Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The large range encompasses most of the eastern United States and a relatively small portion of adjacent southeastern Canada, from Maine, southern Quebec, and southern Ontario to Minnesota, extreme southern South Dakota, and eastern Colorado, and south to extreme northern Texas, southern Louisiana, the Florida panhandle, western South Carolina, and North Carolina, at elevations from sea level to around 1,675 meters (5,500 feet) (Conant and Collins 1991, Hammerson 1999, Ernst and Ernst 2003, Stebbins 2003, Gibbons and Dorcas 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The large range of this species encompasses most of the eastern United States and a relatively small portion of adjacent southeastern Canada, from Maine, southern Quebec, and southern Ontario to Minnesota, extreme southern South Dakota, and eastern Colorado, and south to extreme northern Texas, southern Louisiana, the Florida panhandle, western South Carolina, and North Carolina, at elevations from sea level to around 1,675 m (5,500 feet) (Conant and Collins 1991, Hammerson 1999, Ernst and Ernst 2003, Stebbins 2003, Gibbons and Dorcas 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Northern water snakes are found in southern Ontario and the northeastern United States from Nebraska and Kansas in the west to the Atlantic coast and as far south as North Carolina and southern Missouri.

Biogeographic Regions: nearctic (Native )

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Northern water snakes are found in southern Ontario and the northeastern United States from Nebraska and Kansas in the west to the Atlantic coast and as far south as North Carolina and southern Missouri.

Biogeographic Regions: nearctic (Native )

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: North-America
Distribution: SE Canada (Ontario, Quebec), USA (E Colorado, Nebraska, Kansas, E/N Oklahoma, Iowa, Missouri, Arkansas, SE Minnesota, Wisconsin, Illinois, Tennessee, SE Louisiana, Mississippi, Alabama, N Georgia, NW Florida, NW South Carolina, North Carolina, Kentucky, West Virginia, Virginia, Indiana, Ohio, Pennsylvania, New York, Vermont, New Hampshire, S Maine, Massachusetts, Connecticut, New Jersey, Delaware, Maryland, Michigan),   pleuralis: Florida  
Type locality: “America septentrionali”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These are dark-colored snakes, brownish, tan or grayish in appearance. The back and sides have a series of square blotches alternating with each other that may merge to form bands. Adult snakes can appear solid brown or black, especially when dry. The belly is usually white, yellowish, or orangish with dark half-moon-shaped black edges. Juveniles have reddish brown saddles on a tan, brown, or gray background. Males are usually smaller than females.

Northern water snakes are medium to large snakes, ranging from 61 to 140 cm. They range from 19 to 27.3 cm at birth.

Range length: 61 to 140 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Behler, J., F. King. 1979. The Audubon Society Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knoph, Inc..
  • Jordan, D. 1929. Manual of the Vertebrate Animals. New York: World Book Company.
  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

These are dark-colored snakes, brownish, tan or grayish in appearance. The back and sides have a series of square blotches alternating with each other that may merge to form bands. Adult snakes can appear solid brown or black, especially when dry. The belly is usually white, yellowish, or orangish with dark half-moon-shaped black edges. Juveniles have reddish brown saddles on a tan, brown, or gray background. Males are usually smaller than females.

Scales are keeled and the anal plate is divided, with 21-25 scales at midbody.

Northern water snakes are medium to large snakes, ranging from 61 to 140 cm. They range from 19 to 27.3 cm at birth.

