Overview

Comprehensive Description

Biology

Occurs on or near turbid inshore reefs surrounded by soft sand-mud bottoms, often in the proximity of freshwater discharge (Ref. 74961).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Papua, western New Guinea, Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Indonesia and Papua New Guinea; also expected from the East Indian region, Sabah and the Philippines.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

16.8 cm SL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is distinguished by the following characters: D XIII,11; A III,7; pectoral rays 12-14 (usually 13); vertical scale rows in longitudinal scale series 62-72; horizontal scale rows above lateral line 9-10; below lateral line 13-15; dorsal spines with narrow, inconspicuous membrane on posterior edge with exaggerated pennant-like flap distally; relatively few dark spots on median fins, 5-28 on dorsal fin, 10-19 on anal fin, and 17-41 on caudal fin; first dorsal spine is relatively short, with an average length of 14.95% of SL (Ref. 74961).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Pterois andover Allen & Erdmann
Catalog Number: USNM 390776
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Allen
Year Collected: 2005
Locality: Payahi Bay, southwestern Halmahera, Indonesia, Indonesia, Pacific
Depth (m): 5 to 8
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine; depth range 3 - 70 m (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois andover

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTCGGTGCTTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGGGCAGAACTCAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAATGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTAGTACCCCTTATGCTCGGGGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTTCTTGCCTCCTCAGGGGTTGAAGCAGGGGCTGGAACAGGTTGAACAGTATACCCACCACTAGCCGGAAACCTTGCCCATGCAGGGGCGTCTGTAGACCTGACAATTTTTTCCTTGCACTTAGCAGGTATTTCATCAATTCTAGGGGCCATCAACTTTATTACAACAATTATTAATATGAAGCCCCCTGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACGGCAGTTCTTCTACTTCTTTCTCTACCAGTCCTTGCCGCCGGCATTACGATGCTACTAACGGACCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois andover

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pterois andover

Pterois andover is a scorpaenid fish of the genus Pterois. This species is found in the western Pacific. It is found in marine waters off of Indonesia and Papua New Guinea and ranges as far as Sabah, Malaysia and the Philippines. Pterois andover is found at a depth range 3-70 m.[2]

Description

This fish has thirteen dorsal spines. Its first dorsal spine is relatively short.[3]

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!