Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Athrycia trepida is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Bessa parallela is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Hebia flavipes is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Orthosia miniosa

Animal / parasitoid / endoparasitoid
larva of Phryno vetula is endoparasitoid of larva of Orthosia miniosa

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orthosia miniosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTCGGAACTTCATTAAGATTGTTAATTCGAGCTGAATTAGGAAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAATTGACTTGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCTCCCCTTTCATCTAATATTGCTCATGGGGGAAGATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAACCTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACTGCATTTTTATTATTATTATCATTACCTGTATTAGCTGGGGCCATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orthosia miniosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orthosia miniosa

The Blossom Underwing (Orthosia miniosa) is a moth of the Noctuidae family. It is found in Europe.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 31–36 mm. The length of the forewings is 15–17 mm. Forewing sandy rufous, black-speckled, median area generally deeper rufous: lines browner, edged with pale, the outer dentate-lunulate; stigmata with yellowish outlines and grey centres: submarginal line rufous and yellowish: hindwing white, rosy-tinged along termen; cellspot, outer line, and veins sometimes well-marked ;- rubricosa Esp. is the form in which the red of the median area is most emphasised; — pallida Tutt is greyish ochreous, with hardly a vestige of rufous: in virgata Tutt, while the basal and marginal areas are grey, the median space is rufous.[1]

Biology[edit]

The moth flies in one generation from the end of March to mid May [1].

Larva pale or dark blue grey; dorsal and subdorsal lines yellow; the sides black with a yellow spiracular line, marked with a white spot on each segment; head whitish with coarse blackish mottling. The larvae feed on various trees and shrubs, mainly oak.[2]

Notes[edit]

  1. ^ The flight season refers to Belgium and the Netherlands. This may vary in other parts of the range.

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!