Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Brief Summary

Biology

Hawksbills may take decades to mature and it could be between 20 to 40 years before they are ready to breed (10). Upon reaching sexual maturity, a female will typically lay up to five clutches of around 100 to 140 eggs in one breeding season, and then wait a few years before nesting again (6). Nesting is much more dispersed than in other marine turtles, but individuals do tend to return to a particular beach season after season (10). Having survived the dash to the sea, hatchlings are believed to spend their first few years in the open ocean before returning to more sheltered coastal waters. Recent studies indicate that the oceanic phase may be shorter for hawksbills, or even omitted in certain regions, as hatchlings swim less vigorously than those of other species (7). Probably less than one out of 1000 eggs will survive and reach adulthood (10). Adults are opportunistic predators, using their sharp beak to prize invertebrate prey from crevices within the reef. Unusually amongst marine animals (to whom they are often unpalatable), sponges make up the majority of the hawksbill's diet (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Lifestyle

You can find hawksbill turtles in tropical waters around coral reefs. The only time you will find them out of the water is when female turtles crawl onto a beach, dig a hole, and then lay 100 to 140 eggs. Once they’ve chosen a beach, female turtles stick with it, returning to it every time they lay eggs. Only one out of every 100 eggs will become an adult turtle, because so many other animals like to eat tiny turtles!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eretmochelys Imbricate is Considered One of the most Endangered Sea Turtles

The hawksbill is a medium, sized sea turtle often considered the most beautiful of all sea turtles because of the amber scutes on the carapace that are usually streaked with red-brown, black and yellow. Additional distinctive characters include overlapping capace scutes, except in very old individuals.

One of smaller sea turtles with adult shell length usually 76-89 cm. Adults usually weigh between 43 and 75 kg (100-165) but may grow as large as 127 kg. Frequent warm, shallow water habitats (less than 20 m) such as bays, shoals, coral reefs, and island (nesting), females lay several hundered eggs on exposed sand beach every 2 to 3 years.

Turtle has a unique characteristic that is strong homing instict or strong memory and ability as bioindikator to know an area is polluted. With a strong memory, turtles will return to shore where they were first born to spawn and hawksbill turtle have a sharp beak and tapered with a large jaw like beak of eagle and overlapping scales. Adults travel hundereds or thousand of kilometers from foraging grounds to breeding areas and neonates are broadly dispersed by ocean currents. Studies of hawksbill habitat use and behaviour on foraging grounds may also elucidate ecological roles and susceptibility to threats (Leon and Bjorndal, 2002)

Although this species has been harvested for meat and eggs, the primary reasons for the decline was harvest for "tortoise shell". As recently as 1991, Japan allowed importation of up to 20 tons of hawksbill turtle shell for their industry. However, recent pressure has caused the japanese government to begin phasis out this industry. A recent trend to offer stuffed juvenile hawksbills as tourist curios continues to be a threat. Because this species tends to nest on small, isolated islands, loss of nesting habitat to development has not been as much of a threat as it has been with other sea turtles. Loss of coral reefs in tropical regions has had a serious effect because of loss of feeding areas. Erosion of barrier island and other actors which decrease available seagrass beds have been a factor in its decline.
  • Leon, Y.M and Bjorndal, KA. 2002. Selective feeding in The hawksbill turtle, an important predator in coral reef ecosystems. Marine Ecology progress series 245: 249-258
Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Eka Maya Kurniasih

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Eretmochelys Imbricate is Considered One of the most Endangered Sea Turtles

The hawksbill is a medium, sized sea turtle often considered the most beautiful of all sea turtles because of the amber scutes on the carapace that are usually streaked with red-brown, black and yellow. Additional distinctive characters include overlapping capace scutes, except in very old individuals.

One of smaller sea turtles with adult shell length usually 76-89 cm. Adults usually weigh between 43 and 75 kg (100-165) but may grow as large as 127 kg. Frequent warm, shallow water habitats (less than 20 m) such as bays, shoals, coral reefs, and island (nesting), females lay several hundered eggs on exposed sand beach every 2 to 3 years.

Turtle has a unique characteristic that is strong homing instict or strong memory and ability as bioindikator to know an area is polluted. With a strong memory, turtles will return to shore where they were first born to spawn and hawksbill turtle have a sharp beak and tapered with a large jaw like beak of eagle and overlapping scales. Adults travel hundereds or thousand of kilometers from foraging grounds to breeding areas and neonates are broadly dispersed by ocean currents. Studies of hawksbill habitat use and behaviour on foraging grounds may also elucidate ecological roles and susceptibility to threats (Leon and Bjorndal, 2002)

Although this species has been harvested for meat and eggs, the primary reasons for the decline was harvest for "tortoise shell". As recently as 1991, Japan allowed importation of up to 20 tons of hawksbill turtle shell for their industry. However, recent pressure has caused the japanese government to begin phasis out this industry. A recent trend to offer stuffed juvenile hawksbills as tourist curios continues to be a threat. Because this species tends to nest on small, isolated islands, loss of nesting habitat to development has not been as much of a threat as it has been with other sea turtles. Loss of coral reefs in tropical regions has had a serious effect because of loss of feeding areas. Erosion of barrier island and other actors which decrease available seagrass beds have been a factor in its decline.
  • Leon, Y.M and Bjorndal, KA. 2002. Selective feeding in The hawksbill turtle, an important predator in coral reef ecosystems. Marine Ecology progress series 245: 249-258
Creative Commons Attribution 3.0 (CC BY 3.0)

© Eka Maya Kurniasih

Supplier: Eka Maya Kurniasih

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This Critically Endangered marine turtle has been exploited for thousands of years as the sole source of commercial tortoiseshell. The beautiful carapace is generally streaked and marbled with amber, yellow or brown and often has a strongly serrated edge (5). Unlike other species, the scales (or scutes) of the carapace overlap. The narrow head and strongly hooked beak give rise to this turtle's common name (6), while the imbricate nature of the (overlapping) scutes give rise to the Latin species name of 'imbricata' (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

A moderately sized marine turtle; largest Egyptian specimen has a carapace length of 835 mm. Carapace depressed, elongate, smooth; scutes imbricate in younger animals, increasingly less so in older specimens; posterior edge strongly serrate; 4 cosatal scutes; first marginal scute in contact with first vertebral scute. Head rather small, narrow, with two pairs of prefrontals. Snout is beak-like, elongate. There area 2 claws on each limb. Males smaller, with longer tails and larger claws. Color of carapace yellowish brown, with dark brown and black radiating streaks; dorsal sides of limbs and head brown, scales edged yellowish. All ventral sides yellowish white.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Eretmochelys imbricata is one of the smaller turtle species, with a carapace (shell) of up to 1 m and weighing up to 80 kg. The beak-shaped mouth has lead to the species common name of hawksbill. The carapace of this species is amber in colour with reddish-brown, blackish-brown streaks and can also have yellow markings.Populations of hawksbill are threatened with decline as a result of a number of factors, including loss of nesting sites, accidental entanglement in fishing line and the destruction of coral reefs which provide a feeding ground.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

Many people think that hawksbill turtle’s shell is the most beautiful sea turtle shell in the world! The hawksbill turtle is so named because its sharp beak is hooked, much like a hawk’s beak. Some people think it can live to be up to 50 years old.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Eretmochelys imbricata are found mainly in the tropical regions of the Atlantic and Pacific oceans. However, in the western hemisphere, they have been reported to have nests as far north as Woods Hole, Massachusetts. They are also present in the Long Island Sound. However, between the Carolinas and New Jersey, very few hawksbill turtles have been recorded.

Biogeographic Regions: australian ; oceanic islands ; indian ocean; atlantic ocean ; pacific ocean ; mediterranean sea

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

The Hawksbill has a circumglobal distribution throughout tropical and, to a lesser extent, subtropical waters of the Atlantic Ocean, Indian Ocean, and Pacific Ocean. Hawksbills are migratory and individuals undertake complex movements through geographically disparate habitats during their lifetimes. Hawksbill nesting occurs in at least 70 countries, although much of it now only at low densities. Their movements within the marine environment are less understood, but Hawksbills are believed to inhabit coastal waters in more than 108 countries (Groombridge and Luxmoore 1989, Baillie and Groombridge 1996; see Regional Overviews in attached PDF).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

cosmopolitan warm water
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Mexico, Irish Exclusive economic Zone, Mediterranean Sea, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

The Red Sea, where it is the commonest marine turtle; not recorded yet from the Egyptian Mediterranean, although Werner (1988) lists the species from Israeli Mediterranean waters. It has been recorded throughout the Red Sea and in both the Gulfs of Aqaba and Suez. Breeding has been recorded throughout the Hurghada Archipelago, Ras Mohamed, Wadi El Gemal Island, Qulan Islands, Ras Banas, and Zabargad Island.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© BA Cultnat

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

A pan-tropical species, recorded erratically in the Mediterranean, but not known to breed there.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Pantropical and warm-temperate regions, rarely venturing into higher latitudes; Atlantic, Pacific, and Indian oceans. Nests on beaches generally between 25 degrees latitude north and south, including tropical Gulf Coast of Mexico, West Indies, Bahamas, and the Americas. Nesting in U.S. waters: Virgin Islands, Puerto Rico (including Isla Vieques, Isla Mona, and the Culebra group); infrequently on the Atlantic coast of central and southern Florida and the Florida Keys (Meylan 1992, Lund 1985) and in the southeastern Hawaiian chain (Hawaii, Molokai; Balazs 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa Oceania Near-East North-America Middle-America Asia Caribbean South-America Australia
Distribution: Atlantic, Pazific, and Indian oceans, the Red Sea, the British Isles,  Europe: Portugal  USA (California, Massachusetts, Washington,  Western Atlantic: Maine, New Hampshire, Massachusetts,  Connecticut, New Jersey, Delaware, Maryland, Virginia, North Carolina, South Carolina, Georgia, Florida, Alabama, Mississippi, Louisiana, Texas),  SE Mexico (Yucatan, Baja California), Belize, Guatemala, Honduras, Nicaragua, Costa Rica, Panama  Colombia [Castro,F. (pers. comm.)], Galapagos Islands Peru, S Brazil  Madagascar, Andaman Islands, Nicobar Islands, Pakistan, NW Africa, Gambia, Tanzania, Israel,  Japan  Australia (New South Wales?, North Territory, Queensland,  Tasmania: King Island, West Australia) Chagos Archipelago  bissa: Indian and Pacific Oceans, from Madagascar to the Red Sea; Philippine Sea, the Sea of Japan, N Australia; Americas from California to Peru.  imbricata: Atlantic Ocean;
Type locality: "American and Asiatic seas"; restricted to Bermuda Ils. by Smith & Taylor (1950).   squamata: Indian and Pacific Ocean  acording to the 1994 IUCN Red List of Threatened Animals: Atlantic Ocean, Indian Ocean, Mediterranean and Black Sea, EC/SE/W/WC Pacific Ocean, American Samoa, Anguilla, Antigua and Barbuda, Aruba, Australia, Bahamas, Bangladesh, Barbados, Belize, Brazil, British Indian Ocean Territory, Cambodia, Cameroon, Cape Verde, China, Colombia, Comoros, Cook Islands, Costa Rica, Cote d'Ivoire, Cuba, Djibouti, Dominica, Dominican Republic, Ecuador, Egypt, El Salvador, Equatorial Guinea, Eritrea, Federated States of Micronesia, Fiji, French Guiana, French Polynesia, Gabon, Ghana, Grenada, Guadeloupe, Guam, Guatemala, Guinea, Guinea-Bissau, Guyana, Haiti, Honduras, India, Indonesia, Iran, Jamaica, Japan, Kenya, Kiribati, Kuwait, Madagascar, Malaysia, Maldives, Marshall Islands, Martinique, Mauritania, Mayotte, Mexico, Montserrat, Mozambique, Myanmar (= Burma), Netherlands Antilles, New Caledonia, Nicaragua, Nigeria, Northern Marianas, Oman, Palau, Panama, Papua New Guinea, Philippines, Puerto Rico, Qatar, Reunion, Sao Tome & Principe, Saudi Arabia, Senegal, Seychelles, Sierra Leone, Solomon Islands, Somalia, Sri Lanka, St Kitts and Nevis, St Lucia, St Vincent, Sudan, Suriname, Taiwan, Tanzania, Thailand, Tokelau, Tonga, Trinidad and Tobago, Turks and Caicos Islands, Tuvalu, US Minor Pacific Islands, USA, United Arab Emirates, Vanuatu, Venezuela, Viet Nam, Virgin Islands (British), Virgin Islands (US), Western Sahara, Western Samoa, Yemen
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Tropical seas

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Pacific, and Indian Oceans.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Hawksbill turtles are found throughout the world in tropical waters and are known to nest on beaches in at least 60 countries (8). Recent evidence indicates that hawksbills take part in long distance migrations with breeding and feeding grounds in very different locations (5), although they tend to be more sedentary (move less) than other sea turtles species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Young hawksbill turtles have a heart-shaped carapace. As these turtles mature, their carapaces becomes more elongated. In all of the hawksbill turtles, with the exception of very old individuals, the lateral and posterior areas of the carapace are serrated. The heads of hawksbill turtles taper into a V shape, giving them the appearance of birds' beaks.

Eretmochelys imbricata have 5 features that distinguish them from other sea turtles. Their heads have two pairs of prefrontal scales. They also have two claws on each of their forelimbs. There are thick, overlapping scutes on their carapaces, which also have four pairs of costal scutes. Their elongate mouths resemble a beak, that taper off to a sharp point at the end.

Hawksbill turtles are relatively small sea turtles. Nesting females average a length of 87 centimeters in curved carapace length and weigh 80 kilograms. The average hatchling Eretmochelys imbricata in the parts of the Caribbean owned by the United States is about 42 millimeters in straight carapace length and weighs 13.5 to 19.5 grams. Male turtles are distinguished by a brighter pigmentation, a concave plastron, long claws, and a thicker tail.

Range mass: 35.7 to 127 g.

Average mass: 80 g.

