Overview

Brief Summary

The queen conch (Strombus gigas) is a large, marine, gastropod mollusk. The majority of mollusks, including queen conch, are of the class Gastropoda, whose name translates from Latin as "stomach foot." Other types of mollusks include oysters, clams, octopus, and squid. Mollusks (from the Latin word molluscus, meaning "soft") are a phylum of invertebrates with over 100,000 known species.

Queen conchs are soft-bodied animals with an external, spiral-shaped shell with a glossy pink or orange interior. The queen conch lives in sand, seagrass bed, and coral reef habitats. It is found in warm, shallow water and is generally not found deeper than 70 feet (21 m) throughout the Caribbean Sea and Gulf of Mexico, ranging as far north as Bermuda and as far south as Brazil.

Queen conchs achieve full size at about 3-5 years of age, growing to a maximum of about 12 inches (30.4 cm) long and weighing about 5 pounds (2.3 kg). The queen conch is a long-lived species, generally reaching 20-30 years old; however, the lifespan has been estimated as up to 40 years.

Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Queen conch have internal fertilization, after which the female spawns thousands of eggs in a long tubular egg mass. Spawning tends to occur during the summer; the large egg masses may take up to 36 hours to produce and can hold between 310,000 and 750,000 eggs. These egg masses are covered with sand to provide camouflage and the larvae emerge after around 5 days. A single female will spawn between 6 and 8 times during one season. Larvae, known as veligers, float in the open ocean, feeding on phytoplankton and may drift a considerable distance from the site where they emerged, although evidence for this is limited. Between 18 and 40 days later (depending on conditions) the larvae settle into the sand and metamorphose into the adult form. Adult queen conch have been observed to migrate to deeper waters as they increase in size, and seasonal migrations during the summer months, in order to group together and spawn, have also been recorded (5). Conch move by an unusual 'hopping' motion whereby the foot is thrust against the bottom, causing the shell to rise and then be thrown forward. Queen conch are most active during the night and graze on algae and detritus using their extendable proboscis (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This gastropod produces a large spiral shell with spines that are thought to be for protection (3). The shell has a wide, flared lip that is a rich pink colour (4). Within the shell, the gastropod's head has two pairs of tentacles; the larger ones carry eyes whilst the smaller pair provides a sense of smell and touch. The large foot is visible at the lip of the shell (3). The large, beautiful shell has been prized by tourists in recent years, but was previously valued more for its meat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The Queen Conch (Strombus gigas) is a large gastropod mollusk. Its shell is among the largest in the Florida-Caribbean area and has long been a favorite of collectors and souvenir hunters. Conch meat is an important food source in the West Indies. Overfishing for souvenirs and food has severely depleted Queen Conch populations in many areas. (Rehder 1981)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Strombus gigas is one of the largest and most commercially important gastropod molluscs in the Caribbean Sea, Bermuda, and Bahamas (Stoner et al. 1988). It is a member of the family Strombidae and one of seven species that occur in the western Atlantic Ocean. Queen conch adults have a widely flaring lip, while the lip of the juveniles is sharp and un-flared. The color of the adult shell is pale to bright pink with hues of yellow, peach and cream. S. gigas is coated with a moderately thick and horny periostracum protecting the shell from erosion. The periostracum begins to chip off when the animal dies.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Queen Conch (Strombus gigas) occurs from southeastern Florida to the West Indies and Venezuela (Rehder 1981).

The Queen Conch (Strombus gigas) occurs in Bermuda and south Florida through the West Indies (Morris 1973).

The Queen Conch (Strombus gigas) is found from south Florida to Brazil (Abbott 1968).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Strombus gigas is native to north and Central America. It is encountered along the Atlantic coast from South Carolina to the Florida Keys and in the Caribbean Sea and the Bahamas islands at depths from 0.3 to 18 m. S. gigas migrates en masse in offshore directions moving in a flood tide direction (Stoner et al. 1988, Stoner and Lally 1994). Juvenile queen conch are found in shallow, inshore seagrass meadows whereas adults are found in deeper algal plains and seagrass meadows distinct from juveniles (Stoner 1989). Juveniles move in large aggregations that most likely afford them protection from predation (Stoner and Lally 1994). Juvenile Strombus gigas occur in the shallow seagrass beds of the Indian River Lagoon.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The queen conch was previously found throughout the coastal waters of northern South America, north through the Caribbean and Bahamas to south Florida and Bermuda. Today the species has declined in numbers throughout much of this range (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

The shell of the The Queen Conch (Strombus gigas) is large and heavy. It is yellowish white with irregular brownish markings. Fresh shells have a thin, brown periostracum (the outermost layer of most mollusk shells) that flakes off when dry. The spire is high and strongly angled, with pointed knobs where obscure axial ribs cross angles; the knobs on the last 3 whorls are large and pointed. The interior of the outer lip and the aperture are pinkish, suffused with white or yellow. The outer lip has a broad upper expansion that is generally as high or higher than the spire; the lower half is somewhat wavy. Immature shells look quite different, with a high spire of strongly angled whorls, a narrow pointed base, and an unexpanded lip. (Rehder 1981)

The shell of the adult Queen Conch (Strombus gigas) is heavy and solid with a short conical spire. It is mostly body whorl, with an aperture that is moderately narrow and channeled at both ends. The outer lip is thickened and greatly flared in fully grown specimens. There are 8 to 10 whorls, with blunt nodes on the shoulders. The operculum is clawlike and horny. The shell is yellowish buff, with a bright rosy pink interior. Young specimens have zigzag axial stripes of brown. (Morris 1973)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Queen conch reach sexual maturity at approximately 3 1/2 to 4 years reaching a shell length of at least 180 mm and up to 5 pounds (Stoner 1989). Juvenile shells reach a length of 50 to 70 mm in the first year before they emerge from the sand (Stoner et al. 1988). The maximum reported size is 352 mm. Strombus gigas are recorded to live 6 to 7 years and as long as 20-30 years in deeper waters.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Queen Conch (Strombus gigas) may reach a height of 20 to 30 cm and exceed 2 kg in mass (Morris 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 1 - 54
  Temperature range (°C): 26.864 - 27.678
  Nitrate (umol/L): 0.253 - 0.781
  Salinity (PPS): 35.179 - 36.127
  Oxygen (ml/l): 4.660 - 4.699
  Phosphate (umol/l): 0.063 - 0.125
  Silicate (umol/l): 1.406 - 2.090

Graphical representation

Depth range (m): 1 - 54

Temperature range (°C): 26.864 - 27.678

Nitrate (umol/L): 0.253 - 0.781

Salinity (PPS): 35.179 - 36.127

Oxygen (ml/l): 4.660 - 4.699

Phosphate (umol/l): 0.063 - 0.125

Silicate (umol/l): 1.406 - 2.090
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2.5 - 16

Graphical representation

Depth range (m): 2.5 - 16
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Queen Conch (Strombus gigas) is found in sand and rubble, usually in or near eelgrass, in water 1.5 to 3.5 meters deep (Rehder 1981).

The Queen Conch (Strombus gigas) is found in shallow water (Morris 1973).

The Queen Conch (Strombus gigas) is found on sand and eelgrass at depths from less than a meter to 9 meters (Abbott 1968).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults are associated with shallow warm waters usually with a sandy substrate, where there is abundance of seagrasses, such as turtle (Thalasia testuinum), and manatee grass (Syringodium filiforme) or mats of microalgae (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Strombus gigas is an herbivore, feeding on detritus, macroalgae, and epiphytes (Ray and Stoner 1995). The green macroalga Batophora oerstedi appears to be a preferred food.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Wilson et al. (2005) investigated the use by fish of discarded Queen Conch shells, both single shells and middens (piles of shells discarded by fishermen). Although not all isolated shells were occupied by fish, all conch middens examined harbored fish. Fish species found within conch shells included many of the ecologically important herbivores, such as scarids and pomacentrids, as well as lutjanids, haemulids, and serranids which are exploited by fisheries throughout the Caribbean. Furthermore, juvenile fish showed a preference for conch shells over other microhabitats in three of the four habitat types surveyed. In the course of their study, Wilson et al. observed 9 species of fish from 6 different families in individual conch shells; in middens, they recorded shell use by 42 fish species representing 16 families. Although the main use of the conch shells was for shelter, on several occasions Stegastes species had laid eggs on the clean inner surface of conch shells and the goby Gnatholepis thompsoni was observed guarding egg clutches placed under the lip of shells. Conch shells may therefore represent important reproductive sites for fish. Fish abundance and species richness increased with midden size.

