Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Biology

As an adaptation to their harsh desert environment, Gila monsters spend a large proportion of their time underground in burrows, hibernating during the winter and sheltering from the midday sun in the scorching summer months. The lizards emerge from hibernation in spring and the majority of their activity occurs in the following three-month period (3). Mating may takes place from April to June (9); males 'wrestle' to assert dominance (3). Females then lay their clutch of up to 12 eggs in late June or August (6). Eggs are laid in depressions dug into the soil and unusually remain incubating underground throughout the winter, hatching the following spring (4). In springtime, Gila monsters are active during the day, although they are mainly above ground in the morning and late afternoon to avoid the midday heat (3). These lizards feed on eggs, young birds and rodents, as well as lizards; juveniles are able to consume over 50% of their body weight at one time (4). Gila monsters are able to survive for months without food as they store fat in their particularly large tail (3). The infamous venomous bite of the Gila monster is used as a defensive measure rather than to attack prey. If threatened, these lizards will back away hissing with their mouth open, and if provoked they attack surprisingly quickly with a bite that can be extremely painful to humans, although it is rarely life-threatening (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Gila monster is the largest lizard in the United States (3), and one of the few species of venomous lizard in the world (4) (5). It has a stocky body with a large head and a short, fat tail (6). The skin consists of many round, bony scales, a feature that was common amongst the dinosaurs but is unusual in today's reptiles (3). Gila monsters have a striking bright pink and black colouration (6) and the two subspecies can be distinguished by their different patterns; the banded Gila monster (Heloderma suspectum cinctum) has a band of light markings along the back whilst in the reticulated Gila monster (H. s. suspectum) these light marks are joined in a network (3). With their venomous bite and elusive nature, these lizards have inspired many myths over the centuries (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Gila Monster occurs in southwestern United States and northwestern Mexico. It ranges from extreme southwestern Utah, southern Nevada, and adjacent southeastern California south through southern Arizona, southwestern New Mexico, and much of Sonora to extreme northern Sinaloa, Mexico (Stebbins 2003). The core of the range is in Arizona and Sonora. Its elevational range extends from near sea level in Sonora and 30 m in Arizona to at least 1,545 m in southeastern Arizona (Lowe et al. 1986), and 1,180 to 1,950 m in New Mexico (Degenhardt et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Gila monster ranges from the extreme southwestern Utah, southern Nevada, and adjacent San Bernadino County, California, southeastrward through west and south Arizona and southwestern New Mexico. It ranges south into Mexico through Sonora to northwestern Sinaloa. It ranges from sea level to 1,500 meters in altitude. (Ernst, 1992)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The Gila monster ranges from extreme southwestern Utah, southern Nevada, and adjacent southeastern California south through southern Arizona, southwestern New Mexico, and much of Sonora to Sinaloa, Mexico (Stebbins 2003). The core of the range is in Arizona and Sonora. Elevational range extends from near sea level in Sonora and 30 m in Arizona to at least 1,545 m in southeastern Arizona (Lowe et al. 1986); 1,180-1,950 meters in New Mexico (Degenhardt et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: USA (SE California, S Nevada, SW Utah, Arizona, New Mexico),  Mexico (Sonora)  
Type locality: Sierra de la Unión, “Sonora” (= Arizona)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The majority of the Gila monster's range is in western and southern Arizona, south to southern Sonora in Mexico, although populations are also found in restricted areas of California, Nevada, Utah and New Mexico (6). Of the subspecies, the banded Gila monster occupies the northern extent of the species' range (3). The name 'Gila monster' is derived from the Gila River Basin in Arizona, part of this species' range (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This is one of only two venomous lizard species in the world (the other is the Mexican beaded lizard, Heloderma horridum). Gila monsters are large and stout lizards with a short fat tail (maximum length of 56 centimeters). Their scales are beaded yellow, pink, and black. The broad head, chin, and neck are black, as well as the legs and feet. The black eyes have a round pupil. The ear opening is a narrow oblique or ovoid slit. The limbs of the lizard are stout and have heavy claws. (Ernst, 1992)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 61 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from other U.S. lizards in large size and bulk, beadlike dorsal scales, and bold dorsal pattern of black and yellow, orange, or pink. Differs from the similar H. HORRIDUM of Mexico as follows: tail length less than 55% of snout-vent length (vs. at least 65%); 48-62 scales in longitudinal midline from vent to tip of tail (vs. 74-87); dorsal coloration includes yellowish, orange, or pink (vs. black with or without yellow). See Campbell and Lamar (1989) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Lectotype; Syntype for Heloderma suspectum
Catalog Number: USNM 2971
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1858
Locality: Sierra de la Union (= Sierra de Moreno on the boundary between United States and Mexico), Pima, Arizona, United States, North America
  • Lectotype: Bogert, C. M. & del Campo, R. M. 1956. Bull. Amer. Mus. Nat. Hist. 109 (1): 35.; Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 21: 5.; Syntype: Bogert, C. M. & del Campo, R. M. 1956. Bull. Amer. Mus. Nat. Hist. 109 (1): 35.; Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 21: 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Heloderma suspectum
Catalog Number: USNM 564957
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1858
Locality: Sierra de la Union (= Sierra de Moreno on the boundary between United States and Mexico), Pima, Arizona, United States, North America
  • Paralectotype: Bogert, C. M. & del Campo, R. M. 1956. Bull. Amer. Mus. Nat. Hist. 109 (1): 35.; Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 21: 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Heloderma suspectum
Catalog Number: USNM 564956
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: ; Juvenile
Preparation: Ethanol
Year Collected: 1858
Locality: Sierra de la Union (= Sierra de Moreno on the boundary between United States and Mexico), Pima, Arizona, United States, North America
  • Paralectotype: Bogert, C. M. & del Campo, R. M. 1956. Bull. Amer. Mus. Nat. Hist. 109 (1): 35.; Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 21: 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occupied vegetation types include desert grassland, Mohave and Sonoran desert scrub, and thorn scrub (Sonora); less often oak or pine-oak woodland. In Mexico, it occurs on lower mountain slopes and adjacent plains and beaches (Stebbins 2003), sometimes in irrigated areas. Canyon bottoms, arroyos (dry creeks), and rocky slopes may support relatively dense populations in some parts of Arizona and Sonora. In southern Arizona, the Gila Monster is more abundant in wetter and rockier palo verde-sahuaro desert than in drier and sandier creosote-bursage desert, where it occurs mainly in or near rocky buttes or mountains (Lowe et al. 1986). In New Mexico, the species is most commonly associated with desert scrub vegetation in rocky regions of mountain foothills and canyons; sometimes it is found along the lower fringes of pinyon-juniper woodland or oak woodland; rarely encountered in agricultural areas (Degenhardt et al. 1996). Gila monsters are mainly terrestrial but infrequently climb into vegetation. Refuges include spaces under rock, dense shrubs, burrows, or woodrat nests. Sub-surface shelters are important components of the habitat, and certain ones are used with a high degree of fidelity (particularly in winter), sometimes by multiple individuals concurrently (Beck and Jennings 2003). In Arizona, Gila monsters spend about 98% of the year under cover (Lowe et al. 1986). In Utah, individuals spent over 95% of active season underground; occasionally they basked near shelters in spring; shelters were burrows or crevices in rocky areas; hibernacula faced south (Beck 1990).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Gila monster can be found in arid areas. These areas usually contain scattered cacti, shrubs, mesquite, and grasses. Rocky slopes, arroyos, and canyon bottoms (mainly those with streams) support populations in Arizona. (Ernst, 1992)