Range length: 62.5 to 114 cm.

Average length: 87 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful; sexes shaped differently

  • Turtle Trax. 1999. "The Hawksbill Turtle (Eretmochelys imbricata)" (On-line ). Accessed 03/16/03 at http://www.turtles.org/hawksd.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 81 cm

Weight: 75000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

90 cm
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species differs from the green turtle in having two rather than one pair of prefrontals and having overlapping scutes on the carapace (may overlap in very young green turtles). Differs from the loggerhead and ridleys in having only four rather than 5 or more costals on each side of the carapace, andin having the first costal not in contact with the nuchal. (Conant and Collins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Eretmochelys imbricata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Sex unknown;
Preparation: Dry
Year Collected: 1840
Locality: No Further Locality Data, Fiji Islands, Republic of Fiji, Pacific
  • Syntype: Girard, C. & Baird, S. F. 1858. Herpetology. Prepared under the superintendence of S.F. Baird. United States Exploring Expedition during the years 1838, 1839, 1840, 1841, 1842, under the command of Charles Wilkes, U.S.N. 20: 446, plate 30, figures 8-13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Eretmochelys imbricata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Sex unknown;
Preparation: Dry
Year Collected: 1840
Locality: No Further Locality Data, Fiji Islands, Republic of Fiji, Pacific
  • Syntype: Girard, C. & Baird, S. F. 1858. Herpetology. Prepared under the superintendence of S.F. Baird. United States Exploring Expedition during the years 1838, 1839, 1840, 1841, 1842, under the command of Charles Wilkes, U.S.N. 20: 446, plate 30, figures 8-13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Habitats

Hawksbills nest on insular and mainland sandy beaches throughout the tropics and subtropics. They are highly migratory and use a wide range of broadly separated localities and habitats during their lifetimes (for review see Witzell 1983). Available data indicate that newly emerged hatchlings enter the sea and are carried by offshore currents into major gyre systems where they remain until reaching a carapace length of some 20 to 30 cm. At that point they recruit into a neritic developmental foraging habitat that may comprise coral reefs or other hard bottom habitats, sea grass, algal beds, or mangrove bays and creeks (Musick and Limpus 1997) or mud flats (R. von Brandis unpubl. data). As they increase in size, immature Hawksbills typically inhabit a series of developmental habitats, with some tendency for larger turtles to inhabit deeper sites (van Dam and Diez 1997, Bowen et al. 2007). Once sexually mature, they undertake breeding migrations between foraging grounds and breeding areas at intervals of several years (Witzell 1983, Dobbs et al. 1999, Mortimer and Bresson 1999). Global population genetic studies have demonstrated the tendency of female sea turtles to return to breed at their natal rookery (Bowen and Karl 1997), even though as juveniles they may have foraged at developmental habitats located hundreds or thousands of kilometers from the natal beach. While Hawksbills undertake long migrations, some portion of immature animals may settle into foraging habitats near their beaches of origin (Bowen et al. 2007).

Roles in the Ecosystem

Like other species of sea turtles, Hawksbills contribute to marine and coastal food webs and transport nutrients within the oceans (Bouchard and Bjorndal 2000). Hawksbills are important components of healthy coral reef ecosystems and are primarily spongivorous in the Caribbean (Meylan 1988), but more omnivorous in the Indo-Pacific (review by Bjorndal 1997). They consume relatively large amounts of algae in northern Australia (Whiting 2000 cited in S. Whiting in litt. to J. Mortimer 4 Jun 2007), soft corals in the Great Barrier Reef region (C. Limpus unpublished data), and other combinations of forage depending on habitat (in Seychelles, J. Mortimer and R. von Brandis unpublished data; in Barbados, B. Krueger unpublished data). At sites where they are primarily spongivorous, Hawksbills have been found to support healthy reefs by controlling sponges which would otherwise out-compete reef-building corals for space (Hill 1998, León and Bjorndal 2002, Bjorndal and Jackson 2003).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hawksbill turtles are most commonly found in hard-bottomed and reef habitats containing sponges. They also reside in shoals, lagoons of oceanic islands, and continental shelves. In general, they are found in water no deeper than sixty feet (18.3 m). When hawksbill turtles are young, the are unable to dive into deep water, and therefore are forced to live in masses of floating sea plants, such as sargassum.

Range depth: 20 to 0 m.

Average depth: Near Surface m.

Habitat Regions: saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4112 specimens in 3 taxa.
Water temperature and chemistry ranges based on 1948 samples.

Environmental ranges
  Depth range (m): 0 - 300
  Temperature range (°C): 7.560 - 28.819
  Nitrate (umol/L): 0.058 - 21.357
  Salinity (PPS): 33.277 - 37.155
  Oxygen (ml/l): 3.134 - 7.047
  Phosphate (umol/l): 0.034 - 1.298
  Silicate (umol/l): 0.838 - 12.498

Graphical representation

Depth range (m): 0 - 300

Temperature range (°C): 7.560 - 28.819

Nitrate (umol/L): 0.058 - 21.357

Salinity (PPS): 33.277 - 37.155

Oxygen (ml/l): 3.134 - 7.047

Phosphate (umol/l): 0.034 - 1.298

Silicate (umol/l): 0.838 - 12.498
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Warm tropical and subtropical marine waters, usually near coral reefs and rocky outcrops in shallow waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: This species uses a wide range of tropical and subtropical habitats, including shallow coastal waters with rocky bottoms, coral reefs, beds of sea grass or algae, mangrove-bordered bays and estuaries, and submerged mud flats (see NMFS and USFWS 2007). Hatchlings and small juveniles associate with masses of floating sea plants (sargassum rafts) in the open ocean (NMFS and USFWS 2007). Nesting occurs on undisturbed, deep-sand, insular or mainland beaches, from high energy ocean beaches to tiny pocket beaches several meters wide contained in crevices of cliff walls; a typical site would be a low-energy sand beach with woody vegetation, such as sea grape or saltshrub, near the water line (CSTC 1990). Successive nestings usually are in the same general area.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Hawksbills use different habitats at different stages of their life cycle. Adults are usually not found in shallow marine habitats (unless coming ashore to nest), whereas small juveniles are rarely far from the shallowest coral reefs in tropical waters and therefore unlikely to be found in the British Isles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Shallow waters around coral reefs and mangrove estuaries. Juveniles are pelagic and are associated with Sargassum until they are around 1 to 3 years old.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Adult hawksbill turtles are mainly associated with the clear, relatively shallow water of coastal reefs, bays, estuaries and lagoons, with nesting generally occurring on remote, isolated sandy beaches (6) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Adults may migrate hundreds or thousands of kilometers between nesting beaches and marine feeding areas (Plotkin 2003). In the Caribbean region, 19 adults traveled minimum distances of 110-1,936 kilometers, 9 immatures 46-900 kilometers; recapture of immatures suggest long-term residency in developmental habitats (Meylan 1999). Adult females that nested in Barbados traveled 200-435 kilometers (straight-line distance) over 7-18 days to foraging areas in Dominica, Grenada, Trinidad, and Venezuela (Horrocks et al. 2001). A female tagged on a nesting beach at Buck Island Reef National Monument near St. Croix, U.S. Virgin Islands, was recovered at Miskito Cays, Nicaragua (Hillis, 1995, Park Science 15(2):25). A feeding population at Isla Mona (Puerto Rico) included individuals from nesting populations throughout the Caribbean region (Bowen et al. 1996).

MtDNA data from the Caribbean region indicate that a natal homing mechanism predominates and that nesting populations should be considered separate stocks; foraging populations evidently are composed of cohorts from multiple regional nesting colonies (Bass 1999).

Foraging home range sizes of individuals in the West Indies were 1.96-49.5 square kilometers and were positively correlated with average water depth (Horrocks et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hawksbill turtles feed primarily on sponges. They show a large level of feeding selectivity in the way that they only eat certain species of sponges, some of which are toxic to other animals. Sea jellies and other coelenterates are also common prey items. These turtles are omnivorous and also eat mollusks, fish, marine algae, crustaceans, and other sea plants and animals. A preferred feeding ground of the turtles is in shallow shoals abundant with brown algae.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; cnidarians; other marine invertebrates

Plant Foods: leaves; wood, bark, or stems; fruit; algae; macroalgae

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet consist primarily of invertebrates (crabs, sea urchins, shellfish, jellyfish, etc.) but also includes plant material and fishes. This species generally has been regarded as a generalist, but recent research indicates specialization on demosponges in Florida and the Caribbean. Foraging microhabitats include the bottom and reef faces, close to shore.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults consume mostly sponges (especially of the class Demospongiae). They also will eat sea cucumbers, bryozoans, tunicates, molluscs, coelenterates, echinoderms, crabs, and algae.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Hawksbill turtles often times feed on sponges, causing succession to occur in the reef and freeing up space for settlement of other organisms.

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Hawksbill turtles, like all turtles, have a hard shell that discourages predators from trying to eat them. Adult turtles are still consumed by humans, sharks, crocodiles, large fish, and octopi. Nests are commonly robbed by terrestrial predators such as dogs, raccoons, rats, and humans.

Directly after hatching, hawksbill turtles face the most dangerous time of their lives: the journey to water. Although this scramble only lasts a few minutes, countless hatchlings are preyed on by flocks of gulls and large crabs.

Known Predators:

  • Bjorndal, K. A. 1999. Conservation of Hawksbill Sea Turtles: Perceptions and Realities". Accessed 03/16/03 at http://www.turtles.org/bjorndal.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

Pretty much all the hawksbill turtle’s food can be found in coral reefs. They will often eat sponges. But it will also use its strong beak to munch and crunch on snails, sea urchins, starfish, jellyfish, and even octopi. It will also eat seagrasses and different types of algae. As it eats both plants and animals, it is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: Number of distinct occurrences based on nesting areas is unknown but likely falls within the indicated range. NMFS and USFWS (2007) mapped 83 nesting concentrations for which data were available; these nesting areas are a subset of the global total but include most major nesting areas. Nesting occurs in at least 70 nations (NMFS and USFWS 2007). Many occurrences include only a very few individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Better data are needed, though clearly this species is not as abundant as Caretta or Chelonia. For a sample of 83 nesting concentrations for which recent data were available, NMFS and USFWS (2007) estimated the number of females nesting per year at 3,072-5,603 in the Atlantic Ocean, fewer than 8,130 to as many as 10,052 in the Indian Ocean, and 10,010-12,483 in the Pacific Ocean, for a total of fewer than 21,212 to as many as 28,138. This includes most major nesting concentrations. Relatively few populations remain with more than 1,000 females nesting annually (none in the Atlantic) (Meylan and Donnelly 1999, NMFS and USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Eggs and hatchlings incur high mortality from various predators. Humans are the most important predators on adults. In the Seychelles Islands, egg survivorship was 0.86 (see Iverson 1991).

In the U.S. Virgin Islands (Buck Island Reef National Monument), the sex ratio of the juvenile population foraging on the reef was strongly biased toward females (Geis et al. 2003). Multiple nesting populations throughout the Caribbean evidently contributed to the sex ratio.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The mechanisms that aid hawksbill turtles in returning to their nesting beaches are still unknown. It has been thought that these turtles are guided inland by magnetic fields and lunar phases/position.

This species communicates by the use of ritual mating behaviors.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile ; acoustic ; chemical ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Carnivorous, feeding largely on sessile marine invertebrates, such as sponges and soft corals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Cyclicity

Comments: Nests usually at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Hawksbill turtles hatch out of eggs. As a hawksbill turtle matures, its carapace shifts from heart-shaped to more elongate. Sex determination is thought to be temperature-dependent as is the case with other sea turtles and reptiles, however not enough data is available to be sure this is true.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The normal lifespan of hawksbill turtles is thought to be about 30 to 50 years, however biologists are not sure exactly how long they live.

Range lifespan

Status: captivity:
20+ (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: These animals have been kept in captivity for more than 20 years. Their longevity in the wild is unknown (http://www.pwrc.usgs.gov/neparc/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs roughly every 2 to 3 years. It occurs mainly in shallow waters. No information is available as to whether or not these turtles have life-long partners or are promiscuous.

Copulation usually begins in shallow water near the shore. Males lie and wait in the shallow water for the females to return. At times, males have been seen following the females on shore. However, this behavior is rarely observed.

The entire nesting process takes roughly one to three hours. It involves similar steps as most other species of sea turtles. The turtles come out of the sea and select a site in which to lay their eggs. They then clear the area and dig a pit in the sand. Next they lay their eggs and then proceed to fill in the pit in with their hind limbs. After the site is disguised, the turtles return to the sea.

Breeding interval: The females lay three clutches a year at an interval of roughly thirteen to fifteen days.

Breeding season: Nesting generally occurs between July and October.

Average number of offspring: 140.

Average gestation period: 60 days.

Average age at sexual or reproductive maturity (female): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
1277 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1277 days.

After laying the eggs on the beach, the females retreat into the water. After about 60 days, the eggs hatch, and the newborn turtles make a perilous dash for the water where they will mature.

