Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The bristle worm Scoloplos armiger is a thin, flat, segmented worm with short 'feet'. Just like the lugworm, it eats sand. It makes horizontal tunnels in the mudflat bottom. Its body consists of 200 segments. Like many marine animals, eggs are laid in the spring and fertilized in synchronization with a spring tide.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Scoloplos armiger reaches lengths of 12 cm with 200 or more body segments. The front region of the body is swollen and sharply pointed, giving the head a cone-shaped appearance. The eyes are not easily detectable. Gills occur dorsally from segments 9 to 17 onwards and the tip of the posterior has 2 long cirri. Scoloplos armiger is red or reddish brown in colour, and has prominent red blood vessels running down the length of the body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 83 specimens in 2 taxa.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 1 - 113
  Temperature range (°C): 8.794 - 13.353
  Nitrate (umol/L): 2.564 - 24.158
  Salinity (PPS): 30.381 - 33.890
  Oxygen (ml/l): 2.750 - 6.395
  Phosphate (umol/l): 0.565 - 2.064
  Silicate (umol/l): 5.723 - 29.974

Graphical representation

Depth range (m): 1 - 113

Temperature range (°C): 8.794 - 13.353

Nitrate (umol/L): 2.564 - 24.158

Salinity (PPS): 30.381 - 33.890

Oxygen (ml/l): 2.750 - 6.395

Phosphate (umol/l): 0.565 - 2.064

Silicate (umol/l): 5.723 - 29.974
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Occurs on the low shore and shallow sublittoral in fine, muddy sand, often amongst seagrasses. May be found in the lower reaches of estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Scoloplos armiger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 51
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Scoloplos armiger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACAATATATATTATCTTCGGTGTTTGATCTGGTCTTTTAGGAACATCAATAAGAGTCCTAATTCGAACAGAACTAGGTCAACCCGGATCTCTTTTAGGAAGAGACCAACTATATAATACAATTGTTACAGCCCACGCGGTCTTAATAATTTTCTTTCTAGTAATACCTGTCCTAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAACATAAGATTCTGATTACTCCCTCCTTCTCTTATTCTTCTAGTAATATCAGCAGCAGTAGAAAAAGGAGCAGGAACAGGATGAACTGTCTACCCTCCTCTTTCAAGAAACCTGGCTCACTCAGGGCCATCAGTAGATATAGTAATTTTCTCCCTCCATCTAGCAGGAGCAAGATCAATTCTCGCATCAATCAATTTTATTACTACAGTAAAAAAACTCCGATCA---GGAGTATCCCTATCAGCTACCCCTCTATTTGTGTGATCAGTAAAAATTACAACCATTCTTCTCCTTCTTTCACTCCCAGTTTTAGCAGGAGCTATTACTATACTCCTAACAGATCGAAACCTAAACACAGCATTCTTTGATCCTTCAGGGGGAGGAGACCCAGTTCTATTCCAACACCTCTTCNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!