Overview

Brief Summary

Neanthes virens, also known as clam worm, is an annelid worm that burrows in wet sand and mud. It is classified as a polychaete in the family Nereididae. Sandworms make up a large part of the live sea-bait industry and have many distinctive traits, including often reaching great length, sometimes exceeding four feet; numerous, highly vascularized parapodia along both sides of their bodies; blue heads with two large pincer teeth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Canadian Exclusive Economic Zone [Atlantic part], Canadian part of the Arctic Ocean, Gulf of Mexico, Gulf of St. Lawrence, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Nereis (Ceratonereis) paucidentata Moore
Catalog Number: USNM 15709
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1900
Locality: Aleutian Islands, Rat Islands, Rat Island, Alaska, United States, Bering Sea, North Pacific Ocean
Depth (m): 494 to 494
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 787 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): -0.8 - 91
  Temperature range (°C): 3.272 - 11.710
  Nitrate (umol/L): 0.682 - 9.634
  Salinity (PPS): 25.730 - 33.788
  Oxygen (ml/l): 6.161 - 7.355
  Phosphate (umol/l): 0.048 - 0.817
  Silicate (umol/l): 2.362 - 6.938

Graphical representation

Depth range (m): -0.8 - 91

Temperature range (°C): 3.272 - 11.710

Nitrate (umol/L): 0.682 - 9.634

Salinity (PPS): 25.730 - 33.788

Oxygen (ml/l): 6.161 - 7.355

Phosphate (umol/l): 0.048 - 0.817

Silicate (umol/l): 2.362 - 6.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Associations

Known prey organisms

Nereis virens (Nereis virens king ragworm) preys on:
Corophium volutator
Nematoda
Phaephyceae
Enteromorpha
POM
brown algae

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Nereis virens (Nereis virens king ragworm) is prey of:
Platichthys flesus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alitta virens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTTTATATTTCATCTTCGGTATATGATCAGGCCTTCTCGGCACATCAATAAGACTATTAATTCGAGCAGAACTCGGACAGCCCGGCTCCCTTCTAGGTAGGGACCAGCTCTACAATACAATTGTAACTGCCCATGCATTTTTAATAATTTTTTTTCTAGTAATACCCGTGATAATCGGGGGGTTTGGTAACTGACTCGTCCCCTTAATGCTGGGGGCCCCAGATATGGCCTTCCCCCGATTGAATAACATAAGTTTCTGATTACTCCCCCCATCATTAACTCTTCTCTTATCAAGAGCCGCTGTAGAAAAGGGGGCAGGCACAGGTTGAACAGTATACCCCCCCCTTGCTAGAAACATTGCTCACGCCGGTCCCTCTGTTGACTTAGCTATTTTCTCCCTCCATCTAGCAGGGGTGTCATCAATCATAGGAGCGTTAAATTTCATTACAACGGTCATTAATATACGATCTAAGGGACTACGTCTAGAACGAGTACCTCTATTTGTATGATCCGTAATAATTACAGCTATTCTTCTATTACTAAGCCTTCCCGTTCTAGCCGGTGCCATTACAATACTACTAACAGACCGTAATCTAAACACCGCCTTTTTCGACCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alitta virens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alitta virens

Alitta virens (common names include sandworm and king ragworm; older scientific names including Nereis virens are still frequently used) is an annelid worm that burrows in wet sand and mud. It is classified as a polychaete in the family Nereididae .[1]

Sandworms make up a large part of the live sea-bait industry. To fulfill the needs of this industry, some sandworms are commercially grown.[2] "Sandworming", or the harvesting of sandworms from mudflats, employs over 1,000 people in Maine. As of 2006, the population of sandworms had diminished greatly over the preceding few years due in large part to overharvesting before the worms are able to reproduce by spawning.[citation needed]

Sandworms eat seaweed and microorganisms. They have many distinctive traits, including

  • often reaching great length, sometimes exceeding four feet
  • numerous, highly vascularized parapodia along both sides of their bodies
  • blue heads with two large pincer teeth, said to occasionally bite humans[citation needed]

The parapodia function both as external gills (the animal's primary respiratory surfaces), and as means of locomotion (appearing much like short legs).[citation needed]

Gallery

References

  1. ^ a b c Kristian Fauchald & Chris Glasby (2009). "Alitta virens (M. Sars, 1835)". In Kristian Fauchald. World Polychaeta database. World Register of Marine Species. Retrieved January 19, 2010. 
    * indicates a heterotypic synonym
  2. ^ De kweek van zagers op landbouwbedrijven in Zeeland
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!