Parental Investment: no parental involvement

  • New York State Department of Environmental Conservation. 2003. "Atlantic Hawksbill Sea Turtle Fact Sheet" (On-line ). Accessed 03/21/03 at http://www.dec.state.ny.us/website/dfwmr/wildlife/endspec/athafs.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In West Indies, most nesting occurs May-November (apparent peak May-June). Individual adult females lay 3-6 (averaging 3-5, depending on location) clutches of 50-200+ eggs at night at intervals averaging 14-18.5 days; adult females nest at interval of usually 2 to several years (mean as low as 1.84 years in Malaysia, 5-7 years in the Solomon Islands) (see NMFS and USFWS 2007). Eggs hatch in about 2 months. Age of sexual maturity is roughly 20-40 years (ranges from 20+ years in the Caribbean to at least 30-35 years in the Indo-Pacific to 31-38 years in Australia) (see NMFS and USFWS 2007). Formerly nesting concentrations likely were larger than they they cuurently are in most areas; now nesting generally is distributed at low densities in the Caribbean (small nesting concentrations may occur on Antigua), but up to 100 per night may nest on some islands in northern Australia (see Van Meter 1983); nesting aggregations also occur in Oman, Yucatan, and the Sychelles, and these may be typical of pre-exploitation nesting densities (see NMFS and USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hawksbill turtles nest on islands and mainland beaches in the tropics. The females come ashore to nest during the night or day. Nesting takes around 1 to 1.5 hours, and approximately 130 eggs are laid in a clutch. A female may produce 2 to 3 clutches in a reproductive season. She will then not mate for another 2 to 3 years. Hatchlings are 39-50 mm in length when they emerge from the sand.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eretmochelys imbricata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC7072-09|DQ533485|Eretmochelys imbricata| ACCCGTTGATTCTTTTCTACCAACCATAAAGACATTGGCACCCTATACTTGATCTTTGGGGCATGAGCAGGAATAGTAGGCACAGCACTC---AGTCTATTAATCCGTGCAGAACTAAGCCAACCAGGAACTCTCCTAGGAGAT---GACCAAATTTATAATGTTATCGTTACAGCCCATGCTTTCATTATAATCTTGTTTATAGTTATACCAATTATAATTGGCGGTTTCGGAAACTGACTTGTTCCACTAATA---ATTGGAGCACCAGACATAGCATTTCCACGTATAAACAACATAAGCTTTTGACTCCTACCCCCATCACTATTACTACCTCTAGCATCATCAGGAATTGAAGCAGGAGCAGGTACAGGTTGAACAGTATATCCCCCATTAGCCGGAAACCTGGCCCACGCTGGCGCTTCAGTAGACCTA---ACTATCTTTTCCCTCCACCTAGCTGGCGTATCCTCAATCTTAGGCGCTATCAACTTCATTACTACAGCAATCAACATAAAATCCCCTGCCATATCACAATACCAAACACCCTTATTCGTATGATCTGTACTAATTACAGCTGTTCTATTACTACTCTCGCTACCAGTACTTGCTGCA---GGCATTACCATACTACTTACAGACCGAAATCTAAACACAACCTTCTTTGATCCCTCAGGGGGAGGAGACCCAATCCTATATCAACACCTATTCTGATTCTTTGGTCATCCTGAAGTATACATCTTAATCCTTCCAGGATTTGGCATAATCTCCCACATCGTCACCTATTACTCTGGTAAAAAA---GAACCATTCGGCTACATAGGAATAGTTTGAGCAATAATATCCATGGGTTTCCTGGGCTTCATCGTATGAGCCCACCACATATCCACCGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eretmochelys imbricata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 37
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bd

Version
3.1

Year Assessed
2008

Assessor/s
Mortimer, J.A & Donnelly, M. (IUCN SSC Marine Turtle Specialist Group)

Reviewer/s
Chaloupka, M., Bolten, A., Broderick, A.C., Dobbs, K., Dutton, P., Limpus, C., Miller, D.J., Musick, J., Pritchard, P.C.H., Shanker, K. & van Dijk, P.P. (IUCN SSC Marine Turtle Red List Authority)

Contributor/s

Justification

Rationale

Analysis of historic and recent published and unpublished accounts indicate extensive subpopulation declines in all major ocean basins over the last three Hawksbill generations as a result of over-exploitation of adult females and eggs at nesting beaches, degradation of nesting habitats, take of juveniles and adults in foraging areas, incidental mortality relating to marine fisheries, and degradation of marine habitats. Analyses of subpopulation changes at 25 Index Sites distributed globally (see W-Figure 1 in attached PDF) show an 84 to 87% decline in number of mature females nesting annually over the last 3 Hawksbill generations (see W-Table 1 in attached PDF). Numerous populations, especially some of the larger ones, have continued to decline since the last assessment of the species (Meylan and Donnelly 1999). Today, some protected populations are stable or increasing, but the overall decline of the species, when considered within the context of three generations, has been in excess of 80%.

Assessment Procedure:

In accord with the IUCN Red List Categories and Criteria, the Hawksbill is listed as Critically Endangered (CR A2bd) because it meets the following criteria:

A. Reduction in population size based on:

2. An observed, estimated, inferred or suspected population size reduction of >80% over the last 10 years or three generations, whichever is the longer, where the reduction or its causes may not have ceased OR may not be understood OR may not be reversible, based on (and specifying):

(b) an index of abundance appropriate to the taxon; and

(d) actual or potential levels of exploitation.

This assessment measures changes in populations based on the number of mature individuals (IUCN 2001a), specifically changes in the annual number of nesting females.

Index Sites:

Choice of Index Sites. Reliable historic data are not available for all subpopulations, so the present report quantifies population trends by examining data from 25 Index Sites (see W-Figure 1, IND-Table 1, PAC-Table 1 and ATL-Table 1 in attached PDF). Index Sites were chosen to represent broad regional subpopulation trends over time and include representative major nesting areas as well as many of the lesser nesting areas for which quantitative data are available. An estimated 41% of the current global population of nesting females is represented by index sites.

The most reliable method of monitoring trends in sea turtle populations are long-term population assessments conducted at the nesting beach (Meylan 1982) and these are used as an appropriate index of abundance for the taxon (IUCN 2001a, 2001b). But, estimating the total number of adult females in a nesting population is complicated by the fact that an individual female typically nests several times within a breeding season, and follows a non-annual breeding schedule, with intervals of two to seven years separating consecutive nesting seasons. Individuals also may be reproductively active for decades (Carr et al. 1978, FitzSimmons et al. 1995, Mortimer and Bresson 1999). Long-term monitoring is thus essential to document true population change. Few long-term studies of nesting Hawksbills exist, in part because sea turtle research did not become popular until the 1970s, and by then many populations had already been reduced to low levels (Meylan 1999).

Interpretation of long-term data can be complicated. Because Hawksbills mature slowly, an over-exploited nesting population may already be in decline for decades before the damage manifests itself as a decrease in numbers of nesting turtles on the nesting beach. Meanwhile, documented increases in numbers of nesting females must be interpreted cautiously, as they do not always reflect an absolute increase in the size of the population. In situations where protection is afforded a breeding population that previously had been subject to intense exploitation, numbers of egg clutches laid are likely to rise precipitously at the newly protected rookery. This is because, with protection, individual females survive not only to lay their full complement of egg clutches within a single nesting season, but also return to breed in subsequent seasons.

Because of the extended and complicated life cycle of the Hawksbill, to quantify only a single stage in the life cycle will not always adequately portray the true status of the entire population. For example, where over-exploitation of nesting females or eggs has impeded reproduction during long periods of time, estimates of population decline based only on numbers of nests may significantly underestimate the overall population decline at those sites because they will not reflect the absence of juvenile foraging turtles in the wider population (Mortimer 1995). Although studies on foraging grounds are useful, reliable quantitative data on the size of foraging populations, and especially historical data describing foraging populations, are generally not available. Interpretation of foraging data is further confounded by the mixing of animals from various nesting populations at the foraging grounds (Broderick et al. 1994, Encalada et al. 1996). Similarly, recent increases on some Caribbean nesting beaches demonstrate the difficulty in predicting increasing numbers of sea turtles. Although reduced effort in the Cuban Hawksbill fishery has spared more than 55,000 large animals on its foraging grounds since the early 1990s (Mortimer et al. 2007), to date regional nesting increases are still relatively small.

Data Sources for Index Sites. To assess long term changes in the nesting populations at each of the 25 Index Sites, we used several types of data sources, often in combination with each other. For sites for which data on annual numbers of nesting females are not available we used other indices of nesting abundance, including numbers of nests recorded, numbers of nesting females killed, numbers of nesting females recorded per unit of patrol effort, and numbers of egg clutches collected for human consumption or for incubation in hatcheries. At some sites, different measures of Hawksbill abundance were used, including tortoiseshell export statistics, and total numbers of slaughtered animals (including both nesting and foraging turtles). The data were derived from a multitude of sources, including published scientific and historical literature and unpublished reports. We are grateful to the numerous researchers, especially the members of the MTSG Hawksbill Task Force, who generously provided their unpublished data and the benefit of their personal experience to ensure that the most up-to-date information be included in this assessment (see Acknowledgements in the attached PDF). As noted in the text and accompanying tables, such information is recorded as in litt. citations.

Unfortunately, for sea turtles and other long-lived species, decades of long-term quantitative data are seldom available. Few Hawksbill nest-monitoring projects were carried out in the 20th Century on populations that are now depleted or remnants of their former size (Meylan 1999). Nevertheless, to estimate changes in populations over time, the contributions of historically large, but now depleted, populations needs to be considered. Where quantitative data are lacking, old naturalist’s records, historic egg collection data, and tortoise shell trade statistics are often the best source of information about populations, and can be used to estimate former abundance and subsequent declines. Unfortunately, while some excellent information about the enormous trade in tortoiseshell is available, in many areas of the world researchers will never know the full extent of the Hawksbill declines that have taken place before and during the 20th Century. For example, Hawksbills were likely found in some numbers along the eastern coasts of the Pacific and Atlantic although now they have become scarce.

Extrapolated Data For Index Sites. In the present assessment, where quantitative data are available, population abundance estimates are based on raw data, and linear and exponential extrapolation functions (IUCN 2001a). In some subpopulations, more than one trajectory was exhibited over the 3-generation interval; changes in subpopulation size are thus often based on a combination of raw data and extrapolations. If no change is believed to have occurred outside the time interval for which published abundance data are available, we use the raw data to determine the change in population size. However, when it appeared that change in subpopulation abundance occurred outside the interval for which raw data were available, we used extrapolation techniques to determine the overall change. Linear extrapolations were used when it was believed that the same amount of change occurred each year, irrespective of total subpopulation size. Exponential extrapolations were used when it was believed that change was proportional to the subpopulation size. In cases where there is a lack of information on the specific rate of change, we used both linear and exponential extrapolations to derive a population estimate. However, when either the linear or exponential function produced an obviously unrealistic number, we included the unrealistic figures in the tables summarizing estimated population change over three generations (and noted them as being unrealistic), but we did not use those unrealistic figures to estimate population changes for the ocean basin under consideration (see IND-Table 3, PAC-Table 3, and ATL-Table 3 in attached PDF).

Backward Extrapolations of Increasing Populations. Significant increases in nesting populations during the past two decades have been recorded at a number of nesting localities, particularly in the Atlantic Ocean at the following Index Sites: Antigua (JumbyBay), Barbados, Cuba (Doce Leguas Cays), Mexico (YucatanPeninsula), Puerto Rico (MonaIsland), and US Virgin Islands (Buck Island Reef National Monument). The observed population increases correlate with implementation of protective measures at these nesting sites in combination with decreased exploitation at neighbouring foraging grounds (especially in Cuba). However, most of these now-increasing populations were not monitored prior to implementation of protective measures (the presence of researchers on the beach is often a significant element of the actual protection afforded such sites).

Using only the raw data available for these now-increasing sites, it would be impossible to estimate the overall rate of population change during the past three turtle generations, since in most cases data for the protected sites are only available from the mid-1980s onward. There is no reason to doubt that these increasing populations had suffered the same sort of declines as other nesting populations in the region for which earlier data exist. Rather than eliminate these populations from the summary calculations for the ocean basin (and over-estimate the rate of decline), we incorporated these data by extrapolating backwards from 1985, using the average population trajectory calculated for all the other Index Sites in the region for which there are data prior to 1985. The results of these calculations are presented in ATL-Table 6 (in attached PDF).


Qualitative Information

Numerical historic rates of change in the sizes of nesting populations at the Index Sites describe only one aspect of the global conservation status of the Hawksbill turtle, and tend to be somewhat biased towards those subpopulations for which long-term quantitative data exist. A wealth of information also exists about the current status of many of the world's Hawksbill nesting populations, as well as the various modern-day factors, both positive and negative, affecting them. These include: a) the residual impacts from long-term tortoiseshell trade; b) current levels of purposeful slaughter and egg collection; c) incidental capture in fishing gear; d) destruction of nesting beaches caused by unregulated coastal development, oil pollution, sea level rise and accompanying erosional processes, and elevated incubation temperatures; e) damage to foraging habitat caused by sea water warming, and pollution; and f) efforts to raise awareness, and to coordinate and legislate protection. Such information is critical to a complete understanding of the current status of Hawksbill populations around the world.

For 58 countries around the world we have compiled information on current estimated population sizes and qualitative information about current trends in nesting and foraging populations, and the factors influencing them either positively or negatively (see IND-Table 5, PAC-Table 5 and ATL-Table 7 in attached PDF) The inclusion of such relatively qualitative information ensures that even those countries with the fewest resources for monitoring and enforcement can be represented in this assessment; and these areas are often the ones where greatest exploitation and declines have occurred (IUCN 2001b).

Uncertainties in the Assessment Process

As with any assessment based on historic data or small data sets, there is uncertainty relating to the final results of this report. The sources of uncertainty are rooted in the procedure itself as well as in the stochastic nature of Hawksbill biology. Both sources of uncertainty are ultimately related to a lack of information, and when dealing with an animal as long-lived as a Hawksbill, this can be a particularly acute problem.

Since the last Hawksbill assessment (Meylan and Donnelly 1999), the IUCN Standarads and Petitions Working Group have developed a system of regression equations to address population changes over time and produce estimates of previous population sizes. With care to filter out overly regressed populations, this system appears to be adequate. Scale of population change needs to be cautiously addressed: on the one hand, declines can go no lower than 100%, but potential population increases are limitless. Small population declines that may be difficult to observe annually can be devastating over several generations. For example, a hypothetical Hawksbill population numbering 1,000 females declining at a steady rate of 1% annually would have declined by 50% in only 68 years and by 75% in 135 years.

