Overview

Brief Summary

Introduction

Type species of the genus Sepioteuthis.

Size to 20 cm ML.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Habitat and Biology

A truly tropical species that is limited in distribution by the distribution of coral reefs, primarily, and grass flats (Thalassia testudinum). It occurs at depths of 0 to 20 m, mostly 3 to 7 m. As shallow coral reefs are absent from most of the Gulf of Mexico, S. sepioidea also appears to be excluded from the Gulf.

Occurs in schools of 4 to 50 individuals of about equal size that cruise around the reefs or about the reef flats, or grass beds behind the reefs.

Specimens are mature at about 9 cm mantle length (hectocotylus visible on males at 3 cm mantle length). Eggs are very yolky and large, about 5 to 6 mm long; only 3 to 4 eggs are laid in each large, gelatinous capsule, several of which are attached together at their bases; these small clusters are laid under rocks or in conch shells (Strombus gigas); breeding apparently occurs year-round.

Feeds on fishes and shrimps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle broad, relatively stout, tapered to a blunt posterior end, widest at anterior opening.
  2. Fins
    1. Fins occupy nearly entire length of mantle (90% in adults, 75% in juveniles).
    2. Shape elliptical to weakly rhomboidal.
    3. Width about 65% ML.
  3. Buccal crown
    1. Buccal lappets without suckers.
  4. Arms
    1. Left ventral arm hectocotylized; modified portion occupies distal fourth of arm length and is characterized by sudden reduction in size of one or 2 pairs of suckers, the complete absence of suckers in both series from the remaining distal portion of the arm, and the increase in size of the pedicels into large, fleshy papillae.

Comments

Color: quite varied in life from translucent with irredescent sheen, through greenish brown to deep reddish brown, depending on location and situation; may show “eye-spots”, bands, or stripes on mantle, these sometimes outlined in white.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sepioteuthis sepioidea lives in the ocean waters of Flordia and Bermuda through the West Indian islands and from Venezuela to Cozumel along the Caribbean shores of Central America and the northeast of South America. It lives in waters that are relatively clear and shallow to approximately 100 meters, with average salinity. It finds success and dominance in many localized areas of its range. (Moynihan and Rodaniche 1982)

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Distribution

Tropical western Atlantic from Cape Canaveral, Florida, Bermuda and the Bahama Islands, Florida Keys, Carribean Islands, Campeche, Yucatan to Venezuela.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The youngest individuals are semiplanktonic and swim rather passively due to their small, short fins. Their dorsal mantle is typically 8-9mm in length when they emerge from their eggs.

Adults of the species Sepioteuthis sepioidea resemble their close relative, the cuttlefish. They are less elongated, streamlined, and arrow-shaped than many other squids. Their triangular fins extend nearly the entire length of the body, which is a wide flattened viseral mass. Adult females' dorsal mantles reach lengths of at least 120 mm and males' reach at least 114 mm.

Their coloring is typically finely mottled, medium brown on the dorsal side and clear, light brown, or whitish on the ventral side. A distinct white line runs longitudinally on the dorsal side. Prominent brow ridges are above their large eyes. At night, individuals appear to be completely colorless because their pigment cells do not expand. It is not certain if this change in color at night has any significant purpose. (Moynihan and Rodaniche 1982)

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The habitat of S. sepiodea changes according to the squid's stage of life and size. For ease of understanding, they will be divided into four size categories to help explain habitat preferences: very small (newly hatched), small, nonbreeding large, and large (breeding adult). The new hatchlings tend to reside in a very narrow range close to or between islands. Their habitat primarily includes areas from 0.2-1.0m below the surface on or under vegetation and 1-10m from the ocean bottom. These smallest individuals are found primarily during the day.

The small squid typically congregate in shallow turtle grass near islands and remain several centimeters to two meters from the surface to avoid bird predators. They also do not dwell on the ocean floor because of possible snapper predation. At night however, they often will swim to deeper waters and hunt with older, larger squid.

Nonbreeding adult S. sepioidea avoid the turtle grass flats of their younger years because of insufficient room to maneuver in these shallow waters. Most of the waters in the San Blas are home for these, including all varieties of ocean bottoms. They venture to depths of 100m and prefer open waters at night opposed to their shoreline home of their days.

Breeding and courting adults spend their days upon coral reefs of 1.5-8m depths. These large squid avoid all or most other habitats during this period.

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

  • Moynihan, M., A. Rodaniche. 1982. The Behavior and Natural History of the Caribbean Reef Squid. Berlin and Hamburg: Verlag Paul Parey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal reefs and sea grass
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2 - 272.5
  Temperature range (°C): 17.010 - 27.194
  Nitrate (umol/L): 0.642 - 10.763
  Salinity (PPS): 35.661 - 36.216
  Oxygen (ml/l): 3.750 - 4.693
  Phosphate (umol/l): 0.099 - 0.690
  Silicate (umol/l): 1.557 - 5.919

Graphical representation

Depth range (m): 2 - 272.5

Temperature range (°C): 17.010 - 27.194

Nitrate (umol/L): 0.642 - 10.763

Salinity (PPS): 35.661 - 36.216

Oxygen (ml/l): 3.750 - 4.693

Phosphate (umol/l): 0.099 - 0.690

Silicate (umol/l): 1.557 - 5.919
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet primarily inculdes fishes (most of which are schooling sardines) and arthropods (usually shrimp floating near the surface at night). Squid eat on fish proportional to their own size. Very few fish larger than 12 cm are ever eaten; most are only a few centimeters in length. Presumably, S. sepioidea eat many planktonic animals that have not been recorded because they cannot be seen with the human eye. No available list of their prey is all inclusive since feeding patterns are derived entirely from observations made in the field.

