Molecular Biology and Genetics

Molecular Biology

Barcode data: Tholera decimalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTGACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCATTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCATCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCTTCAATCTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTACTTTTATCTTTACCTGTTTTAGCGGGAGCTATTACTATACTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tholera decimalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tholera decimalis

The Feathered Gothic (Tholera decimalis) is a species of moth of the family Noctuidae. It is found in Europe and Scandinavia then through the Palearctic to Asia minor, Western Central Asia, Southern Siberia and in North Africa.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 38–48 mm.Forewing olive fuscous tinged with purple;all the veins white; inner and outer lines double, black; submarginal whitish, preceded by black wedgeshaped spots ; claviform stigma of the ground colour outlined with whitish and black and with a pale linear centre; upper stigmata white-ringed with olive centres, reniform with a curved pale line at centre; wing in male dull white with fuscous termen, in female wholly fuscous with base alone paler; — ab. hilaris Stgr. is smaller and paler, the hindwing of male whitish.[1]

Biology[edit]

The moth flies from August to September depending on the location.

Larva shining bronzy brownish, with the tubercles large and black; head and thoracic plate dark brown. The larvae feed at the roots of various grasses, living through the winter and feeding up in summer. .[2]

Steppe, grassy hillsides, gardens and meadows and pastures are the main habitat.

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!