Ray-Culp et al. (1997) collected potential conch predators from conch nursery areas and tested them in the lab for their ability to kill newly settled Queen Conch. They tested species from 10 families of polychaetes, 8 families of crustaceans, 4 families of mollusks, and 2 families of fishes. Conch kills were made by calappid, portunid, majid, and hermit crabs; alpheid and palaemonid shrimps; panulirid lobsters; file fish; and five families of polychaete worms (glycerids, nereids, sigalionids, spionids, and syllids). Species from five families of polychaete worms (dorvilleids, glycerids, lumbrinerids, nereids, and phyllodocids) also killed competent (i.e., ready-to-settle) conch veliger larvae.

Over the long term, conch escape predation by outgrowing their predators, but larvae and young newly settled juveniles are highly vulnerable to predation Although small conch can leap away from some threats of immediate danger using their opercula, they cannot outrun highly mobile surface predators such as crabs. Studies by Ray-Culp et al. (1999) suggest that xanthid crabs and similar small predators may play an important role in structuring Queen Conch dynamics through their predation on newly settled conch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A small cardinal fish can sometimes be found living within the mantle of the conch. SPECIAL STATUS
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 1,000,000 individuals

Comments: After the Florida and U.S. harvest bans in 1985 and 1986 less than 6000 adult conch remained in the Florida keys (Glazer and Delgado, 2003). Since then ongoing surveys have shown a slow and very limited recovery with an estimated 25,000 adults in 2006 (Delgado and Glazer, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Densities of juvenile queen conch are usually 1 conch per meter square but have been recorded as high as 2.1 per meter square (Stoner et al. 1988). In southern Exuma Cay in the Bahamas, the average density of the conch was reported to be 1.72 per meter square in 1984 (Wicklund et al. 1991). Two year old queen conch have been observed to aggregate in even greater densities during periods of heavy wave action (Stoner 1989). Locomotion: Strombus gigas moves by a unique shell-thrusting motion called "leaping" (Hesse 1980). The queen conch uses its claw-like operculum to dig into the sand and then "pole" forward by extending the foot (Rupert and Barnes 1994). This is a very different mode of transportation from other gastropods.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Delgado et al. (2002) conducted a series of experiments in the lab showing that exposing hatchery-reared juvenile Queen Conch to a predator (the spiny lobster Panulirus argus) resulted in behavioral changes, and apparently even changes in shell density or thickness, that made previously exposed conchs less vulnerable to predatation in subsequent predation trials.

High-density aggregations of juvenile Queen Conch are sometimes observed on nursery grounds. Stoner and Lally (1994) argue that these animals aggregate to reduce the probability of any particular individual being attacked by a predator.

Glazer et al. (2003) studied the home ranges of adult Queen Conch at two sites in the Florida Keys. Mean home range was 5.98 hectares, with more movement during the summer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The pelagic larvae of the Queen Conch live in the water column for 18 to 28 days before they settle and metamorphose on the sediment. Little is known about early stages of the benthic (post-settlement) life of the Queen Conch. However, 1 year-old juveniles (80 to 100 mm shell length) are believed to emerge from the sediment and feed in seagrass beds that provide abundant algal and detrital foods. Sexual maturity is reached at approximately 3.5 yr of age (180 to 270 mm shell length), which is preceded by the development of a flared shell lip. (Stoner and Lally 1994 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Adult queen conch migrate to shallow, warmer inshore waters to mate and lay their eggs (Stoner et al. 1988). The peak reproduction period is from April to August. The queen conch lay between 180,000 - 460,000 eggs in gelatinous strings some as long as 50 -75 feet. Females may spawn many times during a reproductive season (Stoner et al. 1996).
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Planktotropic (feeding) larvae emerge and travel long distances in the water column (Davis et el. 1993). At approximately 18 days, the swimming veliger shifts to a swimming/crawling stage that allows it to move along the substratum and find an appropriate place to settle and metamorphose (Davis 1994). Metamorphosis occurs in response to environmental cues from algae and seagrasses (Davis 1994). After larval recruitment, metamorphosis, and settlement of plantonic larvae, the juveniles live in the sand for the first year until they reach 5-10 cm (Stoner et al. 1988, Stoner 1989). Once the juveniles emerge, they move to the seagrass beds to feed on plant detritus and algae, staying there for the next 2 years (Stoner et al. 1988, Stoner 1989).
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strombus gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTTGGCATGTGATCTGGCTTAGTTGGGACTGCTTTAAGCCTATTAATTCGAGCTGAACTCGGACAACCAGGGGCCTTATTAGGTGAC---GATCAGCTGTATAATGTAATTGTTACGGCTCATGCATTTGTTATAATTTTCTTCTTAGTTATGCCTATAATAATCGGCGGCTTTGGAAACTGATTGGTACCCCTAATATTAGGGGCTCCTGATATAGCTTTTCCACGATTAAATAACATAAGATTCTGATTATTACCCCCTGCTCTTCTGTTGCTTCTTTCTTCTGCAGCTGTCGAGAGTGGTGTTGGTACAGGATGAACAGTTTACCCTCCATTAGCTGGTAATTTAGCTCATGCTGGGGGATCAGTTGACTTAGCTATTTTTTCTCTTCACTTAGCTGGTGTATCCTCTATTCTAGGGGCTGTTAATTTTATTACTACAATTATCAATATACGATGACGAGGAATGCAATTTGAGCGATTGCCTCTCTTTGTATGATCAGTTAAGATTACAGCTGTTTTACTTCTACTTTCTTTACCGGTATTGGCTGGGGCTATTACAATACTTCTCACAGATCGAAATTTTAATACTGCATTTTTTGATCCTGCAGGGGGAGGTGATCCTATCTTATACCAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Strombus gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Queen Conch (Strombus gigas) supports important fisheries in the Caribbean. Unfortunately, the species has become so depleted that it is currently listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) Appendix II (Appendix II lists species that are not necessarily now threatened with extinction but that may become so unless trade is closely controlled). The Queen Conch once also supported commercial and recreational fisheries in south Florida. However, the ease of capture and desirability of the shell and meat resulted in a severe depletion of the local population to the point that in 1985 a total harvest ban was instituted in state waters and in 1986 in federal waters. After the ban was established, fewer than 6000 adult conch remained in the Florida Keys. Since then, ongoing surveys have shown a slow and very limited recovery with an estimated 25,500 adults in 2006. (Delgado and Glazer 2007 and references therein)

For some species, per capita population growth rate may become negative when population density drops too low (e.g., if low population density means that individuals cannot find mates or be properly stimulated to mate), so that below a certain population density a population may go into a tailspin. This is known in ecology as the "Allee Effect". Stoner and Ray-Culp (2000) examined the effect of adult Queen Conch population density on reproductive behavior. They surveyed adult density, reproductive behavior, and spawning in natural Queen Conch populations at 2 locations in the Exuma Cays, Bahamas. They found that mating never occurred when density was <56 conch per hectare, and spawning never occurred at <48 conch per hectare. Reproductive behavior increased rapidly to asymptotes at densities near 200 conch per hectare (i.e.,the effect of population density above 200 individuals/hectare was very slight). Heavily exploited populations of queen conch in the Caribbean have been slow to recover despite fishery closures. The findings of Stoner and Ray-Culp suggest that the failure of Queen Conch populations to recover might be attributable at least in part to spawning stock densities having being reduced to the point at which Allee effects begin to impact reproductive behavior.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: After the Florida and U.S. harvest bans in 1985 and 1986 less than 6000 adult conch remained in the Florida keys (Glazer and Delgado, 2003). Since then ongoing surveys have shown a slow and very limited recovery with an estimated 25,000 adults in 2006 (Delgado and Glazer, 2007).

