Overview

Comprehensive Description

General Description

A large Pyralid with narrow, dark brown forewings and light brown hindwings. The orbicular, reniform and claviform areas are dark while the subterminal space is strigose. The wingspan ranges from 24-35 mm. The size, short labial palps, dark brown forewings with dark areas, and strigose subterminal area make this species easy to identify.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Munroe (1973) divided the genus Nomophila into 12 distinct species of which one, Nomophila nearctica, was limited to North America (Goater 1986). Common to abundant in eastern North America, sometimes migrating to the far north (Covell 1984), also widespread in western North America. Reported from Areas 7 (Lloydminster), 10 (Edmonton) and 20 (Nordegg) in Alberta by Bowman (1951) as Nomophila noctuella Dyar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Widespread.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larvae feed on a wide variety of plants, including grasses, Polygonum and sweet clover (Covell 1984).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Nomophila nearctica in Illinois

Nomophila nearctica Monroe: Pyralidae, Lepidoptera
(observations are from Robertson; this is the Lucerne Moth; Robertson misidentified this moth as Nomophila noctuella Dennis & Schiffermüller, which is found in Eurasia)

Asteraceae: Euthamia graminifolia sn (Rb); Scrophulariaceae: Veronicastrum virginicum sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

April to October, the early individuals being worn and these appear to have come up from the south.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Adults are diurnal and come to light at night.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nomophila nearctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTCTTATATTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATTGCTCATGGAGGAAGATCAGTAGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGGGCTATCAATTTTATTACAACAATTATTAATATACGAATTAATGGATTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCTTTACTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCAATTACAATATTACTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nomophila nearctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 95
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common and of no concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species is also known as Celery Stalkworm Moth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!