Terrestrial Biomes: desert or dune

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Occupied vegetation types include desert grassland, Mohave and Sonoran desert scrub, and thorn scrub (Sonora); less often oak or pine-oak woodland. In Mexico, it occurs on lower mountain slopes and adjacent plains and beaches (Stebbins 2003), sometimes in irrigated areas. Canyon bottoms, arroyos, and rocky slopes may support relatively dense populations in some parts of Arizona and Sonora. In southern Arizona, the Gila monster is more abundant in wetter and rockier palo verde-sahuaro desert than in drier and sandier creosote-bursage desert, where it occurs mainly in or near rocky buttes or mountains (Lowe et al. 1986). In New Mexico, the species is most commonly associated with desert scrub vegetation in rocky regions of mountain foothills and canyons; sometimes it is found along the lower fringes of pinyon-juniper woodland or oak woodland; rarely encountered in agricultural areas (Degenhardt et al. 1996). Gila monsters are mainly terrestrial but infrequently climb into vegetation. Refuges include spaces under rock, dense shrubs, burrows, or woodrat nests. Sub-surface shelters are important components of the habitat, and certain ones are used with a high degree of fidelity (particularly in winter), sometimes by multiple individuals concurrently (Beck and Jennings 2003). In Arizona, Gila monsters spend about 98% of the year under cover (Lowe et al. 1986). In Utah, individuals spent over 95% of active season underground; occasionally they basked near shelters in spring; shelters were burrows or crevices in rocky areas; hibernacula faced south (Beck 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits dry desert scrub and rocky mountain foothills up to 1,500 metres above sea level (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate locally (usually less than 1 km) between highland winter retreat and lowland summer habitat (Lowe et al. 1986).

May travel up to several hundred meters in one day but typically much less. In northwestern Arizona, moved an average of 26 m per day in April-May, 3 m per day in June-July (Jones 1983). In Utah, 27 individuals (including only one immature) were observed in an area of 2 sq km over 3 years; home ranges of 3 individuals were 66, 33, and 6 ha (Beck 1990). In New Mexico, home ranges of 7 individuals ranged from 6 to 105 ha (mean 58 ha), were up to at least 3.5 km long (Beck and Jennings 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Gila monster's diet consists of a variety of objects: small mammals (young rabbits, mice and squirrels), birds, lizards, and eggs (of birds, lizards, snakes, turtles, and tortoises). The Gila monster has the capability to consume large amounts of food at one time (young can consume 50% of their body weight at a single feeding, adults can consume 35%). This is advantageous in an envirnoment in which finding prey at regular intervals may be difficult. Prey are rarely envenomated, which indicates that venom is used mainly for defense. Prey are detected by olfaction (the sense of smell). The Gila monster, like most snakes, uses its tongue for olfaction. (Ernst, 1992) (Bogert, 1956)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats small mammals, eggs (especially of ground-nesting birds, also of reptiles), lizards, insects, and carrion. In northwestern Arizona in April-May, ate mainly eggs of ground-nesting birds; in June-July, diet apparently shifted to small mammals (Jones 1983). Ate eggs and young mammals taken from nests in Utah (Beck 1990). Two juveniles salvaged in Arizona contained reptile eggshells (McGurty 2002). Prey is detected mainly by olfaction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by well over 100 collection/observation sites that are well distributed throughout the range (e.g., see Campbell and Lamar 2004). Degenhardt et al. (1996) mapped approximately 17 collection sites in New Mexico (Campbell and Lamar 2004 mapped only 5); these represent several relatively distinct occurrences. The easternmost locations may represent displaced, released, or escaped captive individuals (Degenhardt et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