Global Long Term Trend: Decline of 50-70%

Comments: After the Florida and U.S. harvest bans in 1985 and 1986 less than 6000 adult conch remained in the Florida keys (Glazer and Delgado, 2003). Since then ongoing surveys have shown a slow and very limited recovery with an estimated 25,000 adults in 2006 (Delgado and Glazer, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: The greatest threat to this species is commercial fisheries and poaching as the conch fishery crashed in Florida and has not recovered to exploitable levels despite a 20 year fishing moratorium (state ban 1985, federal ban 1986 in U.S.) and active reintroduction program (Glazer and Delgado, 2003). Similar crashes have occurred throughout other countries in the species' range and despite various fishing regulations and moratoria through CITES, the species continues to decline to below harvestable levels.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Queen conch have provided a staple meat source in the Caribbean region for centuries and in recent times have been extensively overfished for this resource. Their flesh is also used as fishing bait and the shells can be sold for the tourist trade (6). The tendency of conch to aggregate in shallow waters in order to spawn in the summer months has allowed them to be easily exploited. The population is now in decline throughout most of the region (5). Fishing for conch has been banned in Florida and Bermuda, but so far populations in these areas are showing few signs of recovery (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Legislation

The status and trends of regional Queen Conch fisheries led to listing of the species on Appendix II of the Convention on International Trade in Endangered Species (CITES) in 1990. The International Union for the Conservation of Nature (IUCN) categorized the species as “commercially threatened” on the 1994 Red List. More recently, the CITES Authority imposed a suspension of the export trade from the Dominican Republic, Honduras, and Haiti in 2003 based on evidence for declining stocks and the absence of an effective regulatory framework. In 2004, additional suspensions were implemented for
Antigua and Barbuda, Barbados, Dominica, and Trinidad and Tobago. Fisheries in 13 other countries were categorized as “of possible concern.” (Acosta 2006 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Queen Conch (Strombus gigas) that inhabit the nearshore waters of the Florida Keys are physiologically incapable of reproduction even when they have reached reproductively active sizes (Delgado et al. 2004). In addition, these conch are isolated from offshore breeding aggregations by the poor conch habitat in Hawk Channel, a naturally occurring deep-water channel that runs parallel to the Keys between the island chain and the offshore reef tract. The substrate on the bottom of Hawk Channel is predominantly soft sediment, which is poor conch habitat. This channel thus serves as a barrier to migration, isolating nearshore from offshore conch aggregations. Queen conch in other areas undergo ontogenetic migrations from shallow, nearshore sites to offshore habitats, but conch in the Florida Keys are prevented from doing so by Hawk Channel. Efforts to artificially connect the inshore and offshore areas isolated by Hawk Channel, however, have yielded encouraging resuls. Conch translocated from nearshore habitats into offshore breeding aggregations become reproductively active within just a few months (Delgado et al. 2004). The success of translocation efforts suggests that some component of the nearshore environment (e.g., pollutants, temperature extremes, poor food or habitat quality) disrupts reproduction in conch, but that removal of nearshore animals to suitable offshore habitat can restore reproductive viability. These results indicate that translocations are preferable to releasing hatchery-reared juveniles because they are more cost-effective, result in a more rapid increase in reproductive output, and maintain the genetic integrity of the wild stock. Translocating conch from nearshore larval sinks to offshore larval sources (spawning aggregations) may be the key to expediting the recovery of queen conch stocks in the Florida Keys. (Delgado et al. 2004; Delgado and Glazer 2007)

Queen conch is harvested in over 25 Caribbean countries, but fishery regulations vary considerably. For example, regulations may include shell size and/or meat weight limits (Bahamas, Bonaire, Puerto Rico and the U.S. Virgin Islands, St. Kitts and Nevis, St. Vincent and the Grenadines, Turks and Caicos Islands), closed season (Mexico, Puerto Rico and the U.S. Virgin Islands, Venezuela), and prohibition of fishing using scuba technology (Turks and Caicos Islands). Some countries (Bahamas, Dominica, Panama) have set landings or export quotas, but verification is difficult due to insufficient monitoring and reporting. A few countries have no fishery regulations or management plans for this species. (Acosta 2006)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Queen conch is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), thus requiring an export permit for trade to occur (7). In 1996, the countries within this conch's range recognised the importance of the species and adopted an International Queen Conch Initiative to promote a common international management strategy for the queen conch resource in the Caribbean region (8). It has been suggested that harvesting limits or marine reserves will allow the species to recover from overfishing in the past. Queen conches have been bred in captivity but attempted reintroduction programmes have so far proven unsuccessful (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Strombus gigas has been historically used by the Mayans, Arawak and Florida Indians for food and tools (Stoner et al. 1988). They are still highly valued as an inexpensive and nutritious food source in the Caribbean. Queen conchs are also highly prized for their shells and are the target of heavy fishing in tourist areas. In addition, they are cultured in western Montana for medicinal purposes.Queen conch populations are declining throughout their geographic range and, in some regions stocks have collapsed. In the United States, fishing for S. gigas is illegal and in Puerto Rico and the Virgin Islands the fishery is regulated by the Caribbean Fishery Management Council. In the Caribbean, the queen conch commercial fishery is estimated at 60 million U. S. dollars wholesale. A detailed report of the global net exports of queen conch from 1992-2001 is available online from CITES.
  • Davis M. 1994. Short-term competence in larvae of queen conch Strombus gigas: shifts in behavior, morphology and metamorphic response. Marine Ecological Progress Series 104:101-108.
  • Davis M, Bolton CA, and AW Stoner. 1993. A comparison of larval development, growth, and shell morphology in three Caribbean Strombus species. Veliger 36:236-244.
  • Hess KO. 1980. Gliding and climbing behavior of the queen conch, Strombus gigas. Caribbean Journal of Science 16:1-4.
  • ITIS. Integrated Taxonomic Information System. Available online.NOAA Office of Protected Resources. Available online.
  • Ray M and AW Stoner. 1995. Growth, survivorship, and habitat choice in a newly settled seagrass gastropod, Strombus gigas. Marine Ecological Progress Series 123:83-94.
  • Rosenberg G. 2005. Malacolog 4.1.0: A Database of Western Atlantic Marine Mollusca (version 4.1.0). Available online.
  • Rupert, EE and RD Barnes. 1994. Invertebrate Biology, Sixth Edition. Harcourt College Publishers, Fort Worth, TX pg. 395.
  • Stoner AW. 1989. Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment. 56:99-104.
  • Stoner AW and J Lally. 1994. High-density aggregation in queen conch Strombus gigas: formation, patterns, and ecological significance. Marine Ecology Progress Series 196:73-84.
  • Stoner AW, Lipcius RN, Marshall LS Jr., and AT Bardales. 1988. Synchronous emergence and mass migration in juvenile queen conch. Marine Ecological Progress Series 49:51-55.
  • Stoner AW, Ray M, Glazer RA, and KJ McCarthy. 1996. Metamorphic responses to natural substrata in gastropod larvae: decisions related to postlarval growth and habitat preference. Journal of Experimental Marine Biology and Ecology 205:229-243.
  • Wicklund RI, Hepp LJ, and GA Wenz. 1991. Preliminary studies on the early development of the queen conch, Strombus gigas, in the Exuma Cays, Bahamas. Proceedings of the 40th Annual Gulf and Caribbean Fisheries Institute 40:283-298.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: The proactive strategy for restoring Florida's depleted population includes increasing the spawning stock by translocating reproductively deficient individuals into existing spawning aggregations where previous research has shown translocated conch will develop normally. A study by Delgado and Glazer (2007) showed displacement of native conch populations does not occur following relocation of conch from non-viable sites and that translocating conch into spawning aggregations does not have adverse consequences relative to the interactions among conspecifics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lobatus gigas

Lobatus gigas, commonly known as the queen conch, is a species of edible sea snail, a marine gastropod mollusk in the family of true conchs, the Strombidae. This species is one of the largest mollusks native to the Tropical Northwestern Atlantic, from Bermuda to Brazil, reaching up to 35.2 cm (13.9 in) in shell length.

The queen conch is herbivorous and lives in seagrass beds, although the exact habitat varies during the different stages of its development. The adult animal has a very large, solid and heavy shell, with knob-like spines on the shoulder, a flared thick outer lip and a characteristic pink-colored aperture (opening). The flared lip is completely absent in younger specimens. The external anatomy of the soft parts of L. gigas is similar to that of other snails in the same family: it has a long snout, two eyestalks with well-developed eyes and additional sensory tentacles, a strong foot and a corneous sickle-shaped operculum.

The shell and soft parts of living Lobatus gigas serve as a home to several different kinds of commensal animals, including slipper snails, porcelain crabs and cardinal fish. Its parasites include coccidians. The queen conch is hunted and eaten by several species of large predatory sea snails, and also by starfish, crustaceans and vertebrates (fish, sea turtles and humans). The meat of this sea snail is consumed by humans in a wide variety of dishes. The shell is sold as a souvenir and used as a decorative object. Historically, Native Americans and indigenous Caribbean peoples used parts of the shell to create various tools.

