Overview

Brief Summary

Biology

The sea lemon feeds mainly on the bread-crumb sponge Halichondria panicea and other sponges (4). It is hermaphroditic, possessing both male and female organs. Breeding occurs in the spring (5); thousands of eggs are produced in a long mass, which is attached to rocks and looks like a coiled whitish or yellowish ribbon (5). The larvae are free-swimming, and hatch after around four weeks. This pelagic stage lasts for around three months; larvae then undergo metamorphosis and become adults. It is thought that metamorphosis is triggered by the larva coming into contact with Halichondria sponges (5). Individuals are known to have lived to around 1 year of age, although they may live longer (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The sea lemon, Archidoris pseudoargus (also known as Archidoris tuberculata in much of Europe) (3) is a common sea slug around Britain (4). It has an oval shaped body (2) and varies greatly in colour. Yellow, pink, green, white and brown forms are known, and there is also a brilliant red variety known as Archidoris pseudoargus var. flammea (4). It is usually mottled to a degree, which may act as camouflage (4). The upper surface of the sea lemon is covered in bumps called 'tubercles', and a ring of 8-9 retractable feathery gills is located towards the rear (2). This species may be confused with the similar Geitodoris planata, which can be identified by the presence of brown spots on the underside, and star-like spots on the upper surface (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A large sea slug up to 12 cm long. The top side of the slug is covered in small wart like bumps (tubercles). It has a ring of eight or nine upright feathery gills close to the posterior end, which are quickly retracted when a disturbance is sensed. The colouration of the sea slug is blotchy and variable and can be yellow, green, brown or pink. There is another variety Archidoris psuedoargus var. flammea which is bright red all over.The sea slug Geitodoris planata can be distinguished from Archidoris psuedoargus as it has star-shaped spots on its back (dorsum) and brown specks on the underside of the mantle. 
The sea lemon feeds mainly on sponges, especially the breadcrumb sponge (Halichondria panicea). Once used as fish bait in Shetland (Thompson & Brown, 1976).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This is one of the most common nudibranchs found on British shores and in many places it is known as the "sea-lemon". The mantle bears many short blunt tubercles. The mottled coloration of this nudibranch probably aids camouflage. The colours include yellow, brown, pink, green and white. There is also a bright red variety known as A. pseudoargus var. flammea. Some of the large individuals may grow to 120mm in length. The species most likely to be confused with Archidoris is Geitodoris planata which differs in having stellate spots on the dorsum and brown specks on the underside of the mantle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Common around the coastline of Britain (2); elsewhere it is found from Iceland to the Mediterranean (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common all around the British Isles and from Iceland to the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 101 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 0 - 40
  Temperature range (°C): 9.590 - 12.348
  Nitrate (umol/L): 3.175 - 7.121
  Salinity (PPS): 34.621 - 35.363
  Oxygen (ml/l): 6.069 - 6.461
  Phosphate (umol/l): 0.333 - 0.439
  Silicate (umol/l): 2.118 - 3.727

Graphical representation

Depth range (m): 0 - 40

Temperature range (°C): 9.590 - 12.348

Nitrate (umol/L): 3.175 - 7.121

Salinity (PPS): 34.621 - 35.363

Oxygen (ml/l): 6.069 - 6.461

Phosphate (umol/l): 0.333 - 0.439

Silicate (umol/l): 2.118 - 3.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found on the lower shore underneath large boulders and offshore into the sublittoral to about 300 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs on the lower shore underneath large rocks, and extends offshore to depths of around 300m (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually found on the low shore underneath large boulders. It feeds on the "bread-crumb" sponge Halichondria panicea and on other sponges such as Halichondria bowerbanki and Suberites ficus in the sublittoral. The spawn is a broad ribbon laid in a spiral attached by one edge.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Archidoris pseudoargus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTTGGTATATGATGTGGTCTACTCGGGACTGGACTAAGTTTACTAATTCGTTTTGAGTTAGGTACAGCGGGTGCTTTTCTAGGTGAT---GATCATTTTTACAATGTAATTGTGACTGCTCATGCTTTTGTAATAATTTTTTTCATAGTTATGCCTTTAATAATTGGAGGATTTGGAAACTGAATAGTMCCGTTATTAATTGGTGCACCAGATATAAGTTTTCCTCGGATGAATAACATAAGATTTTGGTTATTACCTCCATCTTTTGTTTTACTTCTTTGTTCTACTCTTATAGAAGGTGGTGCCGGTACTGGGTGAACTGTGTATCCACCCTTATCAGGTCCTGTGGCCCATGGGGGAACCTCAGTTGATCTTGCTATTTTCTCACTTCATCTAGCAGGTGCGTCTTCCTTACTGGGTGCTATTAACTTTATTACAACTATTTTTAACATACGGTCTTCAGCTATAACCATAGAACGACTAAGTTTGTTTGTATGATCAGTTTTAGTNNNNNNTTTTCTTCTTCTCCTTTCACTTCCAGTCTTAGCAGGAGCAATTACTATACTTCTAACAGATCGTAATTTTAATACTAGGTTTTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Archidoris pseudoargus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Doris pseudoargus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not currently threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!