Another issue of concern is the fact that most of the increasing nesting populations in the Caribbean were included as Index Sites in this assessment, while many declining populations were not included due to lack of data. At many sites, the simple process of monitoring a population offers significant protection. Meanwhile, adjacent unprotected and unmonitored nesting sites may be suffering significant decline due to poaching and destruction of nesting habitat that are unrecorded. A case in point is that of Antigua/Barbuda, where the relatively small Jumby Bay nesting population, which has been intensely monitored since 1987, has increased by 79% (+23 turtles) during the past two decades. Meanwhile, the other 35 known Hawksbill nesting beaches of Antigua/ Barbuda neither have been afforded protection, nor has the status of their nesting populations been monitored (see ATL-Table 7 in attached PDF). We are concerned that in the Atlantic Ocean, protected populations are over-represented in our assessment, thus causing the assessment to under-estimate the true rate of regional population decline.

Seychelles, in the Indian Ocean, is one of the few places in the world where records of long-term monitoring of both protected and unprotected beaches are available (see IND-Table 4 in attached PDF). For the inner islands of Seychelles, monitoring was conducted at all 22 islands during both the early 1980s and the early 2000s. Nesting populations at the two islands that had been well-protected since the 1970s increased by 389% during a period of two decades; meanwhile, the nesting populations at 13 islands that had received no protection prior to 1994 declined by 59% during the same period. When all 22 of the inner islands are considered together, there was an overall decline of 24% in the total nesting population between the early 1980s and the early 2000s.


History
  • 1996
    Critically Endangered
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

It is very difficult to classify how endangered hawksbill turtles are because they are found throughout the world and are migratory. In some places, they may be very scarce, and in others they may thrive. Also, since there is little knowledge of their early population levels, it is very hard to know how much the populations have declined.

Currently (throughout the world), it is illegal to trade hawksbill turtle products. This should create the expansion of the turtles because their major predator, humans, will no longer be able to hunt them. In order to succeed in keeping hawksbill turtles in existence, there must be cooperation among all nations that have hawksbill populations in their waters. Free exchange of information on the turtles is needed to ensure that all nations are aware of the best and most efficient ways of keeping hawksbill turtles in existence.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

 Fairly common, but declining. The increase in tourist activities and artisanal fishing in the Red Sea is leading to growing disturbance to the nesting sites of these animals on offshore islands. Development on the mainland is reducing avail­able nesting sites. In the past stuffed animals were commonly offered to tourists, but this has subsided to a large extent.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Critically Endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1B - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widely distributed in tropical and subtropical seas, but due to heavy exploitation much less abundant than in the past, and likely still declining; at least 20,000 females nest each year; nesting locations have been reduced due to beach development and disturbance.

Intrinsic Vulnerability: Highly vulnerable

Environmental Specificity: Very narrow to narrow.

Other Considerations: Listed as Endangered by US, CITES Appendix I. Dispersed nesting has prevented (1) adequate assessment of abundance and (2) protection through the establishment of nesting preserves.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Eretmochelys imbricata , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the ICUN Red List 2007 (1). Listed on Appendix I of CITES (3), and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Generation Length

Generation length is defined as the age to maturity plus one half the reproductive longevity (Pianka 1974). Hawksbills mature very slowly, taking 20 to 40 years, and so are long-lived (Chaloupka and Musick 1997). In the Caribbean and Western Atlantic, Hawksbills may mature in 20 or more years (Boulon 1983, 1994; Diez and van Dam 2002; Krueger in litt. 2006). Age to maturity in the Indo-Pacific requires a minimum of 30-35 years (Limpus 1992; Limpus and Miller 2000; Mortimer et al. 2002, 2003). In northeastern Australia, first breeding is estimated to occur at 31-36 years for females and 38 years for males (Limpus and Miller 2000).

Data on reproductive longevity in Hawksbills are limited, but becoming available with increasing numbers of intensively monitored, long-term projects on protected beaches. During the last decade, numerous individual Caribbean Hawksbills have been recorded actively nesting over a period of 14-22 years (C.E. Diez in litt. 2006, Z. Hillis-Starr in litt. 2006, Parrish and Goodman 2006). In the Indo-Pacific Mortimer and Bresson (1999) and Limpus (1992) have reported nesting over 17-20 years, comparable to other Chelonid turtles which range from 20 to 30 years (Carr et al. 1978, FitzSimmons et al. 1995).

Given estimated ages to maturity of 25 years in the Caribbean and 35 years in the Indo-Pacific, with half of reproductive longevity estimated at 10 years, a conservative generation length of 35 years (25 + 10 years) is calculated for the Caribbean and Western Atlantic, and 45 years (35 + 10 years) in the Indo-Pacific. In analyzing the data, declines over three generations are therefore measured for up to 105 years in the Caribbean and Western Atlantic and up to 135 years in the Indo-Pacific. In fact, generation length may well have been longer in the days when population density was higher (Bjorndal et al. 2000).

Nesting Population Size and Fecundity

Sea turtle population trends are best diagnosed using in-water abundance estimates coupled with estimates of demographic parameters such as survival and recruitment possibilities (Chaloupka and Limpus 2001, Bjorndal et al. 2005). However, these data rarely exist for sea turtle populations and so most assessments are based on evaluating nesting trends, which assumes a close correlation between population trends and nesting activity (Bjorndal et al. 2005).

For this assessment the size of a nesting population is defined as the average number of individual females nesting per year. In some cases, population numbers can be determined by saturation tagging of nesting females or by recording the total number of slaughtered nesters. More often, however, population estimates need to be derived from records of the total number of egg clutches laid during a season. Saturation tagging of nesting females indicates that at most sites the average female Hawksbill lays between three and five egg clutches during a single nesting season (Richardson et al. 1999, Mortimer and Bresson 1999), with indications that newly recruited females lay fewer egg clutches (Mortimer and Bresson 1999, Beggs et al. 2006), and possibly fewer clutches in the Arabian/Persian Gulf (Pilcher 1999). Following the pattern of earlier status reviews, the present assessment calculates the annual number of nesting females by dividing the total number of egg clutches recorded, by three to five to produce a bracketed population estimate.

Population Trends and Conclusions

In many parts of the world, Hawksbill populations have continued to decline since the publication of the previous Red List Assessment (Meylan and Donnelly 1999). Continuing losses in southeast Asia are of particular concern. Hawksbills face multiple, severe threats. The volume of the tortoiseshell trade has diminished, yet it remains active and substantial, and the Japanese bekko industry remains intact.

In 2001 the IUCN Red List Standards and Petitions Subcommittee upheld the Critically Endangered listing of the Hawksbill, based on ongoing and long-term declines in excess of 80% within the time frame of three generations and ongoing exploitation (IUCN 2001b). The Subcommittee review cited “convincing evidence of reductions in excess of 80% over the last three generations at many, if not most of the important breeding sites throughout the global range of the species”. Not surprisingly, those declines reflect the intensity of the tortoiseshell trade in the 20th Century. Although some relatively large populations still exist, especially in Australia, this is not inconsistent with long-term global or even regional population reduction over three generations (a point noted by the Subcommittee). Unlike previous reviews of the status of the Hawksbill, the present assessment is quantitative and provides a numerical basis for the global listing of the species as Critically Endangered. The 2001 findings of the IUCN Red List Standards and Petitions Subcommittee are as valid today as they were six years ago.


The current assessment clearly demonstrates the importance of protection in both terrestrial and marine habitats. With protection, some populations have stabilized, and others are now increasing, most notably in the Caribbean. The increases documented in the Caribbean coincide with dramatic reductions in take on the foraging grounds of Cuba which have, in effect, spared tens of thousands of large Hawksbills since the early 1990s. Such increases provide hope for the future, but unfortunately are still the exception rather than the rule. Similar results are needed elsewhere.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: The time frame for short-term trend is long; three generations is roughly 60-120 years); on this basis the trend is a large decline.

For 42 sites rangewide for which recent trend (within the last 20 years) could be determined, 24 percent were increasing, 7 percent were stable, and 69 percent were declining (NMFS and USFWS 2007). For 11 sites for which quantitative continuous data for approximately 20 or more years were available, 6 were increasing, 4 were decreasing, and 1 was stable; however, these data are not representative of the global pattern because the sites are better protected than most areas. In general, trend is least favorable in the Pacific Ocean and most favorable in the Atlantic (NMFS and USFWS 2007).

Global Long Term Trend: Increase of 10-25% to decline of 70%

Comments: Extent of occurrence has been reduced to a small degree over the long term, but much larger reductions have occurred in population size and condition of occurrences (NMFS & USFWS 2007). For 58 sites rangewide for which long-term trend (>20 to 100 years) could be assessed, all showed a declining trend (NMFS and USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

Threats:

The most important threats to Hawksbill turtles, described here, are dealt with in greater detail in the section entitled Regional Overview (see attached PDF).

  • Tortoiseshell Trade. Recent and historical tortoiseshell trade statistics are key to understanding the enormous and enduring effect that trade has had on Hawksbill populations around the world (see IND-Table 5, PAC-Table 5 and ATL-Table 7 in attached PDF). Within the last 100 years, millions of Hawksbills have been killed for the tortoiseshell markets of Europe, the United States and Asia. The global plight of the Hawksbill in the latter half of the 20th Century has been recognized by the inclusion of the species in the most threatened category of IUCN’s Red List since 1968 and the listing of all Hawksbill populations on Appendix I of CITES, the Convention on International Trade in Endangered Species, since 1977. Nevertheless, trade continued at exceptionally high levels for years as major trading countries acceded to CITES and Japan, the world’s largest consumer of bekko (tortoiseshell), continued to import shell under a CITES reservation (exception) until 1993. During the period 1950-1992, Japan’s bekko imports were the equivalent of 1,329,044 large turtles (1,408,787 kg). Conservatively estimating that 30% of the turtles taken for the trade were nesting females, nearly 400,000 adult female Hawksbills were killed for the Japanese market in those years, a time frame that approximates a single Hawksbill generation. Significant domestic trade in Hawksbill products continues to be a major problem in many countries and, despite international and domestic prohibitions and the lessening of the volume in the last decade, trade remains an ongoing and pervasive threat in the Americas and southeast Asia (Fleming 2001, Chacón 2002, TRAFFIC Southeast Asia 2004, van Dijk and Shepherd 2004, Brautigam and Eckert 2006).

  • Egg Collection. Intense levels of egg exploitation continue in many parts of the world (see IND-Table 5 and ATL-Table 7 in attached PDF), especially southeast Asia, where it approaches 100% in many areas (see PAC-Tables 4 and 5 in attached PDF).

  • Slaughter for Meat. Adult and juvenile Hawksbills are still killed for meat in many areas (see IND-Table 5, PAC-Table 5 and ATL-Table 7 in attached PDF). In some places the meat is used by fishermen as shark bait (J. Mortimer unpubl. data, C. Lagueux, unpubl. data). Fishermen who target lobster and reef fish will commonly take whatever hawksbills they encounter (Carr and Meylan 1980).

  • Destruction of Nesting Habitat. Tropical coastlines are rapidly being developed for tourism which often leads to destruction of nesting habitat (see IND-Table 5, PAC-Table 5 and ATL-Table 7 in attached PDF). Because Hawksbills prefer to nest under vegetation they are particularly impacted by beach-front development and clearing of dune vegetation. Daytime nesting Hawksbills in the Western Indian Ocean are particular sensitive to disturbance from human activity on the coast and in nearshore waters (Mortimer 2004). In other parts of the world such as the Middle East and Western Australia gas and oil refineries seriously disrupt nesting habitat (see IND-Table 5 and PAC-Table 5 in attached PDF).

  • Destruction of Foraging Habitat. Hawksbills are typically associated with coral reefs, which are among the world’s most endangered marine ecosystems (Wilkinson 2000). Climate change has led to massive coral bleaching events with permanent consequences for local habitats (Sheppard 2006) (see IND-Table 5, PAC-Table 5 and ATL-Table 7 in attached PDF).

  • Hybridisation of Hawksbills with Other Species. At certain sites where Hawksbill numbers are particularly low, they regularly hybridise with other species of sea turtles (see ATL-Table 7 in attached PDF).

  • Entanglement and Ingestion of Marine Debris - including Fishing Gear. Hawkbills are particularly susceptible to entanglement in gill nets (see IND-Table 5, PAC-Table 5 andATL-Table 7 in attached PDF) and capture on fishing hooks (Mortimer 1998). Juvenile Hawksbills comprised 47% of all turtles entangled in derelict fishing nets and other debris in northern Australian waters (Kiessling 2003, White 2004). Ingestion of marine debris by Hawksbills is also significant (White 2004).

  • Oil Pollution. There is evidence oil pollution has a greater impact on Hawksbills than on other species of turtle (Meylan and Redlow 2006). In some parts of the world (especially the Middle East) oil pollution is a major problem (see IND-Table 5 in attached PDF).


Tortoiseshell Trade Overview

History of the Trade

Tortoiseshell, the beautiful scutes of the carapace and plastron of the Hawksbill turtle, has been prized since ancient times. Surrounded by legend, tortoiseshell has been described as “one of the romantic articles of commerce, not only because of where it comes from, but because of the creatures from which it is obtained and the people engaged in the trade” (quoted in Parsons 1972). Jewellery and other tortoiseshell objects have been unearthed from pre-dynastic graves of the Nubian rulers of Egypt and excavated from the ruins of the Han Empire which ruled China in pre-Christian times. Over 2,000 years ago Julius Caesar considered the warehouses of Alexandria brimming with tortoiseshell to be the chief spoil of his triumph. By the early years of the 9th Century, caravans of Arab traders carried rhinoceros horn, ivory, and tortoiseshell throughout the Indian Ocean. For the next 1,000 years, the tortoiseshell trade flourished (Parsons 1972). Around 1700, during the Edo Period, the bekko (tortoiseshell) artisans of Japan established themselves at Nagasaki (Milliken and Tokunaga 1987).

The tortoiseshell trade has been closely linked to European discovery, conquest, and commerce around the world. The Portuguese, Dutch, French and English played major roles in the global trade; exploitation occurred throughout the world’s tropical oceans, and especially in the East Indies (i.e., modern day India, Indo China, Indonesia, Malaysia, and Philippines). The East Indies were a major source of the shell of antiquity, and these rich waters fittingly have been called the world’s most productive seas for tortoiseshell (Parsons 1972). In the insular Pacific international trade did not develop until the mid 19th Century, but once established, it took a tremendous toll on the region’s Hawksbills. For the next 150 years, tortoiseshell was a prized commodity in the Pacific, first with the sandal-wooders and then with the whalers (McKinnon 1975).