The queen conch is protected under the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) agreement, in which it is listed as Strombus gigas. This species is not yet truly endangered in the Caribbean as a whole, but it is commercially threatened in numerous areas. This is partly because of extreme overfishing; the meat is an important food source for humans. The CITES regulations are designed to halt the export of the meat of this species as well as the commercial export of the shells as decorative objects. Both of these trades were previously so prevalent that they represented serious threats to the survival of the species.

Contents

Taxonomy and naming

An antique-looking illustration, numbered 321, showing a large, apparently left-handed, sea snail shell with knobs on the shoulders of the whorls
During the 20th century, for a number of years this very early illustration was designated as the neotype of this species: a figure of L. gigas from Recreatio mentis, et occuli (1684). The shell in the figure appears left-right reversed because of the engraving process. The original type was subsequently found, invalidating this designation.[8]

The queen conch was originally described from a shell in 1758 by the Swedish naturalist and taxonomist Carl Linnaeus in his ground-breaking book Systema Naturae.[1] Linnaeus named the species Strombus gigas, and that remained the accepted name for over two hundred years. Linnaeus did not mention a specific locality for this species in his description, giving only "America" as the type locality.[9] The specific name is the Ancient Greek word gigas (γίγας), which means "giant", alluding to the large size of this snail compared with almost all other gastropod mollusks. Strombus lucifer, which was considered to be a synonym much later, was also described by Linnaeus in Systema Naturae.[1]

In the first half of the 20th century, the type material for the species was thought to have been lost; in other words, the shell on which Linnaeus based his original description and which would very likely have been in his own collection, was apparently missing, and without type material to formally define the species, this created a problem for taxonomists. To remedy this, in 1941 a neotype of this species was designated by the American malacologists William J. Clench and R. Tucker Abbott. In this case, the neotype was not an actual shell or whole specimen, but a figure from a book that was published in the 17th century, 23 years before Linnaeus was even born, the 1684 Recreatio mentis, et occuli by the Italian scholar Filippo Buonanni. This was the first book published that was solely about seashells.[10][9][11][12] In 1953 however, the Swedish malacologist Nils Hjalmar Odhner searched the Linnaean Collection at Uppsala University and discovered the original shell upon which Linnaeus had based his description, thereby invalidating Clench and Abbott's neotype designation.[13]

The family Strombidae has recently undergone an extensive taxonomic revision, and a few subgenera, including Eustrombus, were elevated to genus level by some authors.[14][15][16] Petuch (2004)[17] and Petuch and Roberts (2007)[18] recombined this species as Eustrombus gigas, and Landau et al. (2008) recombined it as Lobatus gigas.[16]

Common names

As well as the English names "queen conch" and "pink conch", common names for this species in the languages spoken where it occurs include caracol rosa and caracol rosado in Mexico, caracol de pala, cobo, botuto and guarura in Venezuela, caracol reina and lambí in the Dominican Republic.[19][20][21][22][23]

Anatomy

Shell description

Large shell with flared lip, viewed facing the opening which is glossy and tinted with shades of pink and apricot
Apertural view of an adult shell from Trinidad & Tobago, anterior end to the left

The adult shell of this species is usually 15–31 cm (6–12 in) in length,[24][25] and the maximum reported size is 35.2 cm (13.9 in).[7][12] The shell is very solid and heavy, with 9 to 11 whorls and a widely flaring and thickened outer lip.[12] In the shells of adult snails, a structure called the stromboid notch is present on the edge of the lip. Although this notch is not as well developed in this species as it is in many other species in the same family,[12] the shell feature is nonetheless visible in an adult dextral (normal right-handed) specimen, as a secondary anterior indentation in the lip of the shell, to the right of the siphonal canal, assuming the shell is viewed ventrally. In life, the animal's left eyestalk protrudes through this notch.[12][26][27][28]

The spire (a protruding part of the shell which includes all of the whorls with the exception of the largest and final whorl, known as the body whorl) is usually higher (more elongated) in this species than it is in the shells of other strombid snails, such as the closely related and even larger goliath conch, Lobatus goliath, a species endemic to Brazil.[12] In Lobatus gigas, the glossy finish or glaze around the aperture of the adult shell is colored primarily in shades of pink. This pink glaze is usually pale, and may show a cream, peach or yellow coloration, but it can also sometimes be tinged with a deep magenta, shading almost to red. The periostracum, a layer of protein (conchiolin) which is the outermost part of the shell surface, is thin and a pale brown or tan color in this species.[25][26][27]

Abapertural (left) and apertural (right) views of a beachworn and slightly bleached-out juvenile shell of L. gigas

The overall shell morphology of L. gigas is not solely determined by the animal's genes; environmental conditions such as geographic location, food supply, temperature and depth, and biological interactions such as exposure to predation, can greatly affect it.[29][30] Juvenile conchs develop heavier shells when exposed to predators compared to those that are not exposed to predators. Conchs also develop wider and thicker shells with fewer but longer spines when they are living in deeper water.[30]

The shells of very small juvenile queen conchs are strikingly different in appearance from those of the adults. Noticeable is the complete absence of a flared outer lip; juvenile shells have a simple sharp lip, which gives the shell a conical or biconic outline. In Florida, juvenile queen conchs are known as "rollers", because wave action very easily rolls their shells, whereas it is nearly impossible to roll the shell of an adult specimen, due to its weight and asymmetrical profile. Subadult shells have a flared lip which is however very thin; the flared outer lip of an adult shell constantly increases in thickness with age, until death.[31][32][33]

Five different views of an adult shell

Historic illustrations

Index Testarum Conchyliorum (published in 1742 by the Italian physician and malacologist Niccolò Gualtieri) contains three illustrations showing the morphology of adult queen conch shells from different perspectives. The knobbed spire and the flaring outer lip, with its somewhat wing-like contour expanding out from the last whorl, is a striking feature of these images. The shells are shown as if balancing on the edge of the lip and/or the apex; this was presumably done for artistic reasons as these shells cannot be balanced like this.

Considered as one of the most prized and sumptuous shell publications of the 19th century, a series of books titled Illustrations conchyliologiques ou description et figures de toutes les coquilles connues, vivantes et fossiles (published by the French naturalist Jean-Charles Chenu from 1842 to 1853), contained several illustrations of both adult and juvenile L. gigas shells, and one non colored drawing depicting some of the animal's soft parts.[34] Almost forty years later, a colored illustration from the Manual of Conchology (published in 1885 by the American malacologist George Washington Tryon) shows a dorsal view of a small juvenile shell with its typical brown and white patterning.[33]

Antique illustration of large sea snail shell with flaring lip, as viewed more or less from the apex
Adult shell, apical view, Gualtieri, 1742
Similar large shell viewed from the apertural side
Adult shell, ventral view, Gualtieri, 1742
Similar shell viewed from the side opposite the aperture
Adult shell, dorsal view, Gualtieri, 1742
shell viewed from the apertural side
Juvenile shell, Tryon, 1885

Anatomy of the soft parts

A stout mottled eyestalk protruding from the siphonal canal of the shell with a ringed eye at the tip of the eyestalk and a small tentacle nearby branching off of the eyestalk
At the tip of the eyestalk is the well-developed eye, near the tip is a small sensory tentacle

Many details about the anatomy of Lobatus gigas were not well known until 1965, when the zoologist Colin Little published a general study on the subject.[35] More recently, in 2005, the Brazilian malacologist Luiz R. L. Simone gave a detailed anatomical description of the species.[15]

Lobatus gigas has a long extensible snout with two eyestalks (also known as ommatophores) that originate from its base. The tip of each eyestalk contains a large, well-developed lens eye, with a black pupil and a yellow iris[12] (if amputated, the eyes can be completely regenerated),[36] and a small slightly posterior sensory tentacle.[24] Inside the mouth of the animal is a radula (a tough ribbon covered in rows of microscopic teeth) of the taenioglossan type.[35]

Both the snout and the eyestalks show dark spotting in the exposed areas. The mantle is darkly colored in the anterior region, fading to light gray at the posterior end, while the mantle collar is commonly orange, and the siphon is also orange or yellow.[35]

When the soft parts of the animal are removed from the shell, several organs are distinguishable externally, including the kidney, the nephiridial gland, the pericardium, the genital glands, stomach, style sac, and the digestive gland.[35] In adult males, the penis is also visible.

