Overview

Distribution

Belgian Exclusive Economic Zone, Bonne Bay, Canadian part of the Arctic Ocean, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Irish Exclusive economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Hudson Bay to the Gulf of Mexico, including Cobscook Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 756 specimens in 1 taxon.
Water temperature and chemistry ranges based on 587 samples.

Environmental ranges
  Depth range (m): 0 - 267
  Temperature range (°C): -0.814 - 24.323
  Nitrate (umol/L): 0.757 - 18.777
  Salinity (PPS): 31.982 - 36.290
  Oxygen (ml/l): 3.475 - 7.362
  Phosphate (umol/l): 0.118 - 1.335
  Silicate (umol/l): 1.285 - 15.041

Graphical representation

Depth range (m): 0 - 267

Temperature range (°C): -0.814 - 24.323

Nitrate (umol/L): 0.757 - 18.777

Salinity (PPS): 31.982 - 36.290

Oxygen (ml/l): 3.475 - 7.362

Phosphate (umol/l): 0.118 - 1.335

Silicate (umol/l): 1.285 - 15.041
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Phyllodoce mucosa is prey of:
Platichthys flesus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phyllodoce mucosa preys on:
Pygospio elegans
POM

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Mucus enhances mobility: polychaete worm
 

Polychaete worms travel quickly on trails of mucus.

           
  "Phyllodoce mucosa is attracted in large numbers by dead mollusks, crabs or worms on the sediment surface. Within 10 s worms emerged to the surface, crawled as far as 15 m on mucus trails towards the carcass, sucked in tissue up to one-third of their own weight, and then quickly retreated to below the surface

"P. mucosa massively secretes mucus when crawling, and conspecifics tend to follow existing trails, sometimes forming 'roads' with several parallel trails directed towards a carcass. No interference between worms aggregating at a common food source was observed

"Presumably, P. mucosa gets some protection from the mucus it produces in masses

"High crawling speed, mucus trailing (as a mutual benefit to conspecifics leading to the food source) and the ability to locate a carcass from a distance, all may contribute to the success of P. mucosa as a carrion-feeder." (Lee et al. 2004:575-582)
  Learn more about this functional adaptation.
  • Lee CG; Huettel M; Hong JS; Reise K. 2004. Carrion-feeding on the sediment surface at nocturnal low tides by the polychaete Phyllodoce mucosa. Marine Biology. 145(3): 575-583.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyllodoce mucosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTTTATATATAATTTTTGGTATTTGATCTGGACTTCTTGGAACGTCTATAAGAATATTAATTCGTGCTGAGTTAGGGCAGCCAGGTTCTTTGTTAGGGAGTGATCAATTATATAATACAATTGTTACTGCACATGCTTTTTTAATAATTTTCTTTTTAGTTATACCAGTAATGATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATGCTTGGGGCTCCTGATATAGCTTTTCCACGATTAAATAATATGAGGTTTTGGTTATTACCTCCCTCTCTTATTATATTATTAGGATCCGCGGCAGTTGAACAGGGTGCTGGAACAGGGTGGACAGTTTATCCTCCCTTGTCTAGGAATGTTGCTCACTCAGGACCATCTGTAGATTTAGCAATTTTTTCTTTACATCTAGCTGGGGTATCTTCCATTCTTGCCTCAATTAATTTTATTACTACAGCAATAAACATACGATCTAGAGGTTTACGGCTGGAACGGGTACCATTATTTGTTTGGTCTGTTGCTATTACTGCTTTACTTCTTTTATTGTCTTTGCCTGTATTAGCGGGGGCAATTACAATATTATTAACTGATCGGAATTTAAATACGTCTTTTTTTGATCCTGCTGGAGGTGGTGATCCTATTTTATATCAACATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phyllodoce mucosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!