Unknown

Comments: Total adult population size is unknown but probably is at least several thousand; the species is fairly common in at least some parts of the range. Lowe et al. (1986) stated that Gila monsters are infrequently seen but not rare or uncommon in Arizona. In New Mexico, the species is commonly encountered in the Redrock Wildlife Area in Grant County and at Granite Gap in Hidalgo County; a density of approximately 5 individuals per square kilometer was estimated for one area (Degenhardt et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basically solitary but may use communal overwintering sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: In Arizona and Utah, active mainly from early spring through early fall (surface activity peaks in spring in Arizona); some may bask in winter. In summer, crepuscular-nocturnal or relatively inactive. In northwestern Arizona, relatively inactive (in rodent burrows) in June-July (Jones 1983). Often encountered on roads at dusk or after dark following warm summer rains (Stebbins 1985). In Utah, activity peaked between late April and mid-June, from 0800-1200 h; some nocturnal activity may occur in summer (Beck 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
8.3 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating, which is usually in May, begins with the male tongue-flicking to seek a females's scent, while rubbing his cloaca on the ground. When a male locates a female, he lies by her and rubs his chin on her back and neck while holding her with his hindlegs. If a female objects to the male, she will try to bite him while crawling out from underneath. If receptive, she raises her tail. The male then moves his tail under hers, bringing their vents into contact. Copulation lasts from 30 minutes to an hour. The female lays her eggs (1-12) in an underground cavity, normally in July or August. Incubation lasts on average about ten months, and the young to hatch and emerge the following May. The process (fertilization through emergence) lasts about a year. (Ernst, 1992)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In southern Arizona, sperm formation occurs in May-June; females have oviductal eggs from late June into August (Goldberg and Lowe 1997). Eggs are laid primarily in July-August. Clutch size averages about 6, ranges up to 13 (Goldberg and Lowe 1997). In Arizona, eggs reportedly overwinter underground and hatch the following late April-early June, after an incubation period of about 10 months (Lowe et al. 1986, Goldberg and Lowe 1997). Females are sexually mature at about 24 cm SVL; mature females evidently reproduce every year (Goldberg and Lowe 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Saliva regulates digestion: Gila monster
 

Venomous saliva of gila monsters controls blood sugar levels via a regulating hormone.

     
   

"The recent identification in Heloderma horridum venom of  exendin-3, a new member of the glucagon superfamily that acts as a  pancreatic secretagogue, prompted a search for a similar peptide in Heloderma  suspectum venom…An amino  acid sequencing assay…was used to  isolate a 39-amino acid peptide, exendin-4, from H. suspectum  venom. Exendin-4 differs from exendin-3 by two amino acid substitutions,  Gly2-Glu3 in place of Ser2-Asp3,  but is otherwise identical. The structural differences make exendin-4  distinct from exendin-3 in its bioactivity. In dispersed acini from  guinea pig pancreas, natural and synthetic exendin-4 stimulate a  monophasic increase in cAMP beginning at 100 pM that plateaus at 10 nM.  The exendin-4-induced increase in cAMP is inhibited progressively by  increasing concentrations of the exendin receptor antagonist,  exendin-(9-39) amide. Unlike exendin-3, exendin-4 does not stimulate a  second rise in acinar cAMP at concentrations >100 nM, does not  stimulate amylase  release, and does not inhibit the binding of radiolabeled vasoactive  intestinal peptide to acini. This indicates that in dispersed pancreatic  acini, exendin-4 interacts only with the recently described exendin  receptor." (Eng et al. 1992:7402)