A drawing of an adult male Lobatus gigas (from Duclos in Chenu, 1844) showing the external soft parts including the spade-shaped penis on the left. Separate details show the mouth, and both sides of the claw-like operculum

Lobatus gigas has a large and powerful foot, which has brown spots and markings towards the edge, but is white nearer to the visceral hump (the part of the animal that stays inside, protected by the shell, and which accommodates a number of internal organs). The base of the anterior end of the foot has a distinct groove, which contains the opening of the pedal gland. Attached to the posterior end of the foot for about one third of its length is the dark brown, corneous, sickle-shaped operculum, which is reinforced by a distinct central rib. The base of the posterior two-thirds of the animal's foot is rounded; only the anterior third of the foot is applied to the substrate during locomotion.[15][35]

The columella, the central pillar within the shell, serves as the attachment point for the white collumellar muscle. Contraction of this large strong muscle allows all of the soft parts of the animal to withdraw into the shell in response to undesirable stimuli.[35]

Distribution

Lobatus gigas is native to the tropical Western Atlantic coasts of North and Central America.[27] It lives in the greater Caribbean tropical zone, at depths from 0.3 m to 18 m.[27] Although the species undoubtedly occurs in more individual places than are listed here, the countries, regions, and islands where this species has been recorded within the scientific literature as occurring are, in alphabetical order:[7][37][38]

map showing some of the Western Atlantic Ocean and the eastern parts of North America, Central America and the north part of South America, with a shaded area over the water covering Bermuda, Florida, the Gulf of Mexico, all of the Caribbean Sea and south from there to the northern part of the Brazilian coast
The shaded area of this map indicates the geographical distribution of Lobatus gigas.

Aruba, of the Netherland Antilles; Barbados; Bimini, Cat Island, Eleuthera, Grand Bahama Island, Inagua (Great or Little) and Little San Salvador in the Bahamas; Belize; Bermuda; North and northeastern regions of Brazil (though this is contested by some authors);[12] Old Providence Island in Colombia; Costa Rica; the Dominican Republic; Panama; Swan Islands in Honduras; Jamaica; Martinique; Alacran Reef, Campeche, Cayos Arcas and Quintana Roo, in Mexico; Puerto Rico; Saint Barthélemy; Mustique and Grenada in the Grenadines; Pinar del Rio, North Havana Province, North Matanzas, Villa Clara, Cienfuegos, Holguin, Santiago de Cuba and Guantanamo, in the Turks and Caicos Islands and Cuba; South Carolina, Florida, including East Florida, West Florida, the Florida Keys and the Flower Garden Banks National Marine Sanctuary, in the United States; Carabobo, Falcon, Gulf of Venezuela, Los Roques archipelago, Los Testigos Islands and Sucre in Venezuela; St. Croix in the Virgin Islands.

Behavior

Lobatus gigas has an unusual means of locomotion, which was described in 1922 by the American zoologist George Howard Parker (1864–1955).[39][40] The animal first fixes the posterior end of the foot by thrusting the point of the sickle-shaped operculum into the substrate, then it extends the foot in a forward direction, lifting and throwing the shell forward in a so-called leaping motion. This way of moving is considered to resemble that of pole vaulting,[41] making L. gigas a good climber even of vertical concrete surfaces.[42] This odd leaping form of locomotion may also help prevent predators from following the snail's chemical traces, which would otherwise be a continuous trail on the substrate.[43]

Ecology

Live snail (on sandy bottom) from the front, showing eyestalks protruding from two large notches in the edge of the lip of the shell, which looks "mossy"
Anterior view of a live individual. The eyestalk on the left is protruded through the stromboid notch, and the eyestalk on the right is protruded through the siphonal canal. The outer surface of the shell is covered by periphyton

Habitat

Lobatus gigas lives in seagrass meadows and on sandy substrate,[44] usually in association with turtle grass (species of the genus Thalassia, namely Thalassia testudinum[31] and also Syringodium sp.)[29] and manatee grass (Cymodocea sp.).[45] Juvenile individuals are found in shallow, inshore seagrass meadows, which are different from the deeper algal plains and seagrass meadows where adult individuals live.[27][46]

The critical nursery habitats for juvenile individuals are defined by a series of combined factors, both habitat characteristics (such as tidal circulation) and ecological processes (such as macroalgal production), which together provide high rates of both recruitment and survival.[47] Lobatus gigas is typically found in distinct aggregates, which may contain several thousand individuals.[30]

Life cycle

Lobatus gigas is gonochoristic, which means each individual snail is either distinctly male or distinctly female.[28] Females are usually larger than males in natural populations, with both sexes existing in similar proportion.[44] After internal fertilization,[30] the females lay eggs in gelatinous strings, which can be as long as 75 feet (or about 23 m).[27] These are layered on patches of bare sand or seagrass. The sticky surface of these long egg strings allows them to coil and agglutinate, mixing with the surrounding sand to form compact egg masses, the shape of which is defined by the anterior portion of the outer lip of the female's shell while they are layered.[30][48] Each one of the egg masses may have been fertilized by multiple males.[48] The number of eggs per egg mass may vary greatly depending on environmental conditions, such as food limitation and temperature.[30][48] Commonly, females produce an average of 8–9 egg masses per season,[28][49] each containing 180,000–460,000 eggs,[27] but numbers can be as high as 750,000 eggs per egg mass depending upon the conditions.[30] Lobatus gigas females may spawn multiple times during the reproductive season,[27] which lasts from March to October, with activity peaks occurring from July to September.[28]

After hatching, the emerging two-lobed veliger (a larval form common to various marine and fresh-water gastropod and bivalve mollusks)[50] spend several days developing in the plankton, feeding primarily on phytoplankton. Metamorphosis occurs in about 16–40 days from the hatching,[30] when the fully grown protoconch (embryonic shell) is about 1.2 mm high.[44] After the metamorphosis, Lobatus gigas individuals spend the rest of their lives in the benthic zone (on or in the sediment surface), usually remaining buried during their first year of life.[51]

The queen conch is known to reach sexual maturity at approximately 3 to 4 years of age, reaching a shell length of nearly 180 mm and weighing up to 5 pounds.[27][28] Individuals may usually live up to 7 years, though in deeper waters their lifespan may reach 20–30 years[27][30][44] and maximum lifetime estimates reach 40 years.[52] It is believed that the mortality rate tends to be lower in matured conchs due to their thickened shell, but it could be substantially higher for juveniles. Estimates have demonstrated that the mortality rate of L. gigas decreases as the animal size increases, and can also vary due to habitat, season and other factors.[51]

A dense bed of seagrass with a shell in the middle of it
A subadult individual in a seagrass bed, Rice Bay, San Salvador Island, Bahamas

Feeding habits

Strombid gastropods were widely accepted as carnivores by several authors in the 19th century, a conception that persisted until the first half of the 20th century. This erroneous idea probably originated in the writings of Jean-Baptiste Lamarck, who classified strombids alongside other supposedly carnivorous snails, and was posteriorly recovered by other authors. The claims of such authors, however, were never supported by in situ observations.[53] Lobatus gigas is now known to be a specialized herbivore,[25] as is the case in other Strombidae,[14][53] feeding on macroalgae (including red algae, such as species of Gracilaria and Hypnea),[33] seagrass[45] and unicellular algae, intermittently also feeding on algal detritus.[53][54] The green macroalga Batophora oerstedii is one of its preferred foods.[27]

Interspecific relationships

A sandy bottom. On it a large sea snail with a bright orange-red body and a large operculum is reaching far into the shell of a queen conch.
A horse conch, Pleuroploca gigantea, feeding on L. gigas in Dry Tortugas National Park, Florida, June 2010

A few different animals may establish a commensal interaction with L. gigas, which means both the organisms maintain a relationship where one individual benefits (the commensal) but the other obtains no advantage (in this case, the queen conch). Some commensals of this species are also mollusks, mainly slipper shells (Crepidula spp.).[29] The porcelain crab, Porcellana sayana, is also known to be a commensal,[29] and a small cardinal fish, known as the conch fish (Astrapogon stellatus),[29] sometimes lives in the mantle of the conch for protection, bringing L. gigas no apparent benefit.[27] L. gigas is very often parasitized by protists of the phylum Apicomplexa,[55][56] which are common parasites of mollusks. Those coccidian[55] parasites, which are spore-forming, single-celled microorganisms, initially establish themselves in large vacuolated cells of the hosts digestive gland, where they reproduce freely.[55][56] The infestation may proceed to the secretory cells of the same organ, and the entire life cycle of the parasite will likely occur within the same host and tissue.[55]

A human hand is holding an immature queen conch shell, inside which is a very large brown hermit crab.
The giant hermit crab, Petrochirus diogenes, inside a subadult shell of L. gigas