S. sepioidea track food entirely by sight, which limits their feeding. They use body color changes to express emotion as well as to confuse or distract potential prey. Their tentacles remain hidden except during strikes when they extend the tentacles to bend upward and produce a hooklike effect.

It is not known upon what the semiplanktonic, newly-hatched squid feed. (Moynihan and Rodaniche 1982)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The mating rituals of S. sepioidea are ambiguous and complex. Large adults typically form pairs of one female and one male before they disengage from the squid school to head for the reefs to mate. Most cephalopods, including the Caribbean reef squid, are semelparous; that is, individuals die after reproducing for the first and only time. Females lay eggs in clutches and die immediately after. However, males can copulate many times in a concentrated short period of time before they die. Females lay the eggs in well protected areas, scatterering them within the reefs, but do not care for the young in any direct way. It is advantageous for the male partner to escort the egg-bearing female to the reef in order for him to protect his investment from large carnivorous fish. (Hanlon and Messenger 1996)

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepioteuthis sepioidea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATCCGAACTGAATTAGGTAAACCTGGATCATTACTCAATGAT---GACCAACTATATAATGTAGTAGTTACTGCTCATGGATTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGTTTTGGTAACTGATTAGTGCCATTAATATTAGGTGCACCAGATATAGCCTTTCCTCGTATAAATAATATAAGATTCTGATTGTTACCTCCATCATTAACACTATTATTAGCTTCATCCGCAGTAGAAAGAGGAGCAGGTACTGGTTGAACTGTATATCCTCCTTTATCAAGAAATCTTTCTCATGCAGGCCCATCAGTTGATCTTGCAATTTTTTCTCTCCATTTAGCAGGTATTTCATCTATCCTAGGAGCTATTAATTTTATTACAACTATTGTTAATATACGATGAGAAGGGCTCTTAATGGAACGACTACCATTATTTGCTTGATCTGTTTTTATTACTGCTATTCTACTTCTTTTATCACTACCTGTACTTTCAGGATCAATTACGATACTATTAACAGATCGAAATTTCAACACTACTTTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sepioteuthis sepioidea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Sepioteuthis sepioidea does not compete with humans for food or for habitat and consequently do not affect humans negatively in any respect. (New 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

All types of squid, including the species S. sepioidea, are particularly important to humans as a food source. Squid have little other significant economic importance for humans. (New 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Caribbean reef squid

The Caribbean reef squid (Sepioteuthis sepioidea), also known as just the Reef Squid, is a small (20 cm) torpedo-shaped squid with fins that extend nearly the entire length of the body and undulate rapidly as it swims. The squid has recently become notable when it was discovered that it could fly out of the water; a discovery which finally led to identification of six species of flying squid.[1]

Distribution and habitat[edit]

Reef Squid, Bonaire
A school of Reef Squid, Dry Tortugas National Park, Florida
Individual near the surface.

The Caribbean reef squid is found throughout the Caribbean Sea as well as off the coast of Florida, commonly in small schools of 4-30 in the shallows associated with reefs. The habitat of the Reef Squid changes according to the squid's stage of life and size. New hatchlings tend to reside close to the shore in areas from 0.2–1 meters below the surface on or under vegetation. Young small squid typically congregate in shallow turtle grass near islands and remain several centimeters to two meters from the surface to avoid bird predators. Adults venture out into open water and can be found in depths up to 100 m. When mating, adults are found near coral reefs in depths of 1.5–8 m. The Caribbean reef squid is the only squid species commonly sighted by divers over inshore reefs in the Florida, Bahamas and Caribbean region.

Feeding behavior[edit]

This species, like most squid, is a voracious eater and typically consumes 30-60% of its body weight daily. Prey is caught using the club-like end of the long tentacles which are then pulled towards the mouth supported by the shorter arms. Like other cephalopods, it has a strong beak which it uses to cut the prey into parts so that the raspy tongue, or radula, can be used to further process the food. It consumes small fish, other molluscs, and crustaceans.

Communication[edit]

Caribbean reef squid have been shown to communicate using a variety of color, shape, and texture changes. Squid are capable of rapid changes in skin color and pattern through nervous control of chromatophores.[2] In addition to camouflage and appearing larger in the face of a threat, squids use color, patterns, and flashing to communicate with one another in various courtship rituals. Caribbean reef squid can send one message via color patterns to a squid on their right, while they send another message to a squid on their left.[3][4]

Reproduction[edit]

Like other cephalopods, the Caribbean reef squid, is semelparous, dying after reproducing. Females lay their eggs then die immediately after. The males, however, can fertilize many females in a short period of time before they die. Females lay the eggs in well-protected areas scattered around the reefs. After competing with 2-5 other males, the largest male approaches the female and gently strokes her with his tentacles. At first she may indicate her alarm by flashing a distinct pattern, but the male soon calms her by blowing water at her and jetting gently away. He returns repeatedly until the female accepts him, however the pair may continue this dance or courting for up to an hour. The male then attaches a sticky packet of sperm to the female's body. As he reaches out with the sperm packet, he displays a pulsating pattern. The female places the packet in her seminal receptacle, finds appropriate places to lay her eggs in small clusters, and then dies.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!