  Learn more about this functional adaptation.
  • Eng J; Kleinman W; Singh L; Sing G; Raufman J. 1992. Isolation and characterization of exendin-4, and exendin-3 analogue, from Heloderma suspectum venom: further evidence for an exendin receptor on dispersed acini from guinea pig pancreas. The Journal of Biological Chemistry. 267(11): 7402-7405.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heloderma suspectum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGCTGACTCTTTTCAACTAATCATAAAGATATTGGTACTCTTTATTTAATCTTTGGTGCTTGATCAGGAATGGTTGGTACCGCCCTAAGTCTTCTAATTCGAGCTGAACTGAATCAACCTGGCACTCTCTTAGGAGAT---GATCAAATTTATAATGTCATCGTCACTGCACATGCATTTGTCATAATTTTTTTTATAGTTATACCTGTAATAATCGGCGGATTTGGTAATTGATTGGTCCCATTAATAATTGGGGCCCCTGATATAGCCTTCCCGCGCATAAATAATATAAGTTTTTGACTCCTCCCGCCCTCTCTTCTTCTTCTTCTAGCATCATCAGGCATTGAATCTGGAGCCGGAACTGGTTGAACTGTCTACCCACCCCTTGCAGGAAATCTTACCCACGCCGGAGCATCAGTAGACCTAACAATTTTTTCGCTCCATTTAGCAGGAGTATCGTCTATCCTGGGCGCAATTAATTTTATTACAACCTGTCTTAATATGAAACCTCCTGCCATAACACAATACCAAACTCCATTATTTGTCTGATCAGTCTTAATTACAGCGGTACTACTACTCCTTTCTCTTCCAGTACTTGCAGCAGGAATTACCATACTACTAACTGATCGAAACTTAAACACTTCTTTTTTTGATCCGGCAGGAGGCGGAGATCCAGTTCTTTACCAACATCTATTCTGATTTTTCGGACACCCAGAAGTATATATCCTTATCTTACCAGGGTTCGGCATAATCTCCCACATTGTAACATATTATGCAGGAAAAAAAGAACCATTTGGCTACATAGGCATAGTATGAGCAATAATATCTATTGGCTTTCTTGGTTTTATTGTTTGAGCACACCATATATTTACAGTCGGCATAGATGTTGATACTCGCGCTTACTTTACCTCCGCTACTATAATTATTGCAATTCCAACTGGAGTTAAAGTTTTTAGCTGACTAGCGACACTCCACGGTGGT---ACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heloderma suspectum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A., Frost, D.R. & Gadsden, H.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Near Threatened because this species is probably in significant decline (but probably at a rate of less than 30% over three generations), especially because of habitat loss throughout much of its range, thus making the species close to qualifying for Vulnerable under criteria A2, A3 and A4.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The lizard is often killed because it is poisonous. The Gila monster is legally protected in all states in which they are found. (Ernst, 1992) (Bogert, 1956)

US Federal List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Occurs in the southwestern U.S. and northwestern Mexico; fairly common in some areas; some habitat has been lost to agriculture and urbanization, and illegal collecting may limit certain local populations, but the species is apparently secure at the present time.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is never very abundant, but its abundance varies greatly. It is represented by well over 100 collection/observation sites that are well distributed throughout the range (e.g., see Campbell and Lamar 2004). The total adult population size is unknown but is probably at least several thousand; the species is fairly common in at least some parts of the range. Lowe et al. (1986) stated that Gila monsters are infrequently seen but not rare or uncommon in Arizona. In New Mexico, the species is commonly encountered in the Redrock Wildlife Area in Grant County and at Granite Gap in Hidalgo County; a density of approximately five individuals per sq. kilometre was estimated for one area (Degenhardt et al. 1996). Populations are declining over most of the United States range (Campbell and Lamar 2004), but the rate of decline is unknown (probably less than 30% over the past three generations). Beck (1985) estimated that the population in Utah included 450 to 800 individuals, down from an estimated 2,000 to 5,000 before the 1930s. It is probably declining even more seriously in Mexico.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Comments: Populations are declining over most of the range (Campbell and Lamar 2004), but the rate of decline is unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Populations have been exploited (illegally) by commercial and private collectors, and they have suffered from habitat destruction due to urbanization and agricultural development (New Mexico Department of Fish and Game 1985). Concrete-lined canals are barriers to movement (Brown and Carmony 1999), as are busy highways. Mortality on roads likely is increasing as traffic volume increases on established highways and new roads are built. The most important reason for the decline is habitat loss resulting from development (Campbell and Lamar 2004). It is probably decreasing in southern Sonora due to expanding commercial agriculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Populations have been exploited (illegally) by commercial and private collectors, and they have suffered from habitat destruction due to urbanization and agricultural development (New Mexico Department of Fish and Game 1985). Concrete-lined canals are barriers to movement (Brown and Carmony 1999), as are busy highways. Mortality on roads likely is increasing as traffic volume increases on established highways and new roads are built. The most important reason for the decline is habitat loss resulting from development (Campbell and Lamar 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Much of the bushland of the Gila monster's habitat has been cleared for agriculture and remaining populations are isolated in the resulting fragments that persist (2). Urban development and roads have also encroached on their habitat and many monsters are killed by common feral, or pet, species such as domestic cats and dogs (8). Some specimens are also still illegally collected for the pet trade (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Collection of Gila monsters is prohibited by laws and regulations throughout the range in the United States and Mexico. Sizable areas of habitat are protected from development in national parks and monuments and in federal wilderness areas (Brown and Carmony 1999). It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Translocation of individuals away from urban locations does not appear to be an effective conservation tool. In Arizona, individuals that were moved less than 1,000 m from the site of capture returned within 30 days, whereas those translocated farther incurred a high mortality rate (Sullivan et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Individuals are protected from collection throughout the range, but some degree of illegal collection certainly occurs. Sizable areas of habitat are protected from development in national parks and monuments and in federal wilderness areas (Brown and Carmony 1999).