L. gigas is a prey species for several carnivorous gastropod mollusks, including the apple murex Chicoreus pomum, the horse conch Pleuroploca gigantea, the lamp shell Turbinella angulata, the moon snails Natica spp. and Polinices spp., the muricid snail Murex margaritensis, the trumpet triton Charonia variegata and the tulip snail Fasciolaria tulipa.[12][24][57] A variety of crustaceans are also known predators of conchs, such as the blue crab Callinectes sapidus, the box crab Calappa gallus, the giant hermit crab Petrochirus diogenes, the spiny lobster Panulirus argus and several other species.[24][57] The queen conch is also prey to echinoderms, such as the cushion star, Oreaster reticulatus, and vertebrates, including fish (such as the permit Trachinotus falcatus[58] and the porcupine fish Diodon hystrix), loggerhead sea turtles (Caretta caretta) and humans.[24][57]

Human uses

Three rather worn queen conch shells: the one on the left has a hole in the spire of the shell.
Fished (and rather beachworn) shells of Lobatus gigas from Fort Napoleón, Guadeloupe. The shell on the left shows the hole that is made to reach and cut the columellar muscle, which enables the removal of the soft parts (the "meat") from the shell.[12]

Conch meat has been eaten by humans for centuries, and has traditionally been an important part of the diet in many islands in the West Indies. It is consumed raw, marinated, minced or chopped in a wide variety of dishes, such as salads, chowder, fritters, soups, stew, pâtés and other local recipes.[24][41][45][59] In the Spanish-speaking regions, for example in the Dominican Republic, Lobatus gigas meat is known as lambí. Although the queen conch meat is used mainly for human consumption, it is also sometimes employed as fishing bait (usually the foot is utilized for such purpose).[45][52] L. gigas is among the most important fishery resources in the Caribbean: its harvest value was US$30 million in 1992,[30] increasing to $60 million in 2003.[60] The total annual harvest of meat of L. gigas ranged from 6,519,711 kg to 7,369,314 kg between 1993 and 1998, and later its production declined to 3,131,599 kg in 2001.[60] Data about imports of queen conch meat into the United States shows a total of 1,832,000 kg in 1998, as compared to 387,000 kg in 2009, a drastic reduction of nearly 80%, twelve years later.[61]

very large yellowish sea shell with flared lip uppermost. It has a shiny pink opening. The lip of the shell is unnaturally smooth in outline
Lobatus gigas as a decoration: the lip has been cut or filed to give it a neater appearance

Queen conch shells were used by Native Americans and Caribbean Indians in a wide variety of ways. The South Florida Indians (such as the Tequesta), the Carib, the Arawak and Taino used conch shells to fabricate tools (such as knives, axe heads and chisels), jewelry, cookware and also used them as blowing horns.[24][62] Aztecs used the shell as part of jewelry mosaics like the double-headed serpent.[63] Brought by explorers, queen conch shells quickly became a popular asset in early modern Europe. In the late 17th century they were widely used as decoration over fireplace mantels and English gardens, among other places.[41] In contemporary times, queen conch shells are mainly utilized in handicraft. Shells are made into cameos, bracelets and lamps,[45][64] but have also been traditionally used as doorstops or decorations by families of seafaring men.[64] The shell of the queen conch has been, and continues to be, popular as a decorative object, though its export is now regulated and restricted by the CITES agreement.[24]

Very rarely (about 1 in 10,000 conchs),[24] a pink-colored conch pearl may be found within the mantle of the animal.[24][32] Though they occur in a range of colors, pink-colored pearls are considered to be the most desirable.[65] Those pearls are considered semi-precious,[12] a popular tourist curio,[45] and the most attractive among them have been used to create necklaces and earrings. A conch pearl is a non-nacreous pearl (formerly referred to by some sources as a 'calcareous concretion' – see the pearl article), which differs from most pearls sold as gemstones.[65]

Threats and conservation measures

Within the conch fisheries, one of the threats to sustainability stems from the fact that there is almost as much meat in large juveniles as there is in adults, but only adult conchs can reproduce and thus build up a population.[59] In many places where adult conchs have become rare due to overfishing, larger juveniles and subadult animals are taken by the fishermen before the snails have had a chance to mate and lay eggs.[59][66]

On a number of islands, subadult conchs form the vast majority of the harvest.[67] The abundance of Lobatus gigas is declining throughout the species' range as a result of overfishing and poaching, and populations of the species in Honduras, Haiti and the Dominican Republic, in particular, are currently being exploited at rates that may be unsustainable.[52] In fact, trade from many Caribbean countries is known or suspected to be unsustainable, and illegal harvest, including fishing of the species in foreign waters and subsequent illegal international trade, is a common and widespread problem in the region.[52] The Caribbean "International Queen Conch Initiative" is an attempt at a fisheries management scheme for this species.[38]

The queen conch fishery is usually managed under the regulations of individual nations. In the United States all taking of queen conch is prohibited in Florida and in adjacent Federal waters. No international regional fishery management organization exists in the whole Caribbean area, but in places such as Puerto Rico and the Virgin Islands, queen conch is regulated under the auspices of the Caribbean Fishery Management Council (CFMC).[52] In 1990, the Parties to the Convention for the Protection and Development of the Marine Environment of the Wider Caribbean Region (Cartagena Convention) included queen conch in Annex II of its Protocol Concerning Specially Protected Areas and Wildlife (SPAW Protocol) as a species that may be used on a rational and sustainable basis and that requires protective measures. Because of this recognition, in 1992 the United States proposed queen conch for listing in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES); this proposal was adopted, and queen conch became the first large-scale fisheries product to be regulated by CITES.[52]

Although this species has been mentioned in CITES since 1985[30] and has been listed in Appendix II[68] since 1992,[69] it is only since 1995 that CITES has been reviewing the biological and trade status of the queen conch under its "Significant Trade Review" process. Significant Trade Reviews are undertaken when there is concern about levels of trade in an Appendix II species. Based on the 2003 review,[60] CITES recommended that all countries prohibit the importation of queen conch from Honduras, Haiti and the Dominican Republic, according to Standing Committee Recommendations.[70] Queen conch meat continues to be available from many other Caribbean countries, including Jamaica and the Turks and Caicos Islands (British West Indies), which have well-managed queen conch fisheries.[52]

References

This article incorporates public domain text (a public domain work of the United States Government) from the reference.[52]

