Molecular Biology and Genetics
Molecular Biology
Barcode data: Tholera decimalis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCATTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCATCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCTTCAATCTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTACTTTTATCTTTACCTGTTTTAGCGGGAGCTATTACTATACTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Tholera decimalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Tholera decimalis
The Feathered Gothic (Tholera decimalis) is a species of moth of the family Noctuidae. It is found in Western Europe and Scandinavia.
The wingspan is 38–48 mm. The moth flies from August to September depending on the location.
The larvae feed on various grasses. .[1]
References
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
