Overview

Brief Summary

Tuatara are members of the taxon Rhynchocephalia and are most closely related to squamates (i.e., amphisbaenians, lizards, and snakes). Like squamates, tuatara are elongate and shed skin in large fragments. Unlike squamates, tuatara lack paired hemipenes (male copulatory organs).

The common name "tuatara" comes from Maori words meaning "spines on back," in reference to the crest on the backs of males and females. Tuatara have a lizard-like appearance: both groups are elongate with four limbs (most lizards) and both lizards and tuatara are known to shed their tails (caudal autotomy). The groups diverge, however, on the presence or lack of a paired hemipenes, the morphology of the teeth and skull, and other important features. Tuatara are long-lived species, reaching sexual maturity at about 20 years. Two species of tuatara, Sphenodon guntheri and Sphenodon punctatus, are located in New Zealand, and are the only species known to exist.

  • Pianka, Eric R. and Laurie J. Vitt. "Evolutionary History and Phylogeny." Chapter 1. Lizards: Windows to the Evolution and Diversity. Ed. Harry W. Greene. Berkeley: University of California Press. 2003: 11-18.
  • Pough, Harvey F., Robin M. Andrews, John E. Cadle, Martha L. Crump, Alan H. Savitzky, and Kentwood D. Wells. Herpetology. 3rd Ed. Upper Saddle River, New Jersey: Pearson Education, Inc. 2004.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The two recognized species of tuatara (Sphenodon punctatus and Sphenodon guntheri) are found on approximately 30 small, relatively inaccesible, islands off the coast of New Zealand. The species was once widely distributed throughout New Zealand, but became extinct on the mainland before the arrival of European settlers.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Oceania
Distribution: New Zealand (Islands off North Island & Cook Strait; Northland to Bay of Plenty Islands (Poor Knights Islands, Hen & Chicken Islands, Cuvier Island, Mercury Islands, Alderman Islands, Kawera Island, Plate Island, Moutolki Island)  
Type locality: Karewa Island, Bay of Plenty, New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
New Zealand

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Tuataras may be grey, olive, or brickish red in color. They range in adult length from about 40 cm (female) to 60 cm (large male), with the male generally reaching larger proportions. They lack external ears, have a diapsid skull (two openings on either side), and posess a "parietal eye" on the top of their head. Other lizards also have this "third-eye," which contains a retina and is functionally similar to a normal eye, though the function has not been clearly recognized and a scale grows over it in adult tuataras. The male tuatara displays a striking crest down the back of the neck, and another down the middle of the back. The female has a less developed version of this. Unlike all other living toothed reptiles, the tuatara's teeth are fused to the jaw bone (acrodont tooth structure). The tuatara has a very slow metabolism and is a very long-lived species. It's not uncommon for an individual to live for over 100 years.

Range mass: 0.4 to 1 kg.

Average basal metabolic rate: 0.0605 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The geographic range which the tuatara inhabits is a difficult niche for any species, particularly a reptile. The islands are generally cliff-bound, frequently exposed to strong winds, and support a natural, often stunted, vegetation of salt and wind tolerant species. Most islands are also home to several species of sea birds, whose nutrient-rich guano helps support the island's ecosystem. The habitat is cold and damp, with temperatures rarely exceeding 70 degrees Fahrenheit, and a humidity level of about 80 percent. The temperature may often approach freezing, but the tuatara is able to maintain normal activities at temperatures as low as 45 degrees Fahrenheit. Preferred body temperature is between 60 and 70 degrees, this is the lowest optimal body temperature of all reptiles. At temperatures above 76 degrees, tuataras show signs of distress, and most will die if the temperature exceeds 82 degrees.

Terrestrial Biomes: chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Trophic Strategy

Food Habits

Diet consist of arthropods, earthworms, snails, bird eggs, small birds, frogs, and lizards, and a native cricket-like insect the size of a mouse called a weta. Young tuataras are also occasionally cannibalized. Due to its low metabolic rate, the tuatara eats much less frequently than other reptiles.

Animal Foods: birds; amphibians; reptiles; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
35.0 years.

Average lifespan

Status: captivity:
77.0 years.

Average lifespan

Status: captivity:
50.0 years.

Average lifespan

Status: captivity:
11.7 years.