Needs: Stringent prohibitions against commercial explitation and unnecessary killing should be maintained.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Gila monsters are protected throughout their range, first receiving protection in 1952 in Arizona when they were the first venomous reptiles to receive such legislation (6). Over 300 individuals exist in captivity in the United States (8), and with greater understanding of these elusive lizards many of the common myths and superstitions around them have been surmounted (3). It is hoped that conservation measures will allow this a colourful desert-dweller to persist despite its depleted habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The Gila monster has little economic importance to humans. There is a small market for the hemipenis, which is used as an aphrodisiac. A small "pet" market for the species has also arisen. It is illegal, however, for the Gila monster to be captured or held in the states where it exists. The reptiles can be found in many zoos. (Bogert, 1956) (  http://www.Pharmacy.Arizona.EDU/centers/poison_center/critters/reptiles/gila monster)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Venomous; one of two venomous lizards worldwide; see Ernst (1992) and Lowe et al. (1986) for information on effects of bites on humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gila monster

The Gila Monster (Heloderma suspectum, pron.: /ˈhlə/ HEE-lə) is a species of venomous lizard native to the southwestern United States and northwestern Mexican state of Sonora. A heavy, slow-moving lizard, up to 60 cm (2.0 ft) long, the Gila monster is the only venomous lizard native to the United States and one of only two known species of venomous lizards in North America, the other being its close relative, the Mexican beaded lizard (H. horridum).[2] Though the Gila monster is venomous, its sluggish nature means that it represents little threat to humans. However, it has earned a fearsome reputation and is sometimes killed despite being protected by state law in Arizona.[1][3]

Contents

Taxonomy and etymology [edit]

There are two subspecies of Gila monster: the reticulate Gila monster (H. s. suspectum) and the banded Gila monster (H. s. cinctum).[3] The reticulate Gila monster lives in the southern region of the Gila monster's range, while the banded Gila monster is a northern subspecies occurring primarily in the Mojave Desert. The reticulate Gila monster tends to have its lighter markings broken up by dark scales, giving it a reticulated pattern, while the banded Gila monster generally has more unbroken bands of lighter scales.[4][5]

The Gila monster has one close living relative, the beaded lizard (H. horridum), as well as many extinct relatives in the Helodermatidae whose evolutionary history may be traced back to the Cretaceous period. The genus Heloderma has existed since the Miocene, when H. texana lived, and fragments of osteoderms from the Gila monster have been found in late Pleistocene (10,000-8000 years ago) deposits near Las Vegas, Nevada. Because the Helodermatids have remained relatively unchanged morphologically, they are occasionally regarded as living fossils.[6] Although the Gila monster appears closely related to the monitor lizards (varanids) of Africa, Asia and Australia, their wide geographical separation and the unique features not found in the varanids indicate that the Gila monster is better placed in a separate family.[5]

Plate from the Century Cyclopedia depicts the Gila Monster

The name Gila refers to the Gila River Basin in Arizona, where the Gila monster was once plentiful.[7] Heloderma means "studded skin", from the Ancient Greek words helos (ηλος), "the head of a nail or stud", and derma (δερμα), "skin". Suspectum comes from the describer, paleontologist Edward Drinker Cope, who suspected that the lizard might be venomous due to the grooves in the teeth.[6]

Distribution and habitats [edit]

Head with bead-like scales and strong forelegs and claws suitable for digging

The Gila monster is found in the Southwestern United States and Mexico, a range including Sonora, Arizona, parts of California, Nevada, Utah, and New Mexico (but not Baja California). They inhabit scrubland, succulent desert, and oak woodland, seeking shelter in burrows, thickets, and under rocks in locations with ready access to moisture.[4] In fact, Gila monsters seem to like water and can be observed immersing themselves in puddles of water after a summer rain.[8] They avoid living in open areas such as flats and farmland.[9]

Ecology [edit]

Gila monsters spend 90% of their time underground in burrows or rocky shelters[citation needed]. They are active in the morning during the dry season (spring and early summer); later in the summer, they may be active on warm nights or after a thunderstorm. They maintain a surface body temperature of about 30 °C (86 °F).[10] Gila monsters are slow in sprinting ability, but they have relatively high endurance and maximal aerobic capacity (VO2 max) for a lizard.[11] They are preyed upon by coyotes and raptors.

Diet [edit]

The Gila monster feeds on small birds, mammals, frogs, lizards, insects, and carrion.[12] The Gila monster feeds primarily on bird and reptile eggs, and eats infrequently (only five to ten times a year in the wild),[13] but when it does feed, it may eat up to one-third of its body mass.[14] It uses its extremely acute sense of smell to locate prey, especially eggs. Its sense of smell is so keen that it can locate and dig up chicken eggs buried 15 centimetres (6 in) deep and accurately follow a trail made by rolling an egg.[5]

Prey may be crushed to death if large or eaten alive if small, swallowed head-first and helped down by muscular contractions and neck flexing. Unusually, after food has been swallowed, the Gila monster immediately resumes tongue flicking and search behavior, probably as a result of a history of finding clumped prey such as eggs and babies in nests.[10] Gila monsters are able to climb trees and cacti in search of eggs.[15]

Venom [edit]

I have never been called to attend a case of Gila monster bite, and I don't want to be. I think a man who is fool enough to get bitten by a Gila monster ought to die. The creature is so sluggish and slow of movement that the victim of its bite is compelled to help largely in order to get bitten.