Range length: 61 to 140 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Behler, J., F. King. 1979. The Audubon Society Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knoph, Inc..
  • Jordan, D. 1929. Manual of the Vertebrate Animals. New York: World Book Company.
  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 135 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Nerodia sipedon
Catalog Number: USNM 1350
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Lake Huron, County Undetermined, Michigan, United States, North America
  • Holotype: Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 41.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Habitats include creeks, rivers, canals, lakes, oxbows, ponds, reservoirs, marshes, bogs, and swamps. This snake usually inhabits freshwater but also occurs in brackish and saltwater habitats in some areas (Ernst and Ernst 2003, Gibbons and Dorcas 2004). It frequents sunny areas, especially piles of flood-deposited debris, logs, or rocks, at the water's edge. Hibernation sites often are in burrows, among rocks, or in deep crevices, at the water's edge or in uplands near water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitats include creeks, rivers, canals, lakes, oxbows, ponds, reservoirs, marshes, bogs, and swamps; this snake usually inhabits freshwater but also occurs in brackish and saltwater habitats in some areas (Ernst and Ernst 2003, Gibbons and Dorcas 2004). It frequents sunny areas, especially piles of flood-deposited debris, logs, or rocks, at the water's edge. Hibernation sites often are in burrows, among rocks, or in deep crevices, at the water's edge or in uplands near water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern water snakes utilize many different aquatic habitats, such as: rivers, streams, sloughs, lakes, ponds, bogs, marshes, and impoundments. They prefer open areas that provide many spots for them to bask in the sun and relatively still waters. They may move onto land, especially the juveniles, but they never go to far from the aquatic environment. When they are not basking or searching for prey items they can be found beneath flat rocks, logs, boards or other types of cover. Northern water snakes are the most common snakes near water sources throughout northeastern North America.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern water snakes utilize many different aquatic habitats, such as: rivers, streams, sloughs, lakes, ponds, bogs, marshes, and impoundments. They prefer open areas that provide many spots for them to bask in the sun and relatively still waters. They may move onto land, especially the juveniles, but they never go to far from the aquatic environment. When they are not basking or searching for prey items they can be found beneath flat rocks, logs, boards or other types of cover. Northern water snakes are the most common snakes near water sources throughout northeastern North America.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feed opportunistically on fishes and amphibians; sometimes eats invertebrates and small mammals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern water snakes are carnivores and scavengers. They eat a variety of prey items, including lissamphibia (adults and tadpoles), actinopterygii (alive or dead), Decapoda, large insecta, Hirudinea, other serpentes, Testudines, aves, and small mammalia such as peromyscus leucopus. They have been known to herd schools of fish or tadpoles to the edge of bodies of water where they can prey upon many at one time. Northern water snakes hunt both during the day and at night. They are not constrictors, they simply swallow their prey alive.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern water snakes are carnivores and scavengers. They eat a variety of prey items, including amphibians (adults and tadpoles), fish (alive or dead), crayfish, large insects, leeches, other snakes, turtles, birds, and small mammals such as white-footed mice. They have been known to herd schools of fish or tadpoles to the edge of bodies of water where they can prey upon many at one time. Northern water snakes hunt both during the day and at night. They are not constrictors, they simply swallow their prey alive.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Northern water snakes control the populations of their primary prey, including fish, amphibians, and other reptiles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern water snakes often escape predators by swimming off across a body of water or by diving below the surface, where they anchor themselves to vegetation or logs. They usually remain submerged for about 5 minutes but are capable of remaining below water for an hour and a half.

When confronted, northern water snakes flatten their bodies and jaws and begin to strike and bite ferociously. They also release a foul-smelling musk and may defecate to discourage predators. When extremely agitated they will also regurgitate their last meal. Northern water snakes are preyed on by large snakes, such as lampropeltis and coluber, and by procyon lotor, Mephitinae, and canidae.

Known Predators:

  • large snakes (Serpentes)
  • raccoons (Procyon_lotor)
  • skunks (Mephitinae)
  • foxes (Canidae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Northern water snakes control the populations of their primary prey, including fish, amphibians, and other reptiles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern water snakes often escape predators by swimming off across a body of water or by diving below the surface, where they anchor themselves to vegetation or logs. They usually remain submerged for about 5 minutes but are capable of remaining below water for an hour and a half.

When confronted, northern water snakes flatten their bodies and jaws and begin to strike and bite ferociously. They also release a foul-smelling musk and may defecate to discourage predators. When extremely agitated they will also regurgitate their last meal. Northern water snakes are preyed on by large snakes, such as milk snakes and racers, and by raccoons, skunks, and foxes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Nerodia sipedon preys on:
Pimephales notatus
Chelydra serpentina

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Adult population size is unknown but probably exceeds 1,000,000. This snake is abundant in most areas of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Movements may exhibit great individual variation; in Wisconsin, individuals moved over an area of > 15 hectares (usually much less) during spring-summer (Tiebout and Cary 1987).

