Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Athrycia curvinervis is endoparasitoid of larva of Orthosia gracilis

Animal / parasitoid / endoparasitoid
larva of Bactromyia aurulenta is endoparasitoid of larva of Orthosia gracilis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthosia gracilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTATATCCTCCTCTTTCATCTAATATTGCTCATGGAGGAAGATCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACTGCTTTCTTATTATTATTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTCTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orthosia gracilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orthosia gracilis

The powdered Quaker (Orthosia gracilis) is a moth of the Noctuidae family. It is found in all of Europe except the extreme North and South.Then East across the Palearctic to Northern Asia and Central Asia.O. g. pallidior (Staudinger, 1888) is described from Xinjiang in China.

Caterpillar

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 35–40 mm. Forewing in male pale grey or ochreous grey, in female dark grey, generally more or less irrorated with dark grey; orbicular and reniform stigmata with pale outlines, filled up with grey, the lower half of reniform dark grey; outer line marked by black dots on veins, the inner mostly obsolete; submarginal line ochreous or rufous, sometimes preceded by a dark shade; hindwing in male whitish, becoming grey towards termen, and blackish immediately before the pale fringe, in female wholly grey; - pallida Stph. is a whitish form with hardly any dusting; - in rosea Tutt the ground colour is flesh coloured; - rufescens Cockll is redbrown; - the Japanese form ella Btlr.[now a full species Orthosia ella] differs only in being more strongly marked , sometimes with a redbrown flush. [1] [2]

Biology[edit]

Adults are on wing from April to May.

Larva bluish green ; dorsal and subdorsallines whitish; spiracular line white, black-edged above; spiracles white with black rings.The larvae feed on Myrica gale and Salix species (including Salix repens and Salix caprea). Other recorded food plants include Thalictrum flavum, Thalictrum aquilegiifolium, Ribes nigrum, Ribes rubrum, Rubus idaeus, Filipendula ulmaria, Malus domestica, Cotoneaster, Prunus cerasus, Prunus padus, Trifolium pratense, Lysimachia vulgaris, Chrysanthemum vulgare, Artemisia absinthium, Artemisia vulgaris, Cirsium arvense and Taraxacum vulgare.[3]

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  3. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!