  1. ^ a b c Linnaeus, C. (1758). Systema Naturae, 10th ed., vol. 1. 824 pp. Laurentii Salvii: Holmiae (Stockholm, Sweden). p. 745.
  2. ^ Clench, W. J. (1937). "Descriptions of new land and marine shells from the Bahama Islands." Proceedings of the New England Zoölogical Club 16: 17–26, pl. 1. (Stated date: 5 February 1937.) On pages 18–21, plate 1 figure 1.
  3. ^ Smith, M. (1940). World Wide Seashells: illustrations, geographical range and other data covering more than sixteen hundred species and sub-species of molluscs (1 ed.). Lantana, Florida: Tropical Photographic Laboratory. p. 131. 
  4. ^ McGinty, T. L. (1946). "A new Florida Strombus, S. gigas verrilli". The Nautilus 60: 46–48, plates. 5–6: plate 5, figs. 2–3; plate 6, figs. 7–8.
  5. ^ Burry, L. A. (1949). Shell Notes (Lantana, Florida: Frank Lyman) 2: 106–109. 
  6. ^ Petuch, E. J. (1994). Atlas of Florida Fossil Shells. Chicago Spectrum Press: Evanston, Illinois., xii + 394 pp., 100 pls. On page 82, plate 20: figure c.
  7. ^ a b c Eustrombus gigas (Linnaeus, 1758). A Database of Western Atlantic Marine Mollusca, Malacolog Version 4.1.1.. Retrieved 27 September 2009.
  8. ^ Allmon, W. D. (2007). "The evolution of accuracy in natural history illustration: reversal of printed illustrations of snails and crabs in pre-Linnaean works suggests indifference to morphological detail". Archives of natural history 34 (1): 174–191. doi:10.3366/anh.2007.34.1.174. 
  9. ^ a b Clench, W. J.; Abbott, R. T. (1941). "The genus Strombus in the Western Atlantic". Johnsonia 1 (1): 1–16. 
  10. ^ "Buonanni's Chiocciole (1681)". Digital Collections. The Academy of Natural Sciences. http://www.ansp.org/museum/digital_collections/shells/bounanni.php. Retrieved 12 September 2010. 
  11. ^ Buonanni, F. (1684). Recreatio mentis, et oculi in observatione animalium testaceorum Italico sermone primum proposita ... nunc ... Latine oblata centum additis testaceorum iconibus. Romae, Ex typographia Varesii. pp. 531–532. http://www.archive.org/stream/recreatiomentise00buon#page/n531/mode/2up. 
  12. ^ a b c d e f g h i j k Moscatelli, R. (1987). The superfamily Strombacea from Western Atlantic. São Paulo, Brazil: Antonio A. Nanô & Filho Ltda. pp. 53–60. 
  13. ^ Wallin, L. (2001). Catalogue of type specimens 4: Linnaean specimens. Uppsala, Sweden: Uppsala University Museum of Evolution Zoology section (UUZM). pp. 1–128. http://www.evolutionsmuseet.uu.se/samling/UUZM04_Linnaeus.pdf. 
  14. ^ a b Latiolais, J. M.; Taylor, M. S; Roy, K. & Hellberg, M. E. (2006). "A molecular phylogenetic analysis of strombid gastropod morphological diversity". Molecular Phylogenetics and Evolution (Elsevier) 41 (2): 436–444. doi:10.1016/j.ympev.2006.05.027. PMID 16839783. http://cstl-csm.semo.edu/mtaylor/pubs/Latiolaisetal2006.pdf. 
  15. ^ a b c Simone, L. R. L. (2005). "Comparative morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny". Arquivos de Zoologia (São Paulo: Museu de Zoologia – USP) 37 (2): 178–180. ISSN 0066-7870. http://www.revistasusp.sibi.usp.br/pdf/azmz/v37n2/a01v37n2.pdf. 
  16. ^ a b Landau, B. M.; Kronenberg G. C.; Herbert, G. S. (2008). "A large new species of Lobatus (Gastropoda: Strombidae) from the neogene of the Dominican Republic, with notes on the genus". The Veliger (Santa Barbara: California Malacozoological Society, Inc.) 50 (1): 31–38. ISSN 0042-3211. 
  17. ^ Petuch, E. J. (2004). Cenozoic Seas: The view from Eastern North America. CRC Press. pp. 1–308. ISBN 0-8493-1632-4. http://books.google.com/?id=K0hVJTLfGbMC&printsec=frontcover&dq=Cenozoic+Seas:+The+View+from+Eastern+North+America&q. 
  18. ^ Petuch, E. J.; Roberts, C. E. (2007). The geology of the Everglades and adjacent areas. Boca Raton, Florida: CRC Press, Taylor & Francis Group. pp. 1–212. ISBN 1-4200-4558-X. http://books.google.com/?id=_RlF61pBkqQC&printsec=frontcover&dq=petuch+geology+of+everglades&q. 
  19. ^ Rodríguez, B.; Posada, J.; Posada, J. (1994). "Revisión histórica de la pesquería del botuto o guarura (Strombus gigas L.) y el alcance de su programa de manejo en el Parque Nacional Archipiélago de Los Roques, Venezuela". In Appeldoorn R.; Rodríguez, B.. Queen conch biology, fisheries and mariculture. Caracas, Venezuela: Fundación Cientifica Los Roques. pp. 13–24. 
  20. ^ Buitriago, J. (1983). "Cria en cautiverio, del huevo al adulto, del botuto (Strombus gigas L)". Memoria Sociedad de Ciencias Naturales La Salle 43: 29–39. http://orton.catie.ac.cr/cgi-bin/wxis.exe/?IsisScript=AGRINVE.xis&method=post&formato=2&cantidad=1&expresion=mfn=003428. 
  21. ^ Avalos, D. C. (1988). "Crecimiento y mortalidad de juveniles de Caracol rosado Strombus gigas en Punta Gavilán, Q. Roo". Documentos de Trabajo (Mexico: Secretaria de Pesca) 16: 1–16. http://bases.bireme.br/cgi-bin/wxislind.exe/iah/online/?IsisScript=iah/iah.xis&src=google&base=REPIDISCA&lang=p&nextAction=lnk&exprSearch=105074&indexSearch=ID. 
  22. ^ Posada, J. M.; Ivan, M. R. & Nemeth, M. (1999). "Occurrence, abundance, and length frequency distribution of queen conch, Strombus Gigas, (Gastropoda) in shallow waters of the Jaragua National Park, Dominican Republic". Caribbean Journal of Science 35 (1–2): 70–82. http://www.cavehill.uwi.edu/FPAS/bcs/courses/Ecology/BL34B/fish5-3.pdf. 
  23. ^ Eustrombus gigas (Linnaeus, 1758). World Register of Marine Species, accessed 13 August 2010.
  24. ^ a b c d e f g h i j Toller, W.; Lewis, K-A. (2003). Queen Conch Strombus gigas. U.S.V.I. Animal Fact Sheet. 19. U.S.V.I. Department of Planning and Natural Resources Division of Fish and Wildife. http://fw.dpnr.gov.vi/education/FactSheets/PDF_Docs/19QueenConch.pdf. 
  25. ^ a b c Warmke, G. L.; Abbott, R. T. (1975). Caribbean Seashells. Dover Publications, Inc. p. 88. ISBN 0-486-21359-5. 
  26. ^ a b Leal, J. H. (2002). "Gastropods". In Carpenter, K. E.. The living marine resources of the Western Central Atlantic. Volume 1: Introduction, molluscs, crustaceans, hagfishes, sharks, batoid fishes, and chimaeras. FAO Species Identification Guide for Fishery Purposes. FAO. p. 139. ftp://ftp.fao.org/docrep/fao/009/y4160e/y4160e09.pdf. 
  27. ^ a b c d e f g h i j k l "Smithsonian Marine Station at Fort Pierce". Strombus gigas. Smithsonian Institution. http://www.sms.si.edu/IRLSpec/Strombus_gigas.htm. Retrieved 2009-10-26. 
  28. ^ a b c d e Davis, M. (2005). "Species Profile: Queen Conch, Strombus gigas". SRAC Publication No. 7203 (Southern Region Aquaculture Center). http://www.ca.uky.edu/wkrec/QueenConch.pdf. 
  29. ^ a b c d e Tewfik, A. (1991)."An assessment of the biological characteristics, abundance, and potential yield of the queen conch (Strombus gigas L.) fishery on the Pedro Bank off Jamaica". Thesis submitted in partial fulfillment of the requirements for the Degree of Masters of Science (Biology). Acadia University, Canada.
  30. ^ a b c d e f g h i j k McCarthy, K. (2007). "A review of queen conch (Strombus gigas) life-history. Sustainable Fisheries Division NOAA. SEDAR 14-DW-4.
  31. ^ a b Davis, J.E. (2003). "Population assessment of queen conch, Strombus gigas, in the Eustatius Marine Park, Netherlands Antilles". Eustatius Marine Park.
  32. ^ a b Abbott, R. T. (2002). Zim, H. S.. ed. Seashells of The World. New York: St. Martin's Press. ISBN 1-58238-148-8. 
  33. ^ a b c Tryon, G. W. (1885). Manual of Conchology, structural and systematic, with illustrations of the species. Volume 7. Terebridae, Cancellariidae, Strombidae, Cypraeidae, Ovulidae, Cassididae, Doliidae. pp. 107; 348.
  34. ^ "Chenu's Mollusks (1842-1853)". Digital Collections. The Academy of Natural Sciences. http://www.ansp.org/museum/digital_collections/shells/chenu.php. Retrieved 23 September 2010. 
  35. ^ a b c d e f Little, C. (1965). "Notes on the anatomy of the queen conch, Strombus gigas". Bulletin of Marine Science 15 (2): 338–358.  abstract.
