Overview
Distribution
Belgian Exclusive Economic Zone, Bonne Bay, Canadian part of the Arctic Ocean, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Irish Exclusive economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
ILVO macrofauna data: macrofauna monitoring on the Belgian Part of the North Sea since 1979
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=132965
-
Faulwetter, Sarah (2010). Check-list of marine Polychaeta from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=142069
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Miller, Roberta. 2011. The St. Anne de Bellevue Arctic Biological Station Collection In Museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=150285
-
Quijon, P.A. & Snelgrove, P.V.R., 2005. Polychaete assemblages of a sub-arctic Newfoundland fjord: habitat, distribution, and identification. Polar Biology, 28(7), p.495-505
http://www.marinespecies.org/polychaeta/aphia.php?p=sourcedetails&id=70377
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
Trusted
Western Atlantic: Hudson Bay to the Gulf of Mexico, including Cobscook Bay
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 756 specimens in 1 taxon.
Water temperature and chemistry ranges based on 587 samples.
Environmental ranges
Depth range (m): 0 - 267
Temperature range (°C): -0.814 - 24.323
Nitrate (umol/L): 0.757 - 18.777
Salinity (PPS): 31.982 - 36.290
Oxygen (ml/l): 3.475 - 7.362
Phosphate (umol/l): 0.118 - 1.335
Silicate (umol/l): 1.285 - 15.041
Graphical representation
Depth range (m): 0 - 267
Temperature range (°C): -0.814 - 24.323
Nitrate (umol/L): 0.757 - 18.777
Salinity (PPS): 31.982 - 36.290
Oxygen (ml/l): 3.475 - 7.362
Phosphate (umol/l): 0.118 - 1.335
Silicate (umol/l): 1.285 - 15.041
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 587 samples.
Environmental ranges
Depth range (m): 0 - 267
Temperature range (°C): -0.814 - 24.323
Nitrate (umol/L): 0.757 - 18.777
Salinity (PPS): 31.982 - 36.290
Oxygen (ml/l): 3.475 - 7.362
Phosphate (umol/l): 0.118 - 1.335
Silicate (umol/l): 1.285 - 15.041
Graphical representation
Depth range (m): 0 - 267
Temperature range (°C): -0.814 - 24.323
Nitrate (umol/L): 0.757 - 18.777
Salinity (PPS): 31.982 - 36.290
Oxygen (ml/l): 3.475 - 7.362
Phosphate (umol/l): 0.118 - 1.335
Silicate (umol/l): 1.285 - 15.041
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Associations
Known predators
Phyllodoce mucosa is prey of:
Platichthys flesus
Based on studies in:
Scotland (Estuarine)
This list may not be complete but is based on published studies.
Platichthys flesus
Based on studies in:
Scotland (Estuarine)
This list may not be complete but is based on published studies.
- Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823842
- Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284300
Trusted
Known prey organisms
Phyllodoce mucosa preys on:
Pygospio elegans
POM
Based on studies in:
Scotland (Estuarine)
This list may not be complete but is based on published studies.
Pygospio elegans
POM
Based on studies in:
Scotland (Estuarine)
This list may not be complete but is based on published studies.
- Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823842
- Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284300
Trusted
Evolution and Systematics
Functional Adaptations
Functional adaptation
Mucus enhances mobility: polychaete worm
"Phyllodoce mucosa is attracted in large numbers by dead mollusks, crabs or worms on the sediment surface. Within 10 s worms emerged to the surface, crawled as far as 15 m on mucus trails towards the carcass, sucked in tissue up to one-third of their own weight, and then quickly retreated to below the surface…
"P. mucosa massively secretes mucus when crawling, and conspecifics tend to follow existing trails, sometimes forming 'roads' with several parallel trails directed towards a carcass. No interference between worms aggregating at a common food source was observed…
"Presumably, P. mucosa gets some protection from the mucus it produces in masses…
"High crawling speed, mucus trailing (as a mutual benefit to conspecifics leading to the food source) and the ability to locate a carcass from a distance, all may contribute to the success of P. mucosa as a carrion-feeder." (Lee et al. 2004:575-582)
Learn more about this functional adaptation.
Polychaete worms travel quickly on trails of mucus.
"Phyllodoce mucosa is attracted in large numbers by dead mollusks, crabs or worms on the sediment surface. Within 10 s worms emerged to the surface, crawled as far as 15 m on mucus trails towards the carcass, sucked in tissue up to one-third of their own weight, and then quickly retreated to below the surface…
"P. mucosa massively secretes mucus when crawling, and conspecifics tend to follow existing trails, sometimes forming 'roads' with several parallel trails directed towards a carcass. No interference between worms aggregating at a common food source was observed…
"Presumably, P. mucosa gets some protection from the mucus it produces in masses…
"High crawling speed, mucus trailing (as a mutual benefit to conspecifics leading to the food source) and the ability to locate a carcass from a distance, all may contribute to the success of P. mucosa as a carrion-feeder." (Lee et al. 2004:575-582)
Learn more about this functional adaptation.
- Lee CG; Huettel M; Hong JS; Reise K. 2004. Carrion-feeding on the sediment surface at nocturnal low tides by the polychaete Phyllodoce mucosa. Marine Biology. 145(3): 575-583.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Phyllodoce mucosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 6 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGTACTTTATATATAATTTTTGGTATTTGATCTGGACTTCTTGGAACGTCTATAAGAATATTAATTCGTGCTGAGTTAGGGCAGCCAGGTTCTTTGTTAGGGAGTGATCAATTATATAATACAATTGTTACTGCACATGCTTTTTTAATAATTTTCTTTTTAGTTATACCAGTAATGATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATGCTTGGGGCTCCTGATATAGCTTTTCCACGATTAAATAATATGAGGTTTTGGTTATTACCTCCCTCTCTTATTATATTATTAGGATCCGCGGCAGTTGAACAGGGTGCTGGAACAGGGTGGACAGTTTATCCTCCCTTGTCTAGGAATGTTGCTCACTCAGGACCATCTGTAGATTTAGCAATTTTTTCTTTACATCTAGCTGGGGTATCTTCCATTCTTGCCTCAATTAATTTTATTACTACAGCAATAAACATACGATCTAGAGGTTTACGGCTGGAACGGGTACCATTATTTGTTTGGTCTGTTGCTATTACTGCTTTACTTCTTTTATTGTCTTTGCCTGTATTAGCGGGGGCAATTACAATATTATTAACTGATCGGAATTTAAATACGTCTTTTTTTGATCCTGCTGGAGGTGGTGATCCTATTTTATATCAACATCTTTTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Phyllodoce mucosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