—Dr. Ward, Arizona Graphic, September 23, 1899

Pioneer beliefs [edit]

In the Old West, the pioneers believed a number of myths about the Gila monster, including that the lizard had foul or toxic breath and that its bite is fatal.[16] The Tombstone Epitaph wrote about a Gila Monster that a local person caught on May 14, 1881:

This is a monster, and no baby at that, it being probably the largest specimen ever captured in Arizona. It is 27 inches (69 cm) long and weighs 35 pounds (16 kg). It was caught by H. C. Hiatt on the road between Tombstone and Grand Central Mill and was purchased by Messrs. Ed Baker and Charles Eastman, who now have it on exhibition at Kelley's Wine House, next door above Grand Hotel, Allen Street. Eastern people who have never seen one of these monsters should not fail to inspect his Aztecship, for they might accidentally stumble upon one some fine day and get badly frightened, except they know what it is. They are beautiful pets, they are.

On May 8, 1890, southeast of Tucson, Arizona Territory, Empire Ranch owner Walter Vail captured and thought he'd killed a Gila monster. He tied it to his saddle and it bit the middle finger of his right hand and wouldn't let go. A ranch hand pried open the lizard's mouth with a pocketknife, cut open his finger to stimulate bleeding, and then tied saddle strings around his finger and wrist. They summoned Dr. John C. Handy of Tucson who took Vail back to Tucson for treatment, but Vail experienced swollen and bleeding glands in his throat for sometime afterward.[16]

Dr. Handy's good friend Dr. George Goodfellow of Tombstone was among the first to research the actual effects of Gila monster venom. The Scientific American reported in 1890 that "The breath is very fetid, and its odor can be detected at some little distance from the lizard. It is supposed that this is one way in which the monster catches the insects and small animals which form a part of its food supply—the foul gas overcoming them." Goodfellow offered to pay local residents $5.00 for Gila monster specimens. He bought several and collected more on his own. In 1891 he purposefully provoked one of his captive lizards into biting him on his finger. The bite made him ill and he spent the next five days in bed, but he completely recovered. When Scientific American ran another ill-founded report on the lizard's ability to kill people, he wrote in reply and described his own studies and personal experience. He wrote that he knew several people who had been bitten by Gila monsters but had not died from the bite.[16]

Goodfellow published articles about rattlesnake and Gila monster bites in the Scientific American and the Southern California Practitioner.[17]

Venom production [edit]

The Gila monster produces venom in modified salivary glands in its lower jaw, unlike snakes, whose venom is produced in the upper jaw.[12] The Gila monster lacks the musculature to forcibly inject the venom; instead, the venom is propelled from the gland to the tooth by chewing. Capillary action brings the venom out of the tooth and into the victim.[6] The teeth are loosely anchored, which allows them to be broken off and replaced throughout life. Gila monsters have been observed to flip over while biting the victim, presumably to aid the flow of the venom into the wound. Because the Gila monster's prey consists mainly of eggs, small animals, and otherwise "helpless" prey, it is thought that the Gila monster's venom evolved for defensive rather than for hunting use. A defensive use would explain the Gila monster's bright warning coloration.[5]

Toxicity [edit]

A reticulate Gila monster (Heloderma suspectum suspectum)

Although the venom is a neurotoxin as toxic as that of a Coral Snake, H. suspectum produces only small amounts.[9] The Gila monster's bite is normally not fatal to adult humans. There are no confirmed reports of fatalities after 1939, and those prior to that year are suspect due to the primitive dangerous "treatments." The Gila monster can bite quickly (especially by swinging its head sideways) and hold on tenaciously and painfully.[10] If bitten, the victim may need to fully submerge the attacking lizard in water to break free from its bite. Symptoms of the bite include excruciating pain, edema, and weakness associated with a rapid drop in blood pressure.

More than a dozen peptides and proteins have been isolated from the Gila monster's venom, including hyaluronidase, serotonin, phospholipase A2, and several kallikrein-like glycoproteins responsible for the pain and edema caused by a bite. Four potentially lethal toxins have been isolated from the Gila monster's venom, including horridum venom, which causes hemorrhage in internal organs and exophthalmos (bulging of the eyes)[1], and helothermine, which causes lethargy, partial paralysis of the limbs, and hypothermia in rats. However, the constituents most focused on are the bioactive peptides, including helodermin, helospectin, exendin-3, and exendin-4.[18] Most are similar in form to vasoactive intestinal peptide (VIP), which relaxes smooth muscle and regulates water and electrolyte secretion between the small and large intestines. These bioactive peptides are able to bind to VIP receptors in many different human tissues. One of these, helodermin, has been shown to inhibit the growth of lung cancer.[6][19][20]

Drug research [edit]

In 2005, the U.S. Food and Drug Administration approved the drug exenatide (marketed as Byetta) for the management of type 2 diabetes. It is a synthetic version of a protein, exendin-4, derived from the Gila monster's saliva.[21] In a three-year study with people with type 2 diabetes, exenatide led to healthy sustained glucose levels and progressive weight loss. The effectiveness is due to the fact that the lizard protein is about 50 percent identical to glucagon-like peptide-1 analog (GLP-1), a hormone released from the human digestive tract that helps to regulate insulin and glucagon. The lizard protein remains effective much longer than the human hormone, helping diabetics keep their blood sugar levels under control. Exenatide slows the emptying of the stomach and causes a decrease in appetite, contributing to weight loss.[22] The saliva of the Gila monster contains many chemicals which can be deadly. One of these has been shown to affect memory. Several companies have been researching the abilities of this chemical to help memory loss due to various diseases such as Alzheimer’s, schizophrenia, and ADHD. Gilatide, derived from exendin-4, has been shown to dramatically heighten memory in a study with mice. Gilatide is likely to be researched further to provide help to Alzheimer’s patients.