  36. ^ Hughes, H. P. I. (1976). "Structure and regeneration of the eyes of strombid gastropods". Cell and Tissue Research 171 (2): 259–271. PMID 975213. 
  37. ^ Martin-Mora, E.; James, F. C.; Stoner, A. W. (1995). "Developmental plasticity in the shell of the queen conch Strombus gigas". Ecology (Ecological Society of America) 76 (3): 981–994. doi:10.2307/1939361. http://www.jstor.org/pss/1939361. 
  38. ^ a b "International Queen Conch Initiative". NOAA: Caribbean Fishery Management Council. http://www.strombusgigas.com. Retrieved 2009-09-27. 
  39. ^ Coan, E. V.; Kabat, A. R.; Petit, R. E. (2010). 2,400 Years of Malacology (7th ed.). American Malacological Society. p. 874. http://www.malacological.org/pdfs/2400years/2400yrs_of_Malacology_complete.pdf. 
  40. ^ Parker, G. H. (1922). "The leaping of the stromb (Strombus gigas Linn.)". Journal of Experimental Zoology 36 (2): 205–209. doi:10.1002/jez.1400360204. http://www3.interscience.wiley.com/journal/110509814/abstract?CRETRY=1&SRETRY=0. 
  41. ^ a b c "Queen conch: Florida’s spectacular sea snail". Sea Stats. Florida Fish and Wildlife Conservation Commission. 2006. http://research.myfwc.com/engine/download_redirection_process.asp?file=queenconch_4434.pdf&objid=-1595&dltype=product. Retrieved 31 August 2010. 
  42. ^ Hesse, K. O. (1980). "Gliding and climbing behaviour of the queen conch, Strombus gigas". Caribbean Journal of Science 16: 105–108. http://academic.uprm.edu/publications/cjs/VOL16/P105-107.PDF. 
  43. ^ Berg, C. J. (1975). "Behavior and ecology of conch (superfamily Strombacea) on a deep subtidal algal plain". Bulletin of Marine Science 25 (3): 307–317.  abstract.
  44. ^ a b c d Ulrich Wieneke (ed.). Lobatus gigas. In: Gastropoda Stromboidea. modified: 22 November 2008. Retrieved 23 June 2009.
  45. ^ a b c d e f "Gastropods". FAO Identification Sheets for Fishery Purposes: Western Central Atlantic (fishing area 31). Food and Agriculture Organization of the United Nations (FAO). http://www.strombusgigas.com/strombus%20species%20id%20pg2.pdf. 
  46. ^ Stoner, A. W. (1988). "Winter mass migration of juvenile queen conch Strombus gigas and their influence on the benthic environment". Marine Ecology Progress Series 56: 99–104.
  47. ^ Stoner, A. W. (2003). "What constitutes essential nursery habitat for a marine species? A case study of habitat form and function for queen conch". Marine Ecology Progress Series (Inter-Research) 257: 275–289. doi:10.3354/meps257275. ISSN 1616-1599. http://cat.inist.fr/?aModele=afficheN&cpsidt=15047378. 
  48. ^ a b c Robertson, R. (1959). "Observations on the spawn and veligers of conchs (Strombus) in the Bahamas". Proceedings of the Malacological Society of London 33 (4): 164–171. 
  49. ^ Davis, M.; Hesse, C.; Hodgkins, G. (1987). "Commercial hatchery produced queen conch, Strombus gigas, seed for the research and grow-out market". Proceedings of the Gulf and Caribbean Fisheries Institute (Gulf and Caribbean Fisheries Institute) 38: 326–335. 
  50. ^ Brusca, R. C.; Brusca, G. J. (2003). Invertebrates (2nd ed.). Sinauer Associates, Inc.. p. 936. ISBN 0878930973. 
  51. ^ a b Medley, P. (2008). Monitoring and managing queen conch fisheries: A manual. FAO Fisheries Technical Paper. 514. Rome: Food and Agriculture Organization of the Uniteded Nations (FAO). ISBN 978-92-5-106031-5. ftp://ftp.fao.org/docrep/fao/011/i0256e/i0256e.pdf. 
  52. ^ a b c d e f g h NOAA. Queen Conch (Strombus gigas). Retrieved 4 July 2009.
  53. ^ a b c Robertson, R. (1961). "The feeding of Strombus and related herbivorous marine gastropods". Notulae Naturae of the Academy of Natural Sciences of Philadelphia (343): 1–9. 
  54. ^ Stoner, A.; Ray, M. (1996). "Queen conch, Strombus gigas, in fished and unfished locations of the Bahamas: effects of a marine fishery reserve on adults, juveniles, and larval production". Fishery Bulletin (USA: National Oceanic and Atmospheric Administration (NOAA)) 94 (3): 551–565. http://fishbull.noaa.gov/943/stoner.pdf. 
  55. ^ a b c d Cárdenas, E. B.; Frenkiel, L.; Zarate, A. Z.; Aranda, D. A. (2007). "Coccidian (Apicomplexa) parasite infecting Strombus gigas Linné, 1758 digestive gland". Journal of Shellfish Research (NSA) 26 (2): 319–321. doi:10.2983/0730-8000(2007)26[319:CAPISG]2.0.CO;2. http://www.thefreelibrary.com/Coccidian+(Apicomplexa)+parasite+infecting+Strombus+gigas+Linne,+1758+...-a0168820706. 
  56. ^ a b Gros, O.; Frenkiel, L.; Aranda, D. A. (2009). (Abstract) "Structural analysis of the digestive gland of the queen conch Strombus Gigas Linnaeus, 1758 and its intracellular parasites". Journal of Molluscan Studies (UK: Oxford University Press) 75: 59–68. doi:10.1093/mollus/eyn041. ISSN 0260-1230. http://mollus.oxfordjournals.org/cgi/content/abstract/75/1/59 (Abstract). 
  57. ^ a b c Iversen, E. S.; Jory, D. E.; Bannerot, S. P. (1986). "Predation on queen conchs, Strombus gigas, in the Bahamas". Bulletin of Marine Science 39(1): 61–75.
  58. ^ Jory, D. E. (2006). (Abstract) "An incident of predation on queen conch, Strombus gigas L. (Mollusca, Strombidae), by Atlantic permit, Trachinotus falcatus L. (Pisces, Carangidae)". Journal of Fish Biology (The Fisheries Society of the British Isles) 28 (2): 129–131. doi:10.1111/j.1095-8649.1986.tb05149.x. http://www3.interscience.wiley.com/journal/119489331/abstract (Abstract). 
  59. ^ a b c "Virgin Islands Vacation Guide & Community". http://www.vinow.com/articles/101508/conch.php. Retrieved 13 April 2010. 
  60. ^ a b c CITES (2003). Review of Significant Trade in specimens of Appendix-II species. (Resolution Conf. 12.8 and Decision 12.75). Nineteenth meeting of the Animals Committee, Geneva (Switzerland), 18–21.
  61. ^ NOAA (2009). National Marine Fisheries Service Fisheries Statistics and Economics Division. [1]. Retrieved 4 July 2009.
  62. ^ Squires, K. (1941). "Pre-Columbian Man in Southern Florida". Tequesta (Florida International University) (1): 39–46. http://digitalcollections.fiu.edu/tequesta/files/1941/41_1_05.pdf. 
  63. ^ Turquoise mosaics from Mexico, Colin McEwan, p.32, 2003, British Museum. Retrieved 29 August 2010.
  64. ^ a b Abbott, R. T.; Morris, P. A. (1995). A Field Guide to Shells. New York: Houghton Mifflin Company. pp. 184–185. ISBN 0-395-69779-4. 
  65. ^ a b Fritsch, E.; Misiorowski, E. B. (1987). "The History and Gemology of Queen Conch "Pearls"". Gems & Gemology (Gemological Institute of America) 23 (4): 208–221. ISSN 0016-626X. http://gia.metapress.com/content/v1005136k21m0777/. 
  66. ^ Theile, S. (2001). "Queen conch fisheries and their management in the Caribbean". Traffic Europe (CITES): 1–77. http://www.google.com.br/url?sa=t&source=web&ct=res&cd=3&ved=0CB8QFjAC&url=http%3A%2F%2Fwww.traffic.org%2Fspecies-reports%2Ftraffic_species_invertebrates5.pdf&rct=j&q=In+places+where+adults+have+become+rare%2C+juveniles+are+often+harvested+by+conch+fisherman+before+they+have+reproduced&ei=elPES57QOsP48AaRqr3SDw&usg=AFQjCNGC3vifTkx8qEwc5c-GNGIEomHrFg. 
  67. ^ Oxenford, H. A.; et al (2007). Fishing and marketing of queen conch (Strombus gigas) in Barbados. CERMES Technical Report. 16. University of the West Indies, Barbados: Centre for Resource Management and Environmental Studies. http://www.cavehill.uwi.edu/cermes/Technical_Reports/Oxenford_et_al_2007_Barbados_conch_CRT.pdf. 
  68. ^ Appendices I, II and III. cites.org website. Retrieved 4 July 2009.
  69. ^ NOAA Fisheries Office of International Affairs website: CITES. Retrieved 4 July 2009.
  70. ^ "Standing Committee Recommendations". CITES Official Documents No 2003/057. 2003. http://www.cites.org/eng/notif/2003/057.shtml. Retrieved 16 April 2010. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!