European Hawksbill fishing in the Caribbean began in the mid-17th Century and intensified throughout the 18th Century as demand increased (McClenachan et al. 2006). As they decimated local Hawksbill populations in one area after another, turtle fishermen moved from one site to the next. The plentiful Hawksbill resources of Central America were exploited for more than 100 years by traders, including Americans, who established the town of Bocas del Toro on the coast of Panama in 1826 (Parsons 1972). Turtling was still a lucrative business in Cuba in 1885 when the village of Cocodrilos on the Isle of Pines was settled by turtle fishermen who emigrated from the Cayman Islands after its Hawksbills were gone (Carrillo et al. 1999). Over the next 100 years, many tens of thousands of Hawksbills were captured in the rich foraging grounds of the Cuban shelf.

20th Century Trade

Tortoiseshell trade statistics are key to understanding the enormous and enduring effect that trade has had on Hawksbill populations around the world. In the early 20th Century, tortoiseshell was imported for luxury markets in Europe, the United States and Asia as the manufacture of combs and brushes, jewellery boxes, and tortoiseshell ornaments was “an established industry in almost every civilized country” (Seale 1917). Declines in Hawksbill populations were obvious in many areas by the first part of the century, as exemplified by expressions of “wanton destruction” in the Virgin Islands (Schmidt 1916) and over exploitation in the Dutch East Indies (now Indonesia) (Dammerman 1929). Although existing records document an extensive trade in many countries, such as the 8,000 Hawksbills (8,000 kg) taken annually in the Philippines for the shell trade to Japan during World War I (Seale 1917) and 160,700 Hawksbills killed between 1918-1927 in the Dutch East Indies for export to Japan, Singapore and the Netherlands (Dammerman 1929), records for many other areas are incomplete.

During the 20th Century, Japan was the world’s largest importer of tortoiseshell (Milliken and Tokunaga 1987, Groombridge and Luxmoore 1989). Although data are not available for imports in the first half of the century, Japanese statistics document the import of shell equivalent to more than 1.3 million large Hawksbills from around the world between 1950-1992 and more than 575,000 stuffed juveniles from Asia between 1970-1986 (Milliken and Tokunaga 1987, Groombridge and Luxmoore 1989). Local trade in stuffed Hawksbills also flourished in the Indian Ocean, the Pacific and the Americas, especially in tourist areas. When Japanese, European, American and other Asian imports are considered along with the large quantities of tortoiseshell used locally in places like Sri Lanka and Madagascar, it is readily apparent that some millions of Hawksbills were killed for the tortoiseshell trade in the last 100 years.

Hawksbills and CITES

In 1975, in recognition of its threatened status, the Hawksbill was included on Appendices I (Atlantic population) and II (Pacific population) of CITES, the Convention on International Trade in Endangered Species of Wild Fauna and Flora, when the Convention came into force. By 1977 the entire species was moved to Appendix I to prohibit all international trade. Nevertheless, the global trade continued for a number of years, in large part driven by Japanese demand. At the end of 1992, Japanese imports ceased, but the industry continues to operate with stockpiled material.

  • In the late 1970s more than 45 countries were involved in exporting and importing raw shell, with annual Japanese imports the equivalent of about 37,700 turtles (40,000 kg).

  • Export and import levels remained exceptionally high until the mid-1980s as major trading nations slowly joined CITES. When they acceded to CITES in 1978, France and Italy took reservations (exceptions) to the Appendix I Hawksbill listing; these reservations were withdrawn in 1984 when they joined the EU.

  • When Japan acceded to CITES in 1980, it also took a reservation on the Hawksbill and reduced its annual quota to the equivalent of 28,300 turtles (30,000 kg), based solely on the needs of its bekko industry.

  • In 1985 CITES proposals by Indonesia and the Seychelles to place their Hawksbill populations on Appendix II to allow trade failed at the 5th CITES Conference of the Parties (COP 5). A similar Indonesian proposal at COP 6 in 1987 was withdrawn before the vote.

  • A comprehensive report on the Japanese sea turtle trade by Milliken and Tokunaga in 1987 documented significant amounts of bekko trade with CITES countries. From 1980 to 1985, between 42% and 58% of all bekko imports originated in CITES countries, without proper export documents.

  • In 1989 a detailed report commissioned by the CITES Secretariat found that Hawksbill populations were depleted or declining in 56 of 65 geopolitical units for which data were available and estimated that the annual global nesting population was a minimum of 15,000-25,000 Hawksbills. The authors concluded that the listing of the species on Appendix I was “unquestionably appropriate and must be maintained” (Groombridge and Luxmoore 1989).
  • On 1 April 1990, Japan reduced its annual bekko quota to the equivalent of 18,870 turtles (20,000 kg,). In 1991, in an effort to avoid a U.S. embargo of its fish and fishery products, Japan agreed to further reduce its annual quota to the equivalent of 7,075 turtles (7,500 kg) by August 1991, to establish a zero quota on 1 January 1993, and to drop its Hawksbill reservation in July 1994. Japan also agreed to support the re-training of hundreds of bekko artisans. In the early 1990s, in response to the end of the Japanese trade, Cuba reduced its annual Hawksbill fishery quota from 5,000 turtles to 500.

  • Since 1994, officials in Seychelles and Zanzibar have acquired tortoiseshell stocks from local artisans and subsequently burned them to demonstrate a commitment to ending the tortoiseshell trade (Khatib et al. 1996, Mortimer 1999). Cape Verde has shown similar commitment (Fretey et al. 2002).

  • In 1997 and 2000, at CITES COP 10 and COP 11, Cuba proposed to sell its stockpiled tortoiseshell to Japan, and also proposed a continuation of the international trade in tortoiseshell taken from the 500 Hawksbills still captured each year. All these proposals failed.

  • In response to regional disagreement generated by Cuban interest in moving Caribbean Hawksbills from Appendix I to II, the CITES Secretariat convened two regional Hawksbill dialogues in 2001 and 2002. The Dialogues encouraged regional cooperation by helping to establish Hawksbill priorities. As a result, resources for research, management and conservation have been generated.

  • Although the tortoiseshell trade continues to threaten Hawksbills in numerous places, overall volume is substantially reduced. Thirty years after CITES came into force, the ban on international trade demonstrates its value over time in protecting Hawksbills. Above all, nesting increases in the Caribbean coincide with the enormous reduction in Hhawksbill fishing in Cuban waters.
  • In June 2007, Cuba informed CITES COP 14 that it would voluntarily institute a moratorium on its sea turtle fisheries in 2008. Although Cuba has a CITES Hawksbill reservation (exception) and reserves its right to dispose of its tortoiseshell stockpile, most nations are members of CITES and therefore cannot legally trade in tortoiseshell.

The Japanese Tortoiseshell Trade

Twenty years ago, in their landmark report on Japan’s sea turtle trade, Milliken and Tokunaga (1987) focused on providing estimates of the numbers of Hawksbills (and other species of sea turtles) represented by trade data so that the effect of Japanese exploitation around the world could be assessed. In particular, they cautioned that past exploitation is relevant to understanding and predicting current sea turtle population trends.

Estimates of the numbers of Hawksbills involved in the tortoiseshell trade are based on conversion factors calculated for each region by Milliken and Tokunaga (1987). Globally, the average Hawksbill produces 1.06 kg of tortoiseshell; but regionally, conversions are 0.74 kg in the Indian Ocean; 0.75 kg in Asia; 0.88 kg in Oceania; and 1.34 kg in the Caribbean. A combination of factors likely accounts for these differences, including regional variation in average adult size, as well as the relative proportion of adult and immature turtles represented in the trade. Some reports indicate that in the past the average turtle produced more shell than in recent decades. Adult turtles that survive long enough will continue to grow, so it follows that the average size of nesting animals tends to decline in an over-exploited population. In other cases, once nesting populations have been destroyed, hunters may shift their focus to foraging turtles which usually include immature animals. In the absence of specific historical information documenting the size classes of animals killed, the conversions we use in the present assessment are based on estimates provided by Milliken and Tokunaga. Based on the trade through 1992 (when legal Japanese imports ceased), the following information reveals the extent of the Japanese exploitation of global Hawksbill populations and the percent contribution of different regions to overall imports during 1950-1992.

  • Caribbean and Latin America (44.2%): 29 countries provided the shell of 460,220 turtles (616,695 kg). Exports from Panama and Cuba were the equivalent of 152,070 and 106,948 turtles (203,774 kg and 170,047 kg, respectively), making them the most important sources of bekko in the world for Japan. Panama hosted the region’s largest nesting Hawksbill assemblages until the latter part of the 20th Century. After 1961, Hawksbills in the Cuban trade were captured only at sea, but comprised adult and large immature animals.

  • Asia (20.8%): 9 countries provided the shell of 387,020 turtles (290,265 kg). Exports from Indonesia were the equivalent of 155,654 turtles (116,741 kg), making it the most important source in the region and the third largest global supplier to Japan. Much of the shell exported from Singapore to Japan was probably of Indonesian origin (118,535 turtles, 88,901 kg). Asia was nearly the sole source of Japan’s stuffed juvenile Hawksbill imports, as discussed below.

  • North America (15.1%): the United States provided Japan with the shell of 199,490 turtles (211,463 kg) in two very large shipments, 142,241 kg in 1951 and 68,402 in 1954. The countries of origin are unknown, but in all likelihood some quantity originated in U.S. Caribbean and Pacific territories.

  • Indian Ocean and East Africa (8.7%): 15 countries provided the shell of 164,828 turtles (121,973 kg). Kenya and Tanzania, regional collection points, were the major exporters. Countries in the northwestern Indian Ocean are notably absent from Japanese import statistics. As a non-CITES country, Maldives figured prominently in the trade after 1984 despite its national legislation protecting Hawksbills. Japanese imports therefore were in contravention of CITES Conf. Res. 4.25, which requires a nation with a reservation to treat an Appendix I species as Appendix II, with valid export documents from the country of origin.

  • Oceania (5.8%): 6 countries provided the shell of 92,124 turtles (81,069 kg). A significant proportion of this trade is attributed to Australia until 1977 (29,109 turtles; 25,616 kg). Solomon Islands and Fiji were also important suppliers, especially in the final years of trading, with 40,982 and 14,490 turtles (36,064 and 12,751 kg, respectively). Fiji banned all tortoiseshell exports in January 1991 (Daly, 1991) but domestic tourist trade in Hawksbill curios and whole carapaces continues (see PAC-Table 5 in attached PDF).
  • Europe and West Africa (5.4%): 10 countries provided the shell of 70,560 turtles (74,793 kg). The Netherlands was the largest exporter with the equivalent of 44,775 turtles (47,461 kg), but the source of this shell is unknown.

  • In the 1970s, small lacquered Hawksbills became popular in Japan as symbols of long life. From 1970-1986 Japan imported 576,702 juvenile Hawksbills, mostly from Indonesia and Singapore but also from Taiwan, Province of China (32,075), the Ryukyus (13,438), Philippines (8698), Viet Nam (1195), Hong Kong (3549), and small quantities from a handful of other nations. Japan subsequently prohibited the trade, but continued to allow dealers to sell stocks acquired before July 1994. In December 1999, the dealers reported that they had a total of 135 stuffed sea turtles (TRAFFIC East Asia-Japan 2000).

  • Numerous irregularities in bekko imports occurred in the final years of Japan’s trade under its CITES reservation. These included imports of shell from non-CITES countries that did not legally allow export of shell, as well as imports from countries known to have had too few turtles to supply the shell attributed to them. Based on these data, Japanese bekko imports from 11 of the 14 countries reported by the dealers in 1989 were illegal.

  • The bekko stockpile in Japan includes raw shell and finished products. After Japan banned all imports in January 1993, annual Japanese domestic sales from stockpiled supplies remained high. Between July 1995 and July 1998 the stockpile was reduced from 188.4 to 102.73 tonnes (TRAFFIC East Asia-Japan 2000). Information on subsequent annual sales and use is not available, but supplies would now be exhausted if utilization had continued at 28 tonnes a year after July 1998.
  • Today, however, the bekko industry is intact, and Japanese consumer demand remains high. In January 2000, the valuable raw shell from abdominal plates ranged in price from JPY 30,000 per kg to JPY 150,000 per kg (US $ 294-$1470 at that time) (TRAFFIC East Asia-Japan 2000).

21st Century Global Trade

Significant domestic trade in Hawksbill products is a major problem in many countries and, despite prohibitions on international trade and a reduction in its volume in the last decade, international and domestic trade remains an ongoing and pervasive threat in the Americas, Asia, and parts of Africa (Fleming 2001, Chacon 2002, TRAFFIC Southeast Asia 2004, van Dijk and Shepherd 2004, Brautigam and Eckert 2006, Reuter and Allan 2006).

  • Some Japanese dealers have continued to import shell illegally as evidenced by numerous bekko shipments intercepted en route to or in Japan since the ban took effect (TRAFFIC East Asia-Japan 2000) and ongoing underground trade in southeast Asia to Japan and other destinations (van Dijk and Shepherd 2004, TRAFFIC Southeast Asia 2004).
  • More than a decade after the Japanese prohibition on bekko imports took effect, van Dijk and Shepherd (2004) reported the interest of the Japan Bekko Association in acquiring Indonesia’s remaining stockpiles of bekko.
  • Although the volume of trade in Indonesia diminished significantly between 1991 and 2001, it is still substantial. The collection of tortoiseshell still occurs in numerous places, with most of the trade appearing to be disorganized and underground. Western Sumatra, Nias, and Papua are areas where significant exploitation and trade are known or suspected (van Dijk and Shepherd 2004).
  • Those familiar with the trade warn that Indonesian stockpiles should be seized “as any indication of resumption of international trade of bekko could lead to requests from Indonesian traders to be allowed to sell their stockpiles” (van Dijk and Shepherd 2004).
  • Surveys in Viet Nam in 2002 revealed an active international trade in tortoiseshell that had increased since 1999. Shell was purchased by tourists and foreigners buying in bulk for export to Hong Kong, Japan, South Korea, Taiwan (Province of China), Thailand, China and Asian communities in North America and Europe. Viet Nam subsequently instituted full protection for the Hawksbill (van Dijk and Shepherd 2004, TRAFFIC East Asia 2004).