If captured by hand, northern water snakes may release voluminous fluid from the vent, including the malodorous secretions from the cloacal sacs, and they usually bite, often drawing blood with the sharp teeth. Adults have high endurance and may expend considerable energy in fleeing or defending themselves.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Northern water snakes probably communicate with each other primarily through touch and smell. They also use their sense of sight and detection of vibrations to locate prey.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Northern water snakes probably communicate with each other primarily through touch and smell. They also use their sense of sight and detection of vibrations to locate prey.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Northern water snakes are inactive during cold winter months in the north, where most activity occurs from March-April through October.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Northern water snakes have been known to live up to 9 years and 7 months in captivity. Their lifespan in the wild is unknown.

Range lifespan

Status: captivity:
115 (high) months.

Average lifespan

Status: captivity:
9.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Northern water snakes have been known to live up to 9 years and 7 months in captivity. Their lifespan in the wild is unknown.

Range lifespan

Status: captivity:
115 (high) months.

Average lifespan

Status: captivity:
9.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship and mating occur in spring (generally late April to early June. Reproductive females give birth to up to several dozen young usually from August to October in the north, primarily in July or August in the southern part of the range. Females sexually mature in 2-3 years (Vogt 1981). Females may not breed every year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: polygynous

Male northern water snakes are able to reproduce when they are 21 months old. Female snakes begin to breed when they are three years old and produce a single litter each year. Most reproduction occurs while in or near their hibernation sites between mid-April and mid-June. Temperature and latitude may cause variation in these times.

Gestation can last anywhere from 3 to 5 months. Young snakes are born alive (not laid as eggs) from July to September. The litter ranges in size from 4 to 99 offspring. Larger females tend to have larger litters.

Breeding interval: Northern water snakes mate once yearly

Breeding season: April to June

Range number of offspring: 4 to 99.

Range gestation period: 3 to 5 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 21 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; ovoviviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Female northern water snakes nurture and protect their young before they are born. Young water snakes become independent at birth, and are capable of hunting and caring for themselves.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: The University of Michigan Press.
  • Bauman, M., D. Metter. 1977. Reproductive cycle of the northern water snake, Nerodia sipedon (Reptilia, Serpentes, Colubridae). Journal of Herpetology, 11(1): 51-59.
  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: polygynous

Male northern water snakes are able to reproduce when they are 21 months old. Female snakes begin to breed when they are three years old and produce a single litter each year. Most reproduction occurs while in or near their hibernation sites between mid-April and mid-June. Temperature and latitude may cause variation in these times.

During breeding, a male comes along side a female and rubs his chin along her back, occasionally giving a spasmodic jerk. He then twines his tail around hers and brings the cloacal openings into contact. Usually only one male copulates with a single female; on occasion there may be two.

Gestation can last anywhere from 3 to 5 months. Young snakes are born alive (not laid as eggs) from July to September. The litter ranges in size from 4 to 99 offspring. Larger females tend to have larger litters.

Breeding interval: Northern water snakes mate once yearly

Breeding season: April to June

Range number of offspring: 4 to 99.