Life history [edit]

Gila monster at the Bristol Zoo

The Gila monster emerges from hibernation in the months of January or February and mates in May and June.[12] The male initiates courtship by flicking his tongue to search for the female's scent. If the female rejects his advances, she will bite him and crawl away. When successful, copulation has been observed to last from 15 minutes to as long as 2 hours 30 minutes. The female will lay eggs in July or August, burying them in sand 5 inches (13 cm) below the surface. The clutch consists of two to twelve eggs: five is the average.[4] The incubation lasts nine months, as the hatchlings emerge during the months of April through June the following year.[23] The hatchlings are about 16 centimetres (6.3 in) long and can bite and inject venom upon hatching. The juveniles typically have larger bands of pink scales than adults, although the banded Gila monster (H. s. cinctum) has a tendency to retain the band pattern. H. suspectum sexually matures at 3–5 years. After egg-laying, adult Gila monsters gradually spend less time on the surface to avoid the hottest part of the summer (although they may be active in the evening), eventually starting their hibernation around November.[5]

Little is known about the social behavior of H. suspectum, but they have been observed engaging in male-male combat, in which the dominant male lies on top of the subordinate one and pins it with its front and hind limbs. Both lizards arch their bodies, pushing against each other and twisting around in an effort to gain the dominant position. A wrestling match ends when the pressure exerted forces them to separate, although bouts may be repeated one after the other. These bouts are typically observed just before the mating season. It is thought that those with greater strength and endurance win more often and enjoy greater reproductive success.[24] Although the Gila monster has a low metabolism and one of the lowest lizard sprint speeds, it has one of the highest aerobic scope values (the increase in oxygen consumption from rest to maximum metabolic exertion) among lizards, allowing them to engage in intense aerobic activity for a sustained period of time. It has been observed that males have a higher aerobic scope than females, presumably because of sexual selection for a trait advantageous in prolonged combat.[11] The Gila monster may live up to 20 years in the wild, or 30 in captivity.[25]

Conservation status [edit]

Urban sprawl and habitat destruction has adversely affected Gila monster numbers. As a result, Gila monsters are protected by Arizona and Nevada state law; it is illegal to "harass, harm, pursue, hunt, shoot, wound, kill, trap, capture, or collect the Gila Monster." In 1952, they became the first venomous animal to be given legal protection.[8][26][27] Gila monsters are listed as Near Threatened by the IUCN.[1] In 1963, the San Diego Zoo became the first zoo to successfully breed Gila monsters in captivity.[25]

Relationship with humans [edit]

Though the Gila monster is venomous, its laggard movement means that it poses little threat to humans. However, it has earned a fearsome reputation and is often killed by humans because of fear. Among Native American tribes, the Gila monster had a mixed standing. The Apache believed that its breath could kill a man, and the Tohono O'Odham and the Pima believed that it possessed a spiritual power that could cause sickness. In contrast, the Seri and the Yaqui believed that the Gila monster's hide had healing properties.[9] The Gila monster has even starred as a monster in a B movie, The Giant Gila Monster. It played a minor role in the motion picture "The Treasure of the Sierra Madre". Myths that the animal's breath is toxic enough to kill humans or that it can spit venom or leap several feet in the air to attack are all false.[25] Another myth held that the Gila monster did not have an anus and therefore expelled waste from its mouth, the source of its venom and "fetid breath".[10] The official mascot of Eastern Arizona College located in Thatcher, Arizona is Gila Hank, a gun-toting, cowboy hat-wearing Gila Monster.

Gallery [edit]

References [edit]

