Overview

Comprehensive Description

Biology

Occurs on or near turbid inshore reefs surrounded by soft sand-mud bottoms, often in the proximity of freshwater discharge (Ref. 74961).
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Papua, western New Guinea, Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Indonesia and Papua New Guinea; also expected from the East Indian region, Sabah and the Philippines.
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 7
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

23.0 cm TL (male/unsexed; (Ref. 90102)); 16.8 cm SL (female)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is distinguished by the following characters: D XIII,11; A III,7; pectoral rays 12-14 (usually 13); vertical scale rows in longitudinal scale series 62-72; horizontal scale rows above lateral line 9-10; below lateral line 13-15; dorsal spines with narrow, inconspicuous membrane on posterior edge with exaggerated pennant-like flap distally; relatively few dark spots on median fins, 5-28 on dorsal fin, 10-19 on anal fin, and 17-41 on caudal fin; first dorsal spine is relatively short, with an average length of 14.95% of SL (Ref. 74961).
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Pterois andover Allen & Erdmann
Catalog Number: USNM 390776
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Allen
Year Collected: 2005
Locality: Payahi Bay, southwestern Halmahera, Indonesia, Indonesia, Pacific
Depth (m): 5 to 8
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine; depth range 3 - 70 m (Ref. 74961)
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois andover

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTCGGTGCTTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGGGCAGAACTCAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAATGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTAGTACCCCTTATGCTCGGGGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTTCTTGCCTCCTCAGGGGTTGAAGCAGGGGCTGGAACAGGTTGAACAGTATACCCACCACTAGCCGGAAACCTTGCCCATGCAGGGGCGTCTGTAGACCTGACAATTTTTTCCTTGCACTTAGCAGGTATTTCATCAATTCTAGGGGCCATCAACTTTATTACAACAATTATTAATATGAAGCCCCCTGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACGGCAGTTCTTCTACTTCTTTCTCTACCAGTCCTTGCCGCCGGCATTACGATGCTACTAACGGACCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois andover

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!