Range gestation period: 3 to 5 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 21 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; ovoviviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Female northern water snakes nurture and protect their young before they are born. Young water snakes become independent at birth, and are capable of hunting and caring for themselves.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: The University of Michigan Press.
  • Bauman, M., D. Metter. 1977. Reproductive cycle of the northern water snake, Nerodia sipedon (Reptilia, Serpentes, Colubridae). Journal of Herpetology, 11(1): 51-59.
  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Nerodia sipedon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Nerodia sipedon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTACCTGTGTTTATCACTCGTTGACTTTTCTCAACAAACCACAAAGATATCGGAACCCTATACCTACTGTTCGGGGCCTGATCCGGACTAATTGGGGCCTGCCTTAGCATGCTAATGCGAATAGAGCTAACACAACCCGGGTCCTTATTCGGAAGCGACCAGATCTTTAATGTCCTAGTCACAGCCCATGCATTCATCATAATCTTCTTCATAGTAATACCAATTATGATCGGCGGTTTTGGAAACTGATTAATCCCACTTATAATCGGGGCCCCAGACATAGCCTTCCCACGTATGAACAATATAAGCTTCTGACTACTTCCACCAGCACTTCTCCTGCTCCTGTCTTCCTCTTATGTAGAAGCCGGTGCTGGCACCGGCTGAACAGTCTACCCACCACTCTCGGGGAACCTGGTACACTCAGGCCCCTCAGTGGACCTGGCAATCTTCTCCCTACATCTAGCAGGAGCCTCGTCCATCCTGGGAGCAATCAACTTTATCACAACATGTGTTAACATAAAACCAAAATCCATACCAATATTTAATATCCCCTTGTTCGTTTGGTCAGTCCTAATTACAGCCATTATACTACTGTTAGCCCTACCAGTACTAGCGGCAGCAATTACCATGTTACTAACCGACCGAAACATCAACACCTCATTTTTCGACCCTTGTGGAGGCGGAGACCCGGTTTTATTCCAACACCTGTTCTGATTTTTTGGCCACCCAGAAGTATATATTCTTATCCTACCCGGATTCGGCATTATTTCAAGCATCATCACTTTCTACACCGGAAAGAAAAATACATTTGGGTACACAAGCATAATTTGAGCAATGATATCCATCGCAATCCTAGGTTTTGTAGTATGAGCACATCACATATTTACAGTTGGCCTAGATATTGACAGTCGAGCCTATTTCACAGCCGCAACAATAATCATCGCAATTCCAACCGGAATTAAAGTATTTGGCTGACTCGCCACTCTAACAGGCGGAAAAGTCAAATGGCAAACCCCAATCTACTGAGCCCTAGGGTTCATCTTCCTCTTTACCGTTGGAGGAATAACCGGAATCATCCTAGCAAACTCATCACTTGATATCGTCCTACACGATACCTATTATGTTGTAGCACACTTCCACTACGTACTCTCCATGGGAGCCGTTTTTGCCATCATGGGAGGACTAACACACTGATTTCCACTATTCACAGGATACACACTTAATCAAACCATAACAAAAACCCAATTCTGAGTGATATTTATCGGGGTTAACATGACATTCTTCCCACAACATTTTTTAGGCCTGTCTGGCATACCACGACGATACTCAGACTTCCCAGACGCCTTCACTCTGTGAAACACCATCTCATCAATCGGGTCAACTATTTCTATGGTAGCAGTACTAATATCATTATTTATCGTATGAGAAGCGCTCACATACAAGCGGGAACTCCAACCATCACTTGGAAAAAAAACACATGTTGAGTGATTCTACGGAACACCACCCCCATACCACACCCACACAGAACCAACATTCATACTAAACAACTCATACGCCCCTATCCGAAATCTAATCACCTATATAGAATGACCTTGACCCGAGAAGAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern water snakes are abundant throughout their range.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern water snakes are abundant throughout their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences (subpopulations). The adult population size is unknown but probably exceeds 1,000,000. This snake is abundant in most areas of its range. The extent of occurrence, area of occupancy, number of subpopulations, and population size are probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: No major threats are known. This snake tolerates a good deal of habitat alteration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known. This snake tolerates a good deal of habitat alteration.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Many occurrences are in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Northern water snakes could potentially be a problem for fish hatcheries and fish farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Contrary to popular belief, northern water snakes are quite beneficial to fish populations. They feed on diseased and dying fish and help to control areas where overpopulation may exist and could stunt fish growth. This may actually help the sport fishing industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Northern water snakes could potentially be a problem for fish hatcheries and fish farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Contrary to popular belief, northern water snakes are quite beneficial to fish populations. They feed on diseased and dying fish and help to control areas where overpopulation may exist and could stunt fish growth. This may actually help the sport fishing industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern water snake

The northern water snake (Nerodia sipedon) is a species of large, nonvenomous, common snake in the Colubridae family that is native to North America.

Geographic range[edit]

It is found throughout eastern and central North America, from southern Ontario and southern Quebec in the north, to Texas and Florida in the south.[2] It has been introduced in California where it is considered an invasive species likely to compete with native giant garter snakes Thamnopis gigas.[3]

Behavior[edit]

Northern water snake basking west of Ottawa, Ontario

They are active during the day and at night. They are most often seen basking on rocks, stumps, or brush. During the day, they hunt among plants at the water's edge, looking for small fish, frogs, worms, leeches, crayfish, salamanders, small birds and mammals. At night, they concentrate on minnows and other small fish sleeping in shallow water. The Lake Erie water snake subspecies, Nerodia sipedon insularum, was once endangered, but now benefits from the introduction of the round goby, an invasive species, which now comprises up to 90% of its diet.

