Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Biology

The sexes are separate. No breeding is observed below water temperatures of 5 °C. Breeding occurs in early spring and is synchronized with spring tides. There also exist reports of a second breeding period. In some habitats the larvae probably have a benthic development and in other places a short planktonic stage. S. armiger is a fast growing species, breeding for the first time in its second year and living for about four years. S. armiger builds a burrow system in the upper 10-15 cm of the sediment and crawls through the top layer as well. lt does not roam on the sediment surface. S. armiger is relatively tolerant to low winter temperatures. This species shows a distinct and identifiable food preference for organic detritus (Hartmann-Schröder, 1971; Wolff, 1973; Curtis, 1977; Kirkegaard, 1978; Beukerna, 1979; Fish & Fish, 1989; Bosselmann, 1991).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bristle worm Scoloplos armiger is a thin, flat, segmented worm with short 'feet'. Just like the lugworm, it eats sand. It makes horizontal tunnels in the mudflat bottom. Its body consists of 200 segments. Like many marine animals, eggs are laid in the spring and fertilized in synchronization with a spring tide.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 Scoloplos armiger reaches lengths of 12 cm with 200 or more body segments. The front region of the body is swollen and sharply pointed, giving the head a cone-shaped appearance. The eyes are not easily detectable. Gills occur dorsally from segments 9 to 17 onwards and the tip of the posterior has 2 long cirri. Scoloplos armiger is red or reddish brown in colour, and has prominent red blood vessels running down the length of the body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Scoloplos armiger is a widely spread species that was only found scarcely in the eastern coastal zone (1994-2001 period). In the same period the species was mainly distributed near the western coastal zone, the Flemish and Zeeland Banks, where the species reached a very high distribution frequency. The distribution frequency on the Zeeland Banks was remarkably lower. High densities were recorded in both periods: up to 5,000 ind./m2 (1994-2001 period).
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

S. armiger occurs in almost the entire area, except for the central part of the Oyster Ground. The polychaete is also abundant in the Wadden Sea and in almost the whole Delta area.
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic; Labrador to Massachusetts; Bering Sea to California; Central America; north Japan Sea
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Bristle worm measuring up to 120 mm long. The head part is pointed without any visible appendages. The rest of the body consists of numerous segments and can be subdivided into two regions; the central region (segment 12-22) is flattened whereas the posterior region is long and semicylindrical. Gills are present from segment 9 onwards. Colour: orange to deep red.
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

The species superficially resembles a Scolelepis. The head is pointed sharply, smooth and lacks antenna or palps. The body is thin, fragile and reaches a maximum length of 80 mm with more than 200 segments. Parapodia in the front region have simple, short lobes. Those in tail region are more complex with more prominent lobes and dorsal gills. Gills are present on the dorsal surface from about the 12th segment onward. The colour is bright orange-pink or red, with the main blood vessels clearly visible (Hartmann-Schröder, 1971; Fish & Fish, 1989; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Scoloplos armiger is found in all sediment types but prefers sediments with a median grain size of 200 to 350 µm that are enriched with mud (mud content up to 40%). The relative occurrence of the species in such sediments exceeds 50%.
  • Degraer S., J. Wittoeck, W. Appeltans, K. Cooreman, T. Deprez, H. Hillewaert, K. Hostens, J. Mees, E. Vanden Berghe & M. Vincx (2006). The macrobenthos atlas of the Belgian part of the North Sea. Belgian Science Policy. D/2005/1191/3. ISBN 90-810081-6-1. 164 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The species inhabits a wide range of sediment types, ranging from coarse to fine sand. In the study area it prefers substrates composed of fine sand. S. armiger is also known to occur in anoxic sediments and in sea grass beds (Hartmann-Schröder, 1971; Wolff, 1973; Hayward & Ryland, 1990).
  • Holtmann, S.E.; Groenewold, A.; Schrader, K.H.M.; Asjes, J.; Craeymeersch, J.A.; Duineveld, G.C.A.; van Bostelen, A.J.; van der Meer, J. (1996). Atlas of the zoobenthos of the Dutch continental shelf. Ministry of Transport, Public Works and Water Management: Rijswijk, The Netherlands. ISBN 90-369-4301-9. 243 pp.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found from the intertidal zone to 2013 m depth; prefers sea grass beds and sand, mud and gravel substrates.
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 83 specimens in 2 taxa.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 1 - 113
  Temperature range (°C): 8.794 - 13.353
  Nitrate (umol/L): 2.564 - 24.158
  Salinity (PPS): 30.381 - 33.890
  Oxygen (ml/l): 2.750 - 6.395
  Phosphate (umol/l): 0.565 - 2.064
  Silicate (umol/l): 5.723 - 29.974

Graphical representation

Depth range (m): 1 - 113

Temperature range (°C): 8.794 - 13.353

Nitrate (umol/L): 2.564 - 24.158

Salinity (PPS): 30.381 - 33.890

Oxygen (ml/l): 2.750 - 6.395

Phosphate (umol/l): 0.565 - 2.064

Silicate (umol/l): 5.723 - 29.974
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Occurs on the low shore and shallow sublittoral in fine, muddy sand, often amongst seagrasses. May be found in the lower reaches of estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scoloplos armiger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACAATATATATTATCTTCGGTGTTTGATCTGGTCTTTTAGGAACATCAATAAGAGTCCTAATTCGAACAGAACTAGGTCAACCCGGATCTCTTTTAGGAAGAGACCAACTATATAATACAATTGTTACAGCCCACGCGGTCTTAATAATTTTCTTTCTAGTAATACCTGTCCTAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAACATAAGATTCTGATTACTCCCTCCTTCTCTTATTCTTCTAGTAATATCAGCAGCAGTAGAAAAAGGAGCAGGAACAGGATGAACTGTCTACCCTCCTCTTTCAAGAAACCTGGCTCACTCAGGGCCATCAGTAGATATAGTAATTTTCTCCCTCCATCTAGCAGGAGCAAGATCAATTCTCGCATCAATCAATTTTATTACTACAGTAAAAAAACTCCGATCA---GGAGTATCCCTATCAGCTACCCCTCTATTTGTGTGATCAGTAAAAATTACAACCATTCTTCTCCTTCTTTCACTCCCAGTTTTAGCAGGAGCTATTACTATACTCCTAACAGATCGAAACCTAAACACAGCATTCTTTGATCCTTCAGGGGGAGGAGACCCAGTTCTATTCCAACACCTCTTCNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scoloplos armiger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 51
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!