  • In recent reviews of the Lesser Antilles, Dominican Republic, Central America, Colombia and Venezuela, researchers provided evidence of extensive clandestine trade in sea turtles, including Hawksbills. Management and law enforcement are inadequate throughout the region (Brautigam and Eckert 2006, Reuter and Allan 2006).

  • On 1 February 2007, the Kyodo News of Japan reported that Cuba would not seek to re-open the international tortoiseshell trade at the upcoming CITES meeting and noted Japanese disappointment given the long term support provided for the bekko industry. During 1991-2006, the Japanese government spent 735 million yen (US $6M) for research on Hawksbill resources and 140 million yen (US $1.1M) for projects to resume international trade, including trade with Cuba. The article also reported that the Ministry of Economy, Trade and Industry will support the bekko industry for another five years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Greatest threat is harvest for commerical (e.g., tortoiseshell trade) and subsistence (meat, eggs,) purposes (NMFS and USFWS 2007). Over the past 100 years, millions of hawksbills have been killed to supply the tortoiseshell trade. Due to extensive movements of this species, significant harvests in one location can affect populations in other locations (NMFS and USFWS 2007). Other significant threats include destruction/degradation of breeding locations by beach development and illumination, incidental take in fisheries, increased exposure to heavy metals and other contaminants (e.g., from oil tanker discharges) in some regions, entanglement in persistent marine debris (Meylan 1992), and hybridization with other sea turtle species in some areas (NMFS and USFWS 2007). Also, climate warming and imperfect egg hatchery strategies may be increasing bias in sex ratios (NMFS and USFWS 2007), but the overall severity of this threat is uncertain.

See USFWS (1998) and NMFS and USFWS (2007) for detailed information on threats, including beach erosion, beach armoring, beach nourishment, sand mining, artificial lighting, beach cleaning, increased human presence, recreational beach equipment, predation, and poaching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Global numbers are very difficult to estimate but it appears that this turtle has suffered drastic decline, probably by as much as 80 percent over the last century (1) (8). Major threats to survival come from illegal trade in the turtle's prized shell, known as tortoiseshell, which has been sought for jewellery and ornaments for centuries. There is also a substantial market for eggs, meat and even stuffed juveniles as exotic gifts in some parts of the world (11). Additional pressure on the global population comes from harvests to support traditional customs, the loss of nesting sites, accidental entanglement in fishing lines and the deterioration of coral reef systems which act as feeding sites for these turtles (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

The hawksbill turtle is critically endangered! Some think that its population size has decreased by 80% in the last 100 years. Because its shell is so beautiful, people have been hunting it for thousands of years, using its shell in jewelry and for decorations. Since it’s on the endangered species list, it is now illegal to buy and sell the shell of the hawksbill turtle, but some people still try to sell its shell on the black market. There are many projects to try and protect it; one is the Sea Turtle Restoration Project.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The measures briefly described below are dealt with in greater detail in the Regional Overviews (see attached PDF).

  • Treaties and Agreements. Hawksbills benefit globally from inclusion in CITES, the Convention on International Trade in Endangered Species of Wild Fauna and Flora (listed on Appendix I) and CMS, the Convention on Migratory Species (listed on Appendices I and II). Regional agreements also help to conserve Hawksbills and their habitats (see Regional Summaries, Appendix II).
  • Public Awareness. Interest in Hawksbills and other species of marine turtles is at an all-time high around the world. Interest in ecotourism is growing.
  • Capacity building. Increasing numbers of biologists and conservationists focusing on sea turtles around the world benefit hawksbills.
  • Protected Areas. Nesting and foraging sanctuaries protect Hawksbills although effective enforcement remains an elusive goal in many.
  • Legislation and Enforcement. Numerous countries have temporarily or permanently banned all exploitation of sea turtles and their eggs and are attempting to improve enforcement of international bans on the tortoiseshell trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Some basic needs are as follows: conduct population monitoring; protect, manage, and restore nesting populations and habitats; enforce laws to eliminate poaching and harassment; prevent egg and hatchling predation on beaches, including control or elimination of exotic nuisance species; ensure that beach nourishment and coastal construction activities are planned to avoid disruption of nesting and hatching; enact stronger restrictions on beachfront lighting, OCS oil drilling, etc. See recovery plan for U.S. Pacific populations (NMFS 1998).

See NMFS (Federal Register, 19 December 1996, pp. 66933-66947) for recent amendments to regulations pertaining to the use of turtle excluder devices along the Gulf and Atlantic coasts of the southeastern U.S.

See USFWS (1998) for detailed information on recovery and management needs.

Management Research Needs: Investigate life history, including movement patterns.

Biological Research Needs: In many parts of the range, better information is needed on age to maturity, reproductive output, oceanic phase of small juveniles, and at-sea mortality in fisheries (NMFS and USFWS 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Several (4-12) occurrences appropriately protected and managed

Comments: A small percentage of nesting sites are adequately protected. NMFS (1998) designated critical habitat in the vicinity of Isla Mona and Isla Monito, Puerto Rico, seaward to 5.6 km.

Needs: This species would benefit from a ban on international commercial trade of shells. Most nesting beaches and adjacent land and waters need better protection from human disturbance. Year-round use of TEDs (turtle excluder devices) would be beneficial in some areas.

Frazer (1992) emphasized the primary need for clean and productive marine and coastal environments; installation of turtle excluder devices in shrimp trawl nets and use of low pressure sodium lighting on beaches were suggested as appropriate sea turtle conservation technologies, whereas headstarting, captive breeding, and hatcheries were regarded as ineffective at best. In Florida, marine pollution control and protection of coral reefs are needed (Meylan 1992). Mrosovsky (2000) argued that allowing sustainable trade would promote conservation better than would protection, but Robinson and Thorbjarnarson (2000) reported that Mrosovsky did not provide convincing support for a sustainable-use program.

See recovery plans for Atlantic and Pacific populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

International trade in the hawksbill turtle is banned amongst signatory nations by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3), but extensive illegal trafficking still occurs between CITES signatories and among other nations. Preventing this black market trade is the key to saving this species and TRAFFIC (the wildlife trade monitoring arm of WWF and IUCN-World Conservation Union) is involved in monitoring and highlighting this problem (13). In 1988, the government of the Seychelles took a very public stand against tortoiseshell trade by burning a stockpile of seized shells (4), in a manner reminiscent of burning ivory pyres in Kenya. Action to save the world's turtles is being taken by many international bodies and recent increases in hawksbill nesting populations have been observed at a few well-protected sites (10). With successful monitoring of populations and a decrease in illegal trade, the hawksbill may respond well to long-term protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Eretmochelys imbricata on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

For years, humans have hunted the hawksbill turtles in order to sell their scutes. Also, humans eat the turtles as well as their eggs.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: This species is the source of commercial tortoise shell; exploitation increased during the 1970s (Mack et al. 1982); see Luxmoore and Canin (1985) for information on international trade in shell in the late 1970s and early 1980s. Many juveniles are killed for trade in stuffed animals. Japan is the largest market for tortoise shell products and stuffed turtles; major exporters of shell in 1988 were the Maldives, Jamaica, Cuba, Haiti, the Comoros Islands, Fiji, and the Solomons (Matthews and Moseley 1990). Japan agreed to phase out its trade in endangered species of sea turtles by the end of 1992 (End. Sp. Tech. Bull. 16[7-8]:4). Eggs (and adults) are harvested for human consumption in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: See NMFS and USFWS (2007) for a summary of international and and national regulations and conventions that may provide a degree of protection to this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hawksbill sea turtle

The hawksbill sea turtle (Eretmochelys imbricata) is a critically endangered sea turtle belonging to the family Cheloniidae. It is the only extant species in its genus. The species has a worldwide distribution, with Atlantic and Pacific subspecies. E. imbricata imbricata is the Atlantic subspecies, while E. imbricata bissa is found in the Indo-Pacific region.[2]

The hawksbill's appearance is similar to that of other marine turtles. It has a generally flattened body shape, a protective carapace, and flipper-like arms, adapted for swimming in the open ocean. E. imbricata is easily distinguished from other sea turtles by its sharp, curving beak with prominent tomium, and the saw-like appearance of its shell margins. Hawksbill shells slightly change colors, depending on water temperature. While this turtle lives part of its life in the open ocean, it spends more time in shallow lagoons and coral reefs.

Human fishing practices threaten E. imbricata populations with extinction. The World Conservation Union. classifies the Hawksbill as critically endangered.[1] Hawksbill shells are the primary source of tortoise shell material, used for decorative purposes. The Convention on International Trade in Endangered Species outlaws the capture and trade of hawksbill sea turtles and products derived from them.[3]

Contents

Anatomy and morphology

E. imbricata has the typical appearance of a marine turtle. Like the other members of its family, it has a depressed body form and flipper-like limbs adapted for swimming.

Photo from above of swimming turtle, with four outstretched flippers and faceted shell
E. imbricata. The carapace's serrated margin and overlapping scutes are evident in this individual.

Adult hawksbill sea turtles have been known to grow up to 1 metre (3 ft) in length, weighing around 80 kilograms (180 lb) on average. The heaviest hawksbill ever captured was measured to be 127 kilograms (280 lb).[4] The turtle's shell, or carapace, has an amber background patterned with an irregular combination of light and dark streaks, with predominantly black and mottled brown colors radiating to the sides.[5]

The hawksbill sea turtle has several characteristics that distinguish it from other sea turtle species. Its elongated, tapered head ends in a beak-like mouth (from which its common name is derived), and its beak is more sharply pronounced and hooked than others. The hawksbill's arms have two visible claws on each flipper.

Profile photo of animal head with prominent beak protruding above lower jaw. Faceted head covering surrounds eye
A close-up of the hawksbill's distinct beak

One of the hawksbill's more easily distinguished characteristics is the pattern of thick scutes that make up its carapace. While its carapace has five central scutes and four pairs of lateral scutes like several members of its family, E. imbricata's posterior scutes overlap in such a way as to give the rear margin of its carapace a serrated look, similar to the edge of a saw or a steak knife. The turtle's carapace has been known to reach almost 1 metre (3 ft) in length.[6]

Hawksbill sea turtles' sand tracks are asymmetrical, because they crawl on land with an alternating gait. By contrast, the green sea turtle and the leatherback turtle crawl rather symmetrically.[7][8]

Due to its consumption of venomous cnidarians, hawksbill sea turtle flesh can become toxic.[9]

Distribution

Hawksbill sea turtles have a wide range, found predominantly in tropical reefs of the Indian, Pacific, and Atlantic oceans. Of all the sea turtle species, E. imbricata is the one most associated with tropical waters. Two major subpopulations are acknowledged to exist, the Atlantic and Indo-Pacific subpopulations.[10]

World map showing concentrated nesting sites in the Caribbean and northeast coast of South America. Many other sites are spread across South Pacific islands, with other concentrations in the Red Sea and Persian Gulf, China's East coast, Africa's southeast coast and Indonesia.
Another model of the possible distribution of E. imbricata. Red circles represent known major nesting sites. Yellow circles are minor nesting sites.

Atlantic subpopulation

Photo of turtle swimming with extended flippers
A hawksbill sea turtle in Saba, Netherlands Antilles

In the Atlantic, E. imbricata populations range as far west as the Gulf of Mexico and as far southeast as the Cape of Good Hope in South Africa.[10][11][12] They live off the Brazilian coast (specifically Bahia) through southern Florida and the waters off Virginia.[4] The species' range extends as far north as the Long Island Sound and Massachusetts[13] in the west Atlantic and the frigid waters of the English Channel in the east (the species' northernmost sighting to date).

In the Caribbean, the main nesting beaches are in the Lesser Antilles, Barbados[14] Guadeloupe,[15] Puerto Rico (Mona Island), Tortuguero in Costa Rica,[16] and in the Yucatan. They feed in the waters off Cuba[17] and around Mona Island near Puerto Rico[18] among other places.

Indo-Pacific subpopulation

In the Indian Ocean, hawksbills are a common sight along the east coast of Africa, including the seas surrounding Madagascar and nearby island groups, and all the way along the southern Asian coast, including the Persian Gulf, the Red Sea, and the coasts of the Indian subcontinent and Southeast Asia. They are present across the Indonesian archipelago and northern Australia. The Pacific range of E. imbricata is limited to the ocean's tropical and subtropical regions. In the west, it extends from the southwestern tips of the Korean Peninsula and the Japanese Archipelago down to northern New Zealand.

The Philippines hosts several nesting sites, including the island of Boracay.[19] A small group of islands in the southwest of the archipelago has been named the "Turtle Islands" because two species of sea turtle nest there, including E. imbricata (along with green turtle|C. mydas, the green turtle).[20] In Hawaii, hawksbills mostly nest on the "main" islands of Oahu, Maui, Molokai, and Hawaii.[21] In Australia, E. imbricata are known to nest on Milman Island in the Great Barrier Reef.[22] Hawksbill sea turtles nest as far west as Cousine Island in the Seychelles, where the species has been legally protected since 1994 and the population is showing some recovery[23] . The Seychelles' inner islands and islets, such as Aldabra, are popular feeding grounds for immature hawksbills.[8][24]

Eastern Pacific subpopulation

In the eastern Pacific hawksbills are known to occur from the Baja peninsula in Mexico south along the coast to southern Peru.[10] Nonetheless, as recently as 2007 the species had been considered largely extirpated in the region[25]. Important remnant nesting and foraging sites since been discovered in Mexico, El Salvador, Nicaragua, and Ecuador, providing new opportunities for research and conservation. In contrast to their traditional roles in other parts of the world, where hawksbills primarily inhabit coral reefs and rocky substrate areas, in the eastern Pacific hawksbills tend to forage and nest principally in mangrove estuaries, such as those present in the Bahia de Jiquilisco (El Salvador), Gulf of Fonseca (Nicaragua, El Salvador and Honduras), Estero Padre Ramos (Nicaragua), and the Gulf of Guayaquil (Ecuador)[26]. Multi-national initiatives such as the Eastern Pacific Hawksbill Initiative are currently pushing efforts to research and conserve the population, which remains poorly understood.