Average lifespan

Sex: male

Status: captivity:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 90 years (captivity) Observations: Tuataras are the only living descendents from the Rhynchocephalia order and thus have no closely-related species. They are found only in New Zealand. Even though tuataras rarely exceed one kilogram in weight, they are long-lived, attaining sexual maturity after 10-20 years and growing until they are 35-40 years. They probably live over 100 years (Castanet 1994). There is an anecdote of a male tuatara at the Southland Museum and Art Gallery first breeding when 111 years of age, but the age of this specimen is unverified. Tuataras appear to have a low optimal body temperature in comparison with other reptiles.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

It takes between 10 and 20 years for a tuatara to reach sexual maturity. The female, on average, lays between 5 and 18 eggs only once every 4 years, the longest reproductive cycle of any reptile. Mating occurs from mid-summer to early autumn (January-March) and the eggs are laid the following spring or early summer (October-December). Incubation takes from 12 to 15 months, with the development of the embryo stopping during the winter months. Thus, a hatchling tuatara would have been conceived over two years earlier. The male is devoid of any external sex organs, and copulation is achieved by a meeting of the cloacal regions in what is known as a "cloacal kiss."

Average age at sexual or reproductive maturity (male)

Sex: male:
4380 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4380 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphenodon punctatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATCTTACCTTTGCCATACAAACGCTGACTCTACTCAACCAACCACAAAGACATTGGCACCCTATATTTACTATTTGGGGCCTGAGCAGGAATAGTAGGAACCTCCCTAAGTCTACTAATCCGAGGAGAATTAAGCTATCCAGGAACACTTATAGGAAACGACCAAATCTACAACGTAATCGTAACAGCCCATGCTTTCACCATAATTTTTTTTATGGTAATACCAGTAATAATCGGGGGATTTGGAAACTGACTAATTCCATTAATAATTGGAGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCACCATCATTCCTTTTACTATTGACATCCGCCTGAACAGAAACTGGAGCAGGGACAGGATGAACCGTATACCCGCCTCTAGCAGGAAACCTGGCCCACGCAGGACCAAGCGTAGACCTAACCATTTTTTCCCTACACTTGGCTGGCGTCTCTTCAATCTTAGGAGCAATTAACTTCATCACCACAATCATTAATATAAAACCCCCAAACCAATCTCAATACCAAATACCCTTATTCATTTGATCCGTCCTAGTCACAGCAGTATTACTACTCTTATCCTTACCCGTACTAGCAGCAGGAATTACAATACTTCTAACTGACCGAAACCTAAATACTTCATTCTTTGACCCATCTGGAGGAGGAGACCCCATCCTGTACCAACACTTATTTTGATTTTTTGGCCACCCAGAAGTTTATATCTTAATCTTACCTGGATTTGGGATAATCTCACATGTAGTAACCGACTACTCAAACAAGAAAGAACCTTTCGGATACATAGGAATAGTCTGAGCAATAATTTCAATTGGATTCCTAGGCTTTATTGTATGGGCCCACCACATATTCACAGTCGGAATGGACGTAGACACACGCGCCTATTTTACATCTGCAACTATAATTATTGCCATCCCAACAGGCATTAAAGTATTTAGCTGACTAGCTACCCTATATGGAGGAATAATTAAATGAGAAGCAAGCATGCTCTGAGCCCTTGGTTTTATTTTCTTATTTACCGTAGGTGGATTAACTGGAATCATTCTAGCAAACTCATCCTTAGACATTATTCTCCACGACACTTATTACGTAGTAGCGCACTTCCACTACGTACTATCTATAGGAGCAGTATTTGCAATCATGGCTGGACTAACCCATTGATTCCCCCTCCTAACAGGATATATATTACACAAAACATGAGCAAAAGTACACTTCGCACTAACATTCATCGGAGTAAACCTAACCTTTTTCCCACAACACTTCTTAGGCCTAGCAGGAATGCCACGACGATACTCAGACTACCCAGATGCATACTCCACATGAAATACCCTATCATCTTTTGGATCACTTATCTCCTTAACAGCTATCATCATTATACTTTTTATCCTTTGAGAGGCTTTCTCTTCAAAACGAGAAGTAGACCACACAAAAATAAACTTCACAGGCTCAGAATGACTACATGGACACCCCCCACAACTACACACCAACGAAGAACCCCCTTTTATTTACCAACCACAAGAGAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphenodon punctatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Australasian Reptile & Amphibian Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Rare
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In 1895, the country of New Zealand awarded the tuatara strict legal protection. It is currently considered a CITES (Convention on the International Trade in Endangered Species) Appendix I species. This is the most restricted classification for a species. In order for a zoo to possess this species, very demanding rules must be followed, and the public display of tuataras has only recently been allowed. Access to the islands that the tuatara inhabit is strictly regulated, and for many years no tuataras have been removed from any island for any reason.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Sphenodon punctatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Not known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!