Table of Contents
Overview
Brief Summary
Biology
The sea lemon feeds mainly on the bread-crumb sponge Halichondria panicea and other sponges (4). It is hermaphroditic, possessing both male and female organs. Breeding occurs in the spring (5); thousands of eggs are produced in a long mass, which is attached to rocks and looks like a coiled whitish or yellowish ribbon (5). The larvae are free-swimming, and hatch after around four weeks. This pelagic stage lasts for around three months; larvae then undergo metamorphosis and become adults. It is thought that metamorphosis is triggered by the larva coming into contact with Halichondria sponges (5). Individuals are known to have lived to around 1 year of age, although they may live longer (5).
© Wildscreen
Source:
ARKive
Trusted
Description
The sea lemon, Archidoris pseudoargus (also known as Archidoris tuberculata in much of Europe) (3) is a common sea slug around Britain (4). It has an oval shaped body (2) and varies greatly in colour. Yellow, pink, green, white and brown forms are known, and there is also a brilliant red variety known as Archidoris pseudoargus var. flammea (4). It is usually mottled to a degree, which may act as camouflage (4). The upper surface of the sea lemon is covered in bumps called 'tubercles', and a ring of 8-9 retractable feathery gills is located towards the rear (2). This species may be confused with the similar Geitodoris planata, which can be identified by the presence of brown spots on the underside, and star-like spots on the upper surface (4).
© Wildscreen
Source:
ARKive
Trusted
Comprehensive Description
Description
A large sea slug up to 12 cm long. The top side of the slug is covered in small wart like bumps (tubercles). It has a ring of eight or nine upright feathery gills close to the posterior end, which are quickly retracted when a disturbance is sensed. The colouration of the sea slug is blotchy and variable and can be yellow, green, brown or pink. There is another variety Archidoris psuedoargus var. flammea which is bright red all over.The sea slug Geitodoris planata can be distinguished from Archidoris psuedoargus as it has star-shaped spots on its back (dorsum) and brown specks on the underside of the mantle.
The sea lemon feeds mainly on sponges, especially the breadcrumb sponge (Halichondria panicea). Once used as fish bait in Shetland (Thompson & Brown, 1976).
The sea lemon feeds mainly on sponges, especially the breadcrumb sponge (Halichondria panicea). Once used as fish bait in Shetland (Thompson & Brown, 1976).
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Description
This is one of the most common nudibranchs found on British shores and in many places it is known as the "sea-lemon". The mantle bears many short blunt tubercles. The mottled coloration of this nudibranch probably aids camouflage. The colours include yellow, brown, pink, green and white. There is also a bright red variety known as A. pseudoargus var. flammea. Some of the large individuals may grow to 120mm in length. The species most likely to be confused with Archidoris is Geitodoris planata which differs in having stellate spots on the dorsum and brown specks on the underside of the mantle.
© National Museums Northern Ireland and its licensors
Trusted
Distribution
Greek Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Range
Common around the coastline of Britain (2); elsewhere it is found from Iceland to the Mediterranean (4).
© Wildscreen
Source:
ARKive
Trusted
Common all around the British Isles and from Iceland to the Mediterranean.
© National Museums Northern Ireland and its licensors
Trusted
Ecology
Habitat
Depth range based on 101 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.
Environmental ranges
Depth range (m): 0 - 40
Temperature range (°C): 9.590 - 12.348
Nitrate (umol/L): 3.175 - 7.121
Salinity (PPS): 34.621 - 35.363
Oxygen (ml/l): 6.069 - 6.461
Phosphate (umol/l): 0.333 - 0.439
Silicate (umol/l): 2.118 - 3.727
Graphical representation
Depth range (m): 0 - 40
Temperature range (°C): 9.590 - 12.348
Nitrate (umol/L): 3.175 - 7.121
Salinity (PPS): 34.621 - 35.363
Oxygen (ml/l): 6.069 - 6.461
Phosphate (umol/l): 0.333 - 0.439
Silicate (umol/l): 2.118 - 3.727
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 23 samples.
Environmental ranges
Depth range (m): 0 - 40
Temperature range (°C): 9.590 - 12.348
Nitrate (umol/L): 3.175 - 7.121
Salinity (PPS): 34.621 - 35.363
Oxygen (ml/l): 6.069 - 6.461
Phosphate (umol/l): 0.333 - 0.439
Silicate (umol/l): 2.118 - 3.727
Graphical representation
Depth range (m): 0 - 40
Temperature range (°C): 9.590 - 12.348
Nitrate (umol/L): 3.175 - 7.121
Salinity (PPS): 34.621 - 35.363
Oxygen (ml/l): 6.069 - 6.461
Phosphate (umol/l): 0.333 - 0.439
Silicate (umol/l): 2.118 - 3.727
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Found on the lower shore underneath large boulders and offshore into the sublittoral to about 300 m.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Occurs on the lower shore underneath large rocks, and extends offshore to depths of around 300m (2).
© Wildscreen
Source:
ARKive
Trusted
Usually found on the low shore underneath large boulders. It feeds on the "bread-crumb" sponge Halichondria panicea and on other sponges such as Halichondria bowerbanki and Suberites ficus in the sublittoral. The spawn is a broad ribbon laid in a spiral attached by one edge.
© National Museums Northern Ireland and its licensors
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Archidoris pseudoargus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ATTTTTGGTATATGATGTGGTCTACTCGGGACTGGACTAAGTTTACTAATTCGTTTTGAGTTAGGTACAGCGGGTGCTTTTCTAGGTGAT---GATCATTTTTACAATGTAATTGTGACTGCTCATGCTTTTGTAATAATTTTTTTCATAGTTATGCCTTTAATAATTGGAGGATTTGGAAACTGAATAGTMCCGTTATTAATTGGTGCACCAGATATAAGTTTTCCTCGGATGAATAACATAAGATTTTGGTTATTACCTCCATCTTTTGTTTTACTTCTTTGTTCTACTCTTATAGAAGGTGGTGCCGGTACTGGGTGAACTGTGTATCCACCCTTATCAGGTCCTGTGGCCCATGGGGGAACCTCAGTTGATCTTGCTATTTTCTCACTTCATCTAGCAGGTGCGTCTTCCTTACTGGGTGCTATTAACTTTATTACAACTATTTTTAACATACGGTCTTCAGCTATAACCATAGAACGACTAAGTTTGTTTGTATGATCAGTTTTAGTNNNNNNTTTTCTTCTTCTCCTTTCACTTCCAGTCTTAGCAGGAGCAATTACTATACTTCTAACAGATCGTAATTTTAATACTAGGTTTTTTGAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Archidoris pseudoargus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Doris pseudoargus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
