Reviewer/s
Bowles, P.

Contributor/s

Justification
Listed as Least Concern in view of the large and probably relatively stable extent of occurrence, area of occupancy, number of subpopulations, and population size. No major threats are known.

History
  • 2007
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by many occurrences or subpopulations. Webb (1980) mapped over 200 collection sites across the entire range. The total adult population size is unknown but certainly exceeds 10,000 and probably exceeds 100,000. This snake is often common in suitable habitat (Woodin 1953, Minton 1959, Tennant 1984). Its extent of occurrence, area of occupancy, number of subpopulations, and population size are probably relatively stable. Possible declines have been recorded at the extreme northern limit of the range in southwestern Colorado (Hammerson 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable. Possible declines have been recorded at the extreme northern limit of the range in southwestern Colorado (Hammerson 1999).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known. In some areas, habitat has been lost or degraded as a result of urbanization, deforestation, or conversion to intensive agricultural uses. In some areas, this species may be collected for the pet trade, but this is not a significant threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: No major threats are known. In some areas, habitat has been lost or degraded as a result of urbanization, deforestation, or conversion to intensive agricultural uses. The pet trade is a potential threat to this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action. At least several occurrences of this species are in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Several to many (4-40) occurrences appropriately protected and managed

Comments: At least several occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackneck garter snake

Common names: blackneck garter snake, black-neck garter snake

Thamnophis cyrtopsis, the blackneck garter snake, is a species of garter snake of the genus Thamnophis.[2] It is native to the southwestern United States, Mexico and Guatemala, and can be found in a wide range of different habitats,[1] often near water sources.[3]

Description[edit]

There are five recognized subspecies of the blackneck garter snake, two of which, Thamnophis cyrtopsis cyrtopsis and Thamnophis cyrtopsis ocellatus, are described below.

Western blackneck garter snake[edit]

Thamnophis cyrtopsis cyrtopsis (Kennicott, 1860)

The western blackneck garter snake may attain 107 cm (42 inches) in total length. The snake is colored dark olive with an orange-yellow stripe that is displayed on the middle of the body from the top while the underside is usually a cream or light shade of gray.[4] The western blackneck is a water snake that lives near rivers, swims, and eats small fish and tadpoles.

Eastern blackneck garter snake[edit]

Thamnophis cyrtopsis ocellatus (Cope, 1880)

The eastern blackneck garter snake is smaller than the western blackneck garter snake, with an average total length of less than 51 cm (20 inches). It is frequently found on dry land near a water source rather than in water. It displays three light stripes on a dark-colored body with uniform orange and orange-yellow spreading throughout.[5]

Geographic range[edit]

The Blackneck garter snake can be found in southeastern and central Arizona, parts of the southwestern United States, Mexico and Guatemala.[1][6]

Habitat[edit]

Found near water in desertscrub, grasslands, chaparral, woodland environments.[6]

Behavior[edit]

It is active during the day and during twilight activities, and occasionally at night, hibernating from late fall to winter and mating in late spring or summer.[6]

Feeding[edit]

Hunts in rivers for small fish, amnphibians, other snakes, and invertebrates, such as earthworms.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Thamnophis cyrtopsis was for many years referred to as T. eques (see Rossman et al. 1996 for a discussion of the complicated taxonomic history of T. cyrtopsis). Thamnophis cyrtopsis includes "Thamnophis vicinus," formerly regarded as a distinct species but now regarded as a localized color pattern morph of T. cyrtopsis occurring in Michoacan, Mexico (Rossman 1996, Proc. Biol. Soc. Washington 109:10-16).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!