The Northern Water Snake is extremely common over most of its range and is frequently seen basking on stream banks, from which it dives into the water at the slightest disturbance. It is quick to flee from danger, but if cornered or captured, it usually will not hesitate to defend itself. Large specimens can inflict a painful bite.

Subspecies[edit]

Ordered alphabetically.[1]

Description[edit]

The northern water snake can grow up to 135 cm (4.4 ft) in total length.[4] They can be brown, gray, reddish, or brownish-black. They have dark crossbands on their necks and dark stripes and blotches on the rest of their bodies, often leading to misidentification as cottonmouths or copperheads by novices. They darken as they age. Some will become almost completely black. The belly of this snake also varies in color. It can be white, yellow, or gray. Usually it also has reddish or black crescents.

Reproduction[edit]

Northern water snakes mate from April through June. They are ovoviviparous (live-bearers), which means they do not lay eggs like many other snakes. Instead, the mother carries the eggs inside her body and gives birth to free living young, each one 19–23 cm (7.5–9.1 in) long.[5] A female may have as many as thirty young at a time, but the average is eight. They are born between August and October. Mothers do not care for their young; as soon as they are born, they are on their own.

Defense against predators[edit]

Northern water snakes have many predators, including birds, raccoons, opossums, foxes, snapping turtles, and other snakes. They defend themselves vigorously when they are threatened. If they are picked up by an animal, or person, they will bite repeatedly, as well as release excrement and musk. Their saliva contains a mild anticoagulant, which can cause the bite to bleed more but poses little risk to humans.[citation needed]

Hibernation[edit]

Northern water snakes often share winter dens with copperheads and black rat snakes.[citation needed]

Habitats[edit]

Muskrat houses and beaver lodges are good places to find water snakes, which like to hide among the sticks and plant stems. They live near lakes, ponds, marshes, rivers, and canals; just about anywhere there is freshwater.[citation needed]

The Lake Erie water snake subspecies (Nerodia sipedon insularum), which occurs mainly on the lake's western islands offshore from Ohio and Ontario, recovered to the point where on August 16, 2011 the U.S. Fish and Wildlife Service removed it from the Federal List of Endangered and Threatened Wildlife. The subspecies was first listed as threatened in 1999 after a decline due to eradication by humans, as well as habitat loss and degradation. When initially listed, the subspecies’ population had dropped to only 1,500 adults. Endangered Species Act (ESA) protections for the snake included designation of 300 acres of inland habitat and 11 miles of shoreline for breeding grounds. Ironically, the introduction of an invasive species, the Eurasian round goby (Neogobius melanostomus) into Lake Erie in the mid-1990s became a new food source for the Lake Erie water snake. By 2009, the population recovered to 11,980 snakes, safely exceeding the population minimum goal of 5,555 adult snakes required by the 2003 recovery plan. Monitoring will occur for 5 years following this delisting. The Lake Erie water snake is just the 23rd species to be removed from the list due to recovery.[6]

Gallery[edit]

References[edit]

  1. ^ a b Nerodia sipedon, The Reptile Database.
  2. ^ Schmidt, K.P., and D.D. Davis. 1941. Field Book of Snakes of the United States and Canada. G.P. Putnam's Sons. New York. 365 pp. (Natrix sipedon, pp. 219-222, Figure 22. (map) + Plate 24 on p.344.)
  3. ^ Rose, Jonathan P.; Miano, Oliver J; Todd, Brian D. (2013). "Trapping Efficiency, Demography, and Density of an Introduced population of Northern Watersnakes, Nerodia sipedon, in California". Journal of Herpetology 47 (3): 421–427. doi:10.1670/12-119. 
  4. ^ Northern water snake, Canadian Biodiversity.
  5. ^ Conant, Roger. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America, Second Edition. Houghton Mifflin. Boston. 429 pp. ISBN 0-395-19977-8 (paperback). (Natrix sipedon, pp. 144-146 + Plate 20 + Map 99.)
  6. ^ Endangered and Threatened Wildlife and Plants; Removal of the Lake Erie water snake (Nerodia sipedon insularum) From the Federal List of Endangered and Threatened Wildlife (Report). 2011-08-16. http://www.gpo.gov/fdsys/pkg/FR-2011-08-16/pdf/2011-20104.pdf. Retrieved 2011-09-03.

