Molecular Biology and Genetics

Molecular Biology

Barcode data: Strombus alatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATTTGGTATATGATCCGGTTTAGTTGGGACTGCTTTAAGTCTTCTAATTCGGGCTGAGCTCGGACAGCCAGGAGCCTTATTAGGTGAT---GACCAACTATACAATGTAATTGTTACAGCTCATGCATTTGTTATAATTTTCTTTTTAGTTATGCCCATGATAATTGGTGGTTTCGGAAATTGACTAGTGCCATTAATACTAGGAGCTCCTGATATAGCTTTTCCTCGATTAAATAATATAAGATTTTGACTTTTACCTCCTGCTCTCCTTTTACTACTTTCGTCAGCGGCCGTTGAAAGTGGAGTAGGTACAGGATGGACAGTTTATCCCCCTCTAGCTGGAAATCTAGCACATGCTGGTGGATCTGTAGATTTAGCTATTTTTTCTTTACACTTAGCTGGTGTTTCCTCTATTTTAGGAGCGGTTAATTTTATTACTACAATTATTAATATGCGGTGACGAGGAATACAGTTTGAGCGACTCCCACTCTTTGTATGATCAGTTAAGATTACTGCTGTGTTGTTGTTACTTTCTCTACCTGTTTTAGCTGGAGCCATTACAATGCTTCTTACAGATCGTAACTTCAATACTGCATTCTTTGATCCTGCGGGAGGTGGGGATCCAATTTTGTACCAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strombus alatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Strombus alatus

Strombus alatus, common name the "Florida fighting conch" is a species of medium-sized warm-water sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.

Distribution[edit]

This conch occurs in the Western Atlantic Ocean from North Carolina throughout Florida and the Gulf of Mexico, Louisiana, Texas and the east coast of Mexico.[1][2]

Description[edit]

The shell can be as large as 112 millimetres (4.4 in).[1][3]

This species is closely similar to Strombus pugilis, the West Indian fighting conch, which has a more southerly range. Strombus alatus shells have less prominent subsutural spines and a slightly more projected outer lip. Some scientists have treated the two as distinct species; others as subspecies.[4] In an extensive study of the Stromboidea in 2005, Simone provisionally treated these as distinct species, but observed that "no spectacular morphological difference was found [and] all related differences, even those of the genital system, can be regarded as extreme of variation of a single, wide distributed, variable species."[5]

Phylogeny[edit]

Fossil Strombus alatus
from Caloosahatchee Formation, Sarasota, Florida, USA

A cladogram based on sequences of nuclear histone H3 gene and mitochondrial cytochrome-c oxidase I (COI) gene showing phylogenetic relationships of (32 analyzed) species in the genus Strombus and Lambis, including Strombus alatus, was proposed by Latiolais et al. (2006):[6]

Habitat[edit]

The minimum recorded depth for this species is 0 m; the maximum recorded depth is 183 m.[3]

References[edit]

  1. ^ a b "Malacolog ver. 4.1.1". The Academy of Natural Sciences. Retrieved 2009-09-30. 
  2. ^ Perry, H.; Larsen, K. (2004). "Strombus alatus Gmelin, 1791 Florida Fighting Conch". A Picture Guide to Shelf Invertebrates from the Northern Gulf of Mexico. Retrieved 27 June 2010. 
  3. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  4. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 142.
  5. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 169.
  6. ^ a b Latiolais J. M., Taylor M. S., Roy K. & Hellberg M. E. (2006). "A molecular phylogenetic analysis of strombid gastropod morphological diversity". Molecular Phylogenetics and Evolution 41: 436-444. doi:10.1016/j.ympev.2006.05.027. PDF.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!