Molecular Biology and Genetics

Molecular Biology

Barcode data: Naenia typica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCTTTAATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTCTGACTTTTACCTCCTTCATTAACTCTTTTAATTTCAAGTAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTCTCATCTAATATTGCCCATGGAGGAAGTTCTGTAGATTTAGCTATTTTTTCACTTCACTTAGCTGGAATTTCTTCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGACTTTCCTTTGATCAAATACCATTATTTATTTGAGCAGTAGGAATCACTGCATTTTTATTATTACTATCTTTACCTGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAACACATCTTTTTTTGATCCAGCAGGAGGGGGAGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Naenia typica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gothic (moth)

The Gothic (Naenia typica) is a moth of the family Noctuidae. It is distributed in temperate Eurasia, in the Palearctic ecozone, including Europe, Turkey, Iran, Caucasus, Armenia, Transcaucasia, Central Asia, Altai mountains, and west and central Siberia.

This species has a wingspan of 36 to 46 mm. The forewings are broader than those of most other noctuids, and blackish with a network of fine white lines. The pattern is supposedly reminiscent of some elements of Gothic architecture. The hindwings are grey. The species flies at night in June and July in the British Isles. It sometimes comes to light but is not generally strongly attracted. By contrast, it is strongly attracted to sugar and flowers.

The larva is greyish-brown with dark lines along the side and blackish markings at the hind end. It is gregarious when young. It is polyphagous, feeding on a wide range of plants, such as burdock, Artemisia, mustards, Buddleja, marigold, chrysanthemum, hawthorn, Cyclamen, silverberry, fireweed, forsythia, hop, lettuce, Lepisanthes, apple, Parthenocissus, plantain, Prunus, pear, rhododendron, willow, spinach, dandelion, coltsfoot, and nettle.[1] This species overwinters as a larva.

Notes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!