Ecology

Habitat

Adult hawksbill sea turtles are primarily found in tropical coral reefs. They are usually seen resting in caves and ledges in and around these reefs throughout the day. As a highly migratory species, they inhabit a wide range of habitats, from the open ocean to lagoons and even mangrove swamps in estuaries.[6][27] While little is known about the habitat preferences of early-life stage E. imbricata, like other sea turtle young, they are assumed to be completely pelagic, remaining at sea until they mature.[28]

Feeding

Photo of swimming turtle with extended head
E. imbricata in a coral reef in Venezuela

While they are omnivorous, sea sponges are the principal food of hawksbill sea turtles. Sponges constitute 70–95% of their diets in the Caribbean. However, like many spongivores, E. imbricata feed only on select species, ignoring many others. Caribbean hawksbill populations feed primarily on the orders Astrophorida, Spirophorida, and Hadromerida in the class Demospongiae.[29] Select sponge species known to be fed on by these turtles include Geodia gibberosa.[4]

Aside from sponges, hawksbills feed on algae and cnidarians comb jellies and other jellyfish and sea anemones.[6] The hawksbill also feeds on the dangerous jellyfish-like hydrozoan, the Portuguese Man o' War (Physalia physalis). Hawksbills close their unprotected eyes when they feed on these cnidarians. The Man o' War's stinging cells cannot penetrate the turtles' armored heads.[4]

E. imbricata are highly resilient and resistant to their prey. Some of the sponges eaten by hawksbills, such as Aaptos aaptos, Chondrilla nucula, Tethya actinia, Spheciospongia vesparium, and Suberites domuncula, are highly (often lethally) toxic to other organisms. In addition, hawksbills choose sponge species that have a significant amount of siliceous spicules, such as Ancorina, Geodia, Ecionemia, and Placospongia.[29]

Life history

Photo of swimming turtle
Young E. imbricata from Réunion Island

Not much is known about the life history of E. imbricata.[30] The life history of sea turtles can be divided into three phases, namely the pelagic phase running from hatching to about 20 cm, the benthic phase, when the immature turtles recruit to foraging areas and the reproductive phase when turtles reach sexual maturity.[31][32] The pelagic phase possibly lasts 1 to 4 years.[33][34] Hawksbills show a degree of fidelity after recruiting to the benthic phase,[35] however movement to other similar habitats is possible.[36]

Breeding

Hawksbills mate biannually in secluded lagoons off their nesting beaches in remote islands throughout their range. Mating season for Atlantic hawksbills usually spans April to November. Indian Ocean populations such as the Seychelles hawksbill population, mate from September to February.[8] After mating, females drag their heavy bodies high onto the beach during the night. They clear an area of debris and dig a nesting hole using their rear flippers. The female then lays a clutch of eggs and covers them with sand. Caribbean and Florida nests of E. imbricata normally contain around 140 eggs. After the hours-long process, the female then returns to the sea.[6][11]

The baby turtles, usually weighing less than 24 grams (0.85 oz) hatch at night after around two months. These newly emergent hatchlings are dark-colored, with heart-shaped carapaces measuring around 2.5 centimeters (0.98 in) long. They instinctively walk into the sea, attracted by the reflection of the moon on the water (possibly disrupted by light sources such as street lamps and lights). While they emerge under the cover of darkness, baby turtles that do not reach the water by daybreak are preyed upon by shorebirds, shore crabs, and other predators.[6]

Photo of small turtle walking across sand
E. imbricata hatchling in Puerto Rico

Early life

The early life history of juvenile hawksbill sea turtles is unknown. Upon reaching the sea, the hatchlings are assumed to enter a pelagic life stage (like other marine turtles) for an undetermined amount of time. While hawksbill sea turtle growth rates are not known, when E. imbricata juveniles reach around 35 centimeters (14 in) they switch from a pelagic life style to living on coral reefs.

Maturity

Hawksbills evidently reach maturity after thirty years.[11] They are believed to live from thirty to fifty years in the wild.[37] Like other sea turtles, hawksbills are solitary for most of their lives; they meet only to mate. They are highly migratory.[30] Because of their tough carapaces, adults' only predators are sharks, estuarine crocodiles, octopuses, and some species of pelagic fish.[30]

A series of biotic and abiotic cues, such as individual genetics, foraging quantity and quality [38] or population density, may trigger the maturation of the reproductive organs and the production of gametes and thus determine sexual maturity. Like many reptiles, it is highly unlikely that all marine turtles of a same aggregation reach sexual maturity at the same size and thus age.[39] Age at maturity has been estimated between 10[40] and 25 years[41] for Caribbean hawksbills. Turtles nesting in the Indo-Pacific region may reach maturity at a minimum of 30 to 35 years.[42][43]

Evolutionary history

Within the sea turtles, E. imbricata has several unique anatomical and ecological traits. It is the only primarily spongivorous reptile. Because of this, its evolutionary position is somewhat unclear. Molecular analyses support placement of Eretmochelys within the taxonomic tribe Carettini, which includes the carnivorous loggerhead and ridley sea turtles, rather than in the tribe Chelonini, which includes the herbivorous green turtle. The hawksbill probably evolved from carnivorous ancestors.[44]

Etymology and taxonomic history

Fanciful drawing showing 7 turtles, with a variety of carapaces and body shapes
hawksbill sea turtle (top right) in a 1904 plate by Ernst Haeckel

Linnaeus originally described the hawksbill sea turtle as Testudo imbricata in 1766, i nthe 12th edition of his Systema Naturae.[45] In 1843 Austrian zoologist Leopold Fitzinger moved it into genus Eretmochelys.[46] In 1857, the species was temporarily misdescribed as Eretmochelys imbricata squamata.[47]

There are two accepted subspecies in E. imbricata's taxon. E. imbricata bissa (Rüppell, 1835) refers to populations that reside in the Pacific Ocean.[48] The Atlantic population is a separate subspecies, E. imbricata imbricata (Linnaeus, 1766). The nominate subspecies is the Atlantic taxon, because Linnaeus' type specimen was from the Atlantic.[49]

Fitzinger derived the genus' name, Eretmochelys, from the Greek roots eretmo and chelys, corresponding to "oar" and "turtle" respectively. The name refers to the turtles' oar-like front flippers. The species' name imbricata is Latin, corresponding to the English term imbricate. This appropriately describes the turtles' overlapping posterior scutes. The Pacific hawksbill's subspecies name, bissa, is Latin for "double". The subspecies was originally described as Caretta bissa; the term referred to the then-species being the second species in the genus.[50] Caretta is the genus of the hawksbill's much larger relative, the loggerhead turtle.

Importance to humans

Photo of dish
Palauan women's money(toluk)

Throughout the world, hawksbill sea turtles are taken by humans even though it is illegal to hunt them in many countries.[51] In some parts of the world, hawksbill sea turtles are eaten as a delicacy. As far back as the fifth century B.C., sea turtles including the hawksbill were eaten as delicacies in China.[52]

Many cultures also use turtles' shells for decoration. These turtles have been harvested for their beautiful shell since Egyptian times.[53] In China, where it was known as tai mei, the Hawksbill is called the tortoise-shell turtle, named primarily for its shell, which was used for decoration.[52] In Japan, the turtles are also harvested for their shell scutes, which are called bekko in Japanese. It is used in various personal implements, such as eyeglass frames; the fashion style known as"tortoiseshell".[53] In 1994, Japan stopped importing hawksbill shells from other nations. Prior to this, the Japanese hawksbill shell trade was around 30,000 kilograms (66,000 lb) of raw shells per year.[17][54] In the West, hawksbill sea turtle shells were harvested by the ancient Greeks and ancient Romans for jewelry, such as combs, brushes, and rings.[55] The bulk of the world's hawksbill sea turtle shell trade originates in the Caribbean. In 2006, processed shells were regularly available, often in large amounts, in nearby countries, including the Dominican Republic and Colombia.[56]

The hawksbill sea turtle appears on the reverse side of the 20-Venezuelan bolívar and the 2-Brazilian Reais banknotes. A much-beloved fountain sculpture of a boy riding a hawksbill, affectionately known as Turtle Boy, stands in Worcester, Massachusetts.

Conservation

Photo of turtle swimming in shallow, green water
A hawksbill sea turtle in Tobago

General consensus has determined sea turtles, including E. imbricata to be, at the very least, threatened species because of their slow growth and maturity, and slow reproductive rates. Many adult turtles have been killed by humans, both deliberately and accidentally. In addition, human and animal encroachment threatens nesting sites and small mammals dig up eggs.[6] In the U.S. Virgin Islands, mongooses raid Hawksbill nests (along with those of other sea turtles like Dermochelys coriacea) right after they are laid.[57]

In 1982 the IUCN Red List of Threatened Species first listed E. imbricata as endangered.[58] This endangered status continued through several reassessments in 1986,[59] 1988,[60] 1990,[61] and 1994[62] until it was upgraded in status to critically endangered in 1996.[1] Two petitions challenged its status as an endangered species prior to this, claiming that the turtle (along with three other species) had several significant stable populations worldwide. These petitions were rejected based on their analysis of data submitted by the Marine Turtle Specialist Group (MTSG). The data given by the MTSG showed that the worldwide hawksbill sea turtle population had declined by 80% in the three most recent generations, and that there was no significant population increase as of 1996. CR A2 status was denied however, because the IUCN did not find sufficient data to show the population likely to decrease by a further 80% in the future.[63]

The species (along with the entire family Cheloniidae) has been listed on Appendix I of the Convention on International Trade in Endangered Species.[3] It is illegal to import or export turtle products, or to kill, capture, or harass hawksbill sea turtles.[51]

Local involvement in conservation efforts has also increased in the past few years.

The United States Fish and Wildlife Service and National Marine Fisheries Service have classified hawksbills as endangered under the Endangered Species Act[64] since 1970. The U.S. government established several recovery plans[65] for protecting E. imbricata.[66]