  1. ^ a b c "2007 IUCN Red List – Search". Iucnredlist.org. Retrieved 2008-09-19. 
  2. ^ Fry, Bryan G.; et al. (February 2006). "Early evolution of the venom system in lizards and snakes.". Nature 439 (7076): 584–588. doi:10.1038/nature04328. PMID 16292255. Retrieved 2008-05-14. 
  3. ^ a b "Heloderma suspectum". Integrated Taxonomic Information System. Retrieved 19 May 2008. 
  4. ^ a b c Stebbins, Robert (2003). Western Reptiles and Amphibians. New York: Houghton Mifflin. pp. 338–339, 537. ISBN 0-395-98272-3. 
  5. ^ a b c d e Mattison, Chris (1998). Lizards of the World. London: Blandford. ISBN 0-7137-2357-2. 
  6. ^ a b c d King, Ruth Allen; Pianka, Eric R.; King, Dennis (2004). Varanoid Lizards of the World. Bloomington: Indiana University Press. ISBN 0-253-34366-6. 
  7. ^ "Online Etymology Dictionary". Retrieved 2008-06-10. 
  8. ^ a b Endangered Wildlife and Plants of the World. London: Marshall Cavendish. 2001. pp. 629–630. ISBN 0-7614-7199-5. 
  9. ^ a b c "Gila Monster Fact Sheet". National Zoological Park. Retrieved 2008-06-06. 
  10. ^ a b c d Greene, Harry L.; Pianka, Eric R.; Vitt, Laurie J. (2003). Lizards: Windows to the Evolution of Diversity. Berkeley: University of California Press. ISBN 0-520-23401-4. 
  11. ^ a b Beck, D. D.; M. R. Dohm, T. Garland, Jr., A. Ramirez-Bautista, and C. H. Lowe (1985). "Evolutionary physiology" (– Scholar search). Copeia 1995: 577–585. [dead link]
  12. ^ a b c Wilson, Don W.; Burnie, David (2001). Animal. London: DK. p. 419. ISBN 0-7894-7764-5. 
  13. ^ "Meet Our Animals: Gila monster". Philadelphia Zoo. Retrieved 2008-09-20. 
  14. ^ Christel CM, DeNardo DF, Secor SM (October 2007). "Metabolic and digestive response to food ingestion in a binge-feeding lizard, the Gila monster (Heloderma suspectum)". J. Exp. Biol. 210 (Pt 19): 3430–9. doi:10.1242/jeb.004820. PMID 17872997. 
  15. ^ Netherton, John; Badger, David P. (2002). Lizards: A Natural History of Some Uncommon Creatures, Extraordinary Chameleons, Iguanas, Geckos, and More. Stillwater, MN: Voyageur Press. ISBN 0-7603-2579-0. 
  16. ^ a b c Lapidus, Richard (June 3, 2011). "The Gila Monster Had a Killer Reputation". Wild West Magazine. Retrieved 10 March 2013. 
  17. ^ Allen, Paul L. (June 2, 1999). "1800s doc helped get the lead out". Citizen Tucson. Retrieved 9 March 2013. 
  18. ^ Aird SD (June 2008). "Nucleoside composition of Heloderma venoms". Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 150 (2): 183–6. doi:10.1016/j.cbpb.2008.02.012. PMID 18430599. 
  19. ^ Maruno K, Said SI (1993). "Small-cell lung carcinoma: inhibition of proliferation by vasoactive intestinal peptide and helodermin and enhancement of inhibition by anti-bombesin antibody". Life Sci. 52 (24): PL267–71. doi:10.1016/0024-3205(93)90640-O. PMID 8389407. 
  20. ^ Clarke, Toni. "Gila Monster Spit May Yield Alzheimer's Drug". Retrieved 2011-05-29. 
  21. ^ Bond, Aaron (July 2006). "Exenatide (Byetta) as a novel treatment option for type 2 diabetes mellitus". Baylor University Medical Center Proceedings 19 (3): 281–4. PMC 1484540. PMID 17252050. 
  22. ^ "Drug Derived From Gila Monster Saliva Helps Diabetics Control Glucose, Lose Weight". Science Daily. 2007-07-12. 
  23. ^ Seward, Mark (2002). Dr. Mark Seward's Gila monster Propagation: How To Breed Gila monsters in Captivity. Natural Selections Publishing. p. 80. ISBN 0-9701395-0-0. 
  24. ^ Beck, D.D. (1990). "Ecology and behavior of the Gila monster in southwestern Utah". Journal of Herpetology (Society for the Study of Amphibians and Reptiles) 24 (1): 54–68. doi:10.2307/1564290. JSTOR 1564290. 
  25. ^ a b c "San Diego Zoo's Animal Bytes: Gila Monster". San Diego Zoo. Retrieved 2008-05-19. 
  26. ^ "Gila Monster – Heloderma suspectum". Sedgwick County Zoo. Archived from the original on April 6, 2008. Retrieved 2008-06-09. 
  27. ^ Brennan, Thomas C. "Reptiles of Arizona – Gila Monster (Heloderma suspectum)". Retrieved 2008-06-10. 

Further reading [edit]

  • Beck, Daniel D. (2005). Biology of Gila Monsters and Beaded Lizards. Berkeley: University of California Press. ISBN 0-520-24357-9. 
  • Bogert, Charles M.; Rafael Martin del Campo (1956). The Gila Monster and its allies: the relationships, habits, and behavior of the lizards of the Family Helodermatidae. New York: Bull. Amer. Mus. Natur. Hist. 109:1–238. p. 238.  Online .pdf
  • Capula, Massimo; Behler (1989). Simon & Schuster's Guide to Reptiles and Amphibians of the World. New York: Simon & Schuster. ISBN 0-671-69098-1. 
  • Carmony, Neil B.; Brown, David (1991). Gila Monster: Facts and Folklore of America's Aztec Lizard. Silver City, NM: High-Lonesome Books. ISBN 0-944383-18-1.  Paperback (1999). ISBN 978-0-87480-600-7.  Missing or empty |title= (help)
  • Cogger, Harold; Zweifel, Richard (1992). Reptiles & Amphibians. Sydney, Australia: Weldon Owen. ISBN 0-8317-2786-1. 
  • Ditmars, Raymond L (1933). Reptiles of the World: The Crocodilians, Lizards, Snakes, Turtles and Tortoises of the Eastern and Western Hemispheres. New York: Macmillian. p. 321. 
  • Freiberg, Dr. Marcos; Walls, Jerry (1984). The World of Venomous Animals. New Jersey: TFH Publications. ISBN 0-87666-567-9. 
  • Roever, J. M.; Hiser, Iona Seibert (1972). The Gila Monster. Austin, Tex: Steck-Vaughn Co. ISBN 0-8114-7739-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!