Further reading[edit]

  • Conant, R., and W. Bridges. 1939. What Snake Is That? A Field Guide to the Snakes of the United States East of the Rocky Mountains. D. Appleton-Century. New York and London. Frontispiece map + viii + 163 pp. + Plates A-C, 1-32. (Natrix sipedon sipedon, pp. 98-101 + Plate 18, Figure 51.)
  • Holbrook, J.E. 1842. North American Herpetology; or, A Description of the Reptiles Inhabiting the United States. Vol. IV. J. Dobson. Philadelphia. 138 pp. + Plates I.- XXXV. (Tropidonotus sipedon, pp. 29-31 + Plate VI.)
  • Linnaeus, C. 1758. Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, diferentiis, synonymis, locis. Tomus I. Editio Decima, Reformata. L.Salvius. Stockholm. 824 pp. (Coluber sipedon, p. 219.)
  • Morris, P.A. 1942. Boy's Book of Snakes: How to Recognize and Understand Them. A volume of the Humanizing Science Series edited by Jacques Cattell. Ronald Press. New York. viii + 185 pp. ("Common Water Snake", pp. 78-81, 180.)
  • Smith, H.M., and E.D. Brodie, Jr. 1982. Reptiles of North America: A Guide to Field Identification. Golden Press. New York. 240 pp. ISBN 0-307-13666-3 (paperback). (Nerodia sipedon, pp. 156-157.)
  • Wright, A.H., and A.A. Wright. 1957. Handbook of Snakes of the United States and Canada. Comstock. Ithaca and London. 1,105 pp. (in 2 volumes) (Natrix sipedon sipedon, pp. 510-514, Figure 150, Map 42.)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Northern Water Snake

The Northern Water Snake (Nerodia sipedon) is a large, nonvenomous, well-known snake in the Colubridae family that is native to North America. They are active during the day and at night. They are most often seen basking on rocks, stumps, or brush. During the day, they hunt among plants at the water's edge, looking for small fish, frogs, worms, leeches, crayfish, salamanders, small birds and mammals. At night, they concentrate on minnows and other small fish sleeping in shallow water. The Lake Erie Water Snake subspecies, Nerodia sipedon insularum, was once endangered, but now benefits from the introduction of the round goby, an invasive species, which now comprises up to 90 per cent of its diet.

Contents

Subspecies

Ordered alphabetically.[1]

Characteristics

The Northern Water Snake can grow up to 135 cm (4.4 ft) long.[2] They can be brown, gray, reddish, or brownish-black. They have dark crossbands on their necks and dark stripes and blotches on the rest of their bodies, often leading to misidentification as cottonmouths or copperheads by novices. They darken as they age. Some will become almost completely black. The belly of this snake also varies in color. It can be white, yellow, or gray. Usually it also has reddish or black crescents. These snakes have been known to strike at humans when provoked.

Mating

Northern Water Snakes mate from April through June. They are ovoviviparous (live-bearers), which means they do not lay eggs like most snakes. Instead, they carry them inside their bodies and give birth to baby snakes, each one 19–23 cm (7.5–9.1 in) long.[3] A female may have as many as thirty young at a time. Babies are born between August and October. Mothers do not care for their young; as soon as they are born, they are on their own.

Defense against predators

Northern Water Snakes have many predators, including birds, raccoons, opossums, foxes, snapping turtles, and other snakes. They defend themselves vigorously when they are threatened. If they are picked up by an animal, or person, they will bite repeatedly, as well as release excrement and musk. Their saliva contains a mild anticoagulant, which can cause the bite to bleed more but poses little risk to humans.

Hibernation

Northern Water Snakes often share winter dens with copperheads and black rat snakes.

Habitats

Muskrat houses and beaver lodges are good places to find water snakes, which like to hide among the sticks and plant stems. They live near lakes, ponds, marshes, rivers, and canals; just about anywhere there is freshwater.

Gallery

Sources

  1. ^ Nerodia sipedon, The Reptile Database
  2. ^ Northern Water Snake, Canadian Biodiversity
  3. ^ Conant, Roger. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America. Houghton Mifflin. Boston.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in genus Natrix.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!