See also

References

  1. ^ a b c Mortimer, J.A & Donnelly, M. (2008). Eretmochelys imbricata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on June 12, 2011.
  2. ^ "Eretmochelys imbricata (Linnaeus, 1766)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173836. Retrieved 5 February 2007. 
  3. ^ a b CITES (2006-06-14). "Appendices" (SHTML). Convention on International Trade in Endangered Species of Wild Flora and Fauna. Archived from the original on 2007-02-03. http://web.archive.org/web/20070203100154/http://www.cites.org/eng/app/appendices.shtml. Retrieved 2007-02-05. 
  4. ^ a b c d "Species Booklet: Hawksbill sea turtle". Virginia Fish and Wildlife Information Service. Virginia Department of Game & Inland Fisheries. http://www.dgif.state.va.us/wildlife/species/display.asp?id=030073. Retrieved 2007-02-06. 
  5. ^ "Hawksbill turtle – Eretmochelys imbricata: More information". Wildscreen. http://www.arkive.org/species/GES/reptiles/Eretmochelys_imbricata/more_info.html. Retrieved 2007-02-05. 
  6. ^ a b c d e f "Eretmochelys imbricata, Hawksbill Sea Turtle". MarineBio.org. http://marinebio.org/species.asp?id=164. Retrieved 2007-02-05. 
  7. ^ "The Hawksbill Turtle (Eretmochelys imbricata)". turtles.org. http://www.turtles.org/hawksd.htm. Retrieved 2007-02-22. 
  8. ^ a b c "Hawksbill". SeychellesTurtles.org - Strategic Management of Turtles. Marine Conservation Society, Seychelles. Archived from the original on 2007-10-17. http://web.archive.org/web/20071017041228/http://seychellesturtles.org/species/hawksbill.html. Retrieved 2007-02-22. 
  9. ^ "The Hawksbill Turtle: Eretmochelys imbricata". Auckland Zoo. http://www.aucklandzoo.co.nz/sss/sss_003/SSS3.hawksbill_turtle2.htm. Retrieved 2007-07-14. 
  10. ^ a b c "Species Fact Sheet: Eretmochelys imbricata (Linnaeus, 1766)". FIGIS - Fisheries Global Information System. United Nations. 2006. http://www.fao.org/fishery/species/3606/en. Retrieved 2009-06-14. 
  11. ^ a b c "Hawksbill Sea Turtle (Eretmochelys imbricata)". North Florida Field Office. United States Fish and Wildlife Service. 2005-12-09. http://www.fws.gov/northflorida/SeaTurtles/Turtle%20Factsheets/hawksbill-sea-turtle.htm. Retrieved 2007-02-18. 
  12. ^ Formia, Angela; Manjula Tiwari, Jacques Fretey and Alexis Billes (2003). "Sea Turtle Conservation along the Atlantic Coast of Africa". Marine Turtle Newsletter (IUCN Marine Turtle Specialist Group) 100: 33–37. http://www.seaturtle.org/mtn/archives/mtn100/mtn100p33.shtml. Retrieved 2007-02-18. 
  13. ^ Pope, C. H. (1939). Turtles of the United States and Canada. New York: Alfred A. Knopf. 
  14. ^ Beggs, Jennifer A.; Julia A. Horrocks and Barry H. Krueger. "Increase in hawksbill sea turtle Eretmochelys imbricata nesting in Barbados, West Indies". Endangered Species Research (ESR) 3: 159–168. http://www.widecast.org/What/Country/Barbados/Docs/Beggs_et_al_(2007)_EI_rising_in_Barbados.pdf. Retrieved 2010-12-06. 
  15. ^ Kamel, Stephanie J.; Eric Delcroix. "Nesting Ecology of the Hawksbill Turtle, Eretmochelys imbricata, in Guadeloupe, French West Indies from 2000–07". Journal of Herpetology 43 (3): 367–376. http://www.tortuesmarinesguadeloupe.org/downloads/KamelDelcroixJH2009.pdf. Retrieved 2010-12-06. 
  16. ^ Bjorndal, Karen A.; Alan B. Bolten and Cynthia J. Lagueux (December 1993). "Decline of the Nesting Population of Hawksbill Turtles at Tortuguero, Costa Rica". Conservation Biology (Blackwell Publishing) 7 (4): 925–927. doi:10.1046/j.1523-1739.1993.740925.x. JSTOR 2386826. 
  17. ^ a b Heppel, Selina S.; Larry B. Crowder (June 1996). "Analysis of a Fisheries Model for Harvest of Hawksbill Sea Turtles (Eretmochelys imbricata)". Conservation Biology (Blackwell Publishing) 10 (3): 874–880. doi:10.1046/j.1523-1739.1996.10030874.x. JSTOR 2387111. 
  18. ^ Bowen, B. W.; A. L. Bass, A. Garcia-Rodriguez, C. E. Diez, R. van Dam, A. Bolten, K. A., Bjorndal, M. M. Miyamoto and R. J. Ferl (May 1996). "Origin of Hawksbill Turtles in a Caribbean Feeding Area as Indicated by Genetic Markers". Ecological Applications (The Ecological Society of America) 6 (2): 566–572. doi:10.2307/2269392. JSTOR 2269392. 
  19. ^ Colacion, Artem; Danee Querijero (2005-03-10). "Uriel’s journey home — a Young pawikan’s story in Boracay". The Philippine STAR. http://www.philstar.com/Article.aspx?articleId=276743. Retrieved 2007-02-06. 
  20. ^ "Ocean Ambassadors - Philippine Turtle Islands". Coastal Resource & Fisheries Management of the Philippines. OneOcean.org. http://www.oneocean.org/ambassadors/track_a_turtle/tihpa/pti.html. Retrieved 2007-02-06. 
  21. ^ Hoover, John P (2008). The Ultimate guide to Hawaiian Reef Fishes. Mutual Publishing. ISBN [[Special:BookSources/978156647887998|978156647887998]]. 
  22. ^ Loop, K. A.; J. D. Miller and C. J. Limpus (1995). "Nesting by the hawsbill turtle (Eretmochelys imbricata) on Milman Island, Great Barrier Reef, Australia". Wildlife Research (CSIRO Publishing) 22 (2): 241–251. doi:10.1071/WR9950241. ISSN: 1035-3712. http://www.publish.csiro.au/paper/WR9950241.htm. Retrieved 2007-02-21. 
  23. ^ Allen, ZC; N. J. Shah, A. Grant, G-D. Derand and D. Bell (2010). "Hawksbill turtle monitoring in Cousin Island". Endangered Species Research 11: 195-200. doi:10.3354/esr00281. http://www.int-res.com/articles/esr2010/11/n011p195.pdf. Retrieved 23 April 2012. 
  24. ^ Hitchins, P. M.; O. Bourquin and S. Hitchins (2004-04-27). "Nesting success of hawksbill turtles (Eretmochelys imbricata) on Cousine Island, Seychelles". Journal of Zoology (Cambridge University Press, The Zoological Society of London) 264 (2): 383–389. doi:10.1017/S0952836904005904. http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=259629. Retrieved 2007-02-21. 
  25. ^ Gaos, Alexander; et al. (2010). "Signs of Hope in the Eastern Pacific: International collaboration reveals encouraging status of hawksbill turtles in the eastern Pacific". Oryx. http://www.hawksbill.org/sitebuildercontent/sitebuilderfiles/gaos_2010_EPhawksbills.pdf. 
  26. ^ Gaos, Alexander; et al. (2011). "Shifting the life-history paradigm: discovery of novel habitat use by hawksbill turtles". Biol Lett. http://www.hawksbill.org/sitebuildercontent/sitebuilderfiles/Gaosetal2011.pdf. 
  27. ^ Lutz, P. L.; J. A. Musick (1997). The Biology of Sea Turtles. Boca Raton, Florida: CRC Press. ISBN 0-8493-8422-2. 
  28. ^ Houghton, Jonathan D. R.; Martin J. Callow, Graeme C. Hays (2003). "Habitat utilization by juvenile hawksbill turtles (Eretmochelys imbricata, Linnaeus, 1766) around a shallow water coral reef" (PDF). Journal of Natural History 37: 1269–1280. doi:10.1080/00222930110104276. http://www.swan.ac.uk/bs/turtle/reprints/jon_jnh_2003.pdf. Retrieved 2007-03-17. 
  29. ^ a b Meylan, Anne (1988-01-22). "Spongivory in Hawksbill Turtles: A Diet of Glass". Science (American Association for the Advancement of Science) 239 (4838): 393–395. doi:10.1126/science.239.4838.393. JSTOR 1700236. PMID 17836872. 
  30. ^ a b c Edelman, Michael (2004). "Eretmochelys imbricata: Information". Animal Diversity Web. University of Michigan Museum of Zoology. http://animaldiversity.ummz.umich.edu/site/accounts/information/Eretmochelys_imbricata.html. Retrieved 2007-02-04. 
  31. ^ Boulon, R. (1994). Growth Rates of Wild Juvenile Hawksbill Turtles, Eretmochelys imbricata, in St. Thomas, United States Virgin Islands. Copeia, 1994: 3 pp 811-814
  32. ^ Van Dam, R.P. & C.E. Diez. 1997b. Diving behavior of immature hawksbill turtles (Eretmochelys imbricata) in a Caribbean reef habitat. Coral Reefs 16: 133-138.
  33. ^ WITZELL, W. N. 1983. Synopsis of biological data on the hawksbill turtle, Eretmochelys imbricata (Linnaeus 1766). FAO Fisheries Synopsis 137:1-78.
  34. ^ MUSICK, J.A. & C. J. LIMPUS. 1997. Habitat utilization and migration in juvenile sea turtles. In: P. L. Lutz & J. A. Musick (Eds). The Biology of Sea Turtles. CRC Press, Boca Raton. pp. 137-163.
  35. ^ LIMPUS, C.J. 1992. The hawksbill turtle, Eretmochelys imbricata, in Queensland: Population structure within a southern Great Barrier Reef feeding ground. Wildlife Research, 19, 489-506.
  36. ^ BOULON, R.H. 1989. Virgin Island turtle tags recovered outside the U. S. Virgin Islands. In: S.A. Eckert, K.L. Eckert & T.H. Richardson (Compilers). Proceedings of the Ninth Annual Workshop on Sea Turtle Conservation and Biology. U.S. Dept. of Commerce. NOAA Tech. Memo. NMFS-SEFC-232. pp 207.
  37. ^ "Atlantic Hawksbill Sea Turtle Fact Sheet". New York State Department of Environmental Conservation. http://www.dec.ny.gov/animals/7170.html. Retrieved 2009-06-10. 
  38. ^ León, Y.M. and C.E. Diez, 1999. Population structure of hawksbill turtles on a foraging ground in the Dominican Republic (Chelonian Conservation and Biology; 1999, v. 3, no. 2, p. 230-236)
  39. ^ LIMPUS, C.J., P.J. COUPER & M.A. READ. 1994. The green turtle, Chelonia mydas, in Queensland: population structure in a warm temperate feeding area. Memoirs of the Queensland Museum 35: 139-154.
  40. ^ Moncada, F. Carrillo, E., Saenz, A., and Nodarse, G. (1999). Reproduction and Nesting of the Hawksbill Turtle, Eretmochelys imbricata, in the Cuban Archipelago. Chelonian Conservation and Biology, 3(2):257–263
  41. ^ Diez, C. E. & Van Dam, R. P. (2002). Habitat effect on hawksbill turtle growth rates on feeding grounds at Mona and Monito Islands, Puerto Rico. Marine Ecology Progress Series. 234:301-309.
  42. ^ Limpus, C.J. and Miller, J.D. 2000. Final Report for Australian Hawksbill Turtle Population Dynamics Project. A Project Funded by the Japan Bekko Association to Queensland Parks and Wildlife Service. Dr. Colin J. Limpus and Dr. Jeffrey D. Miller, Planning and Research Division, Queensland Parks and Wildlife Service, P.O. Box 155, Brisbane Albert Street, Qld 4002, Australia.
  43. ^ Mortimer, J.A., Collie, J.,Jupiter, T. Chapman, R. Liljevik, A. and Betsy, B. 2003. Growth rates of immature hawksbills (Eretmochelys imbricata) at Aldabra Atoll, Seychelles (Western Indian Ocean). In: J.A. Seminoff (ed.), Proceedings of the Twenty-Second Annual Symposium on Sea Turtle Biology and Conservation, pp. 247.
  44. ^ Bowen, Brian W.; William S. Nelson and John C. Avise (15 June 1993). "A Molecular Phylogeny for Marine Turtles: Trait Mapping, Rate Assessment, and Conservation Relevance". Proceedings of the National Academy of Sciences of the United States of America (National Academy of Sciences) 90 (12): 5574–5577. doi:10.1073/pnas.90.12.5574. PMC 46763. PMID 8516304. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=46763. Retrieved 2007-02-16. 
  45. ^ "Testudo imbricata Linnaeus, 1766". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=208664. Retrieved 5 February 2007. 
  46. ^ "Eretmochelys Fitzinger, 1843". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173835. Retrieved 5 February 2007. 
  47. ^ "Eretmochelys imbricata squamata Agassiz, 1857". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=208665. Retrieved 5 February 2007. 
  48. ^ "Eretmochelys imbricata bissa (Rüppell, 1835)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=208666. Retrieved 5 February 2007. 
  49. ^ "Eretmochelys imbricata imbricata (Linnaeus, 1766)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173836. Retrieved 5 February 2007. 
  50. ^ Beltz, Ellin. "Translations and Original Descriptions: Turtles". Scientific and Common Names of the Reptiles and Amphibians of North America - Explained. ebeltz.net. http://ebeltz.net/herps/etymain.html#Turtles. Retrieved 2007-02-06. 
  51. ^ a b UNEP-WCMC. "Eretmochelys imbricata". UNEP-WCMC Species Database: CITES-Listed Species. United Nations Environment Programme - World Conservation Monitoring Centre. A-301.003.003.001. http://sea.unep-wcmc.org/isdb/CITES/Taxonomy/tax-species-result.cfm?displaylanguage=eng&Genus=Eretmochelys&Species=imbricata&source=animals&Country=&tabname=all. Retrieved 2007-02-05. [dead link]
  52. ^ a b Schafer, Edward H. (1962). "Eating Turtles in Ancient China". Journal of the American Oriental Society (American Oriental Society) 82 (1): 73–74. doi:10.2307/595986. JSTOR 595986. 
  53. ^ a b [1] STRP Hawksbill Sea Turtle
  54. ^ Strieker, Gary (2001-04-10). "Tortoiseshell ban threatens Japanese tradition". CNN.com/sci-tech (Cable News Network LP, LLLP.). http://archives.cnn.com/2001/TECH/science/04/10/japan.turtles/. Retrieved 2007-03-02. 
  55. ^ Casson, Lionel (1982). "Periplus Maris Erythraei: Notes on the Text". The Journal of Hellenic Studies (The Society for the Promotion of Hellenic Studies) 102: 204–206. doi:10.2307/631139. JSTOR 631139. 
  56. ^ "Turtles of the Caribbean: the curse of illegal trade". Newsroom. World Wide Fund for Nature. 2006-10-01. http://www.panda.org/news_facts/newsroom/index.cfm?uNewsID=81940. Retrieved 2007-02-27. 
  57. ^ Nellis, David W.; Vonnie Small (June 1983). "Mongoose Predation on Sea Turtle Eggs and Nests" (PDF). Biotropica (The Association for Tropical Biology and Conservation) 15 (2): 159–160. doi:10.2307/2387964. JSTOR 2387964. http://www.seaturtle.org/PDF/Nellis_1983_Biotropica.pdf. Retrieved 2007-02-16. 
  58. ^ Groombridge, B. (1982). The IUCN Amphibia-Reptilia Red Data Book, Part 1: Testudines, Crocodylia, Rhynocehapalia. Gland, Switzerland: IUCN. 
  59. ^ IUCN Conservation Monitoring Centre (1986). 1986 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK: IUCN. ISBN 2-88032-605-2. 
  60. ^ IUCN Conservation Monitoring Centre (1988). 1988 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK: IUCN. 
  61. ^ IUCN (1990). 1990 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK.: IUCN. 
  62. ^ Groombridge, B. (1994). 1994 IUCN Red List of Threatened Animals. Gland, Switzerland: IUCN. ISBN 2-8317-0194-5. 
  63. ^ Red List Standards & Petitions Subcommittee (2001-10-18). "Ruling of the IUCN Red List Standards and Petitions Subcommittee on Petitions against the 1996 Listings of Four Marine Turtle Species, 18 October 2001" (PDF). International Union for Conservation of Nature and Natural Resources. http://intranet.iucn.org/webfiles/doc/SSC/RedList/MarineTurtleDecisions_18_Oct_01.pdf. Retrieved 2007-02-05. 
  64. ^ Endangered Species Act
  65. ^ recovery plans
  66. ^ "Species Profile: Hawksbill sea turtle (Eretmochelys imbricata)". USFWS Threatened and Endangered Species System (TESS). United States Fish and Wildlife Service. 1970-06-02. http://ecos.fws.gov/speciesProfile/SpeciesReport.do?spcode=C00E. Retrieved 2007-02-05. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Shell size and shape are variable throughout the range, and distinct population demes apparently exist; further analysis is needed. Two subspecies, E. i. imbricata (Atlantic) and E. i. bissa (Pacific), are recognized; additional study is needed to determine if these subspecies are valid, and whether other populations warrant subspecific recognition (Ernst and Barbour 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!