Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Athrycia trepida is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Bessa parallela is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Hebia flavipes is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Phryno vetula is endoparasitoid of larva of Orthosia miniosa

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthosia miniosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTCGGAACTTCATTAAGATTGTTAATTCGAGCTGAATTAGGAAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCTCCCCTTTCATCTAATATTGCTCATGGGGGAAGATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAACCTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACTGCATTTTTATTATTATTATCATTACCTGTATTAGCTGGGGCCATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orthosia miniosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orthosia miniosa

The Blossom Underwing (Orthosia miniosa) is a moth of the Noctuidae family. It is found in Europe.

The wingspan is 31–36 mm. The length of the forewings is 15–17 mm. The moth flies in one generation from the end of March to mid May [1].

The larvae feed on various trees and shrubs, mainly oak.[1]

Notes[edit]

  1. ^ The flight season refers to Belgium and the Netherlands. This may vary in other parts of the range.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!