Molecular Biology and Genetics

Molecular Biology

Barcode data: Strombus alatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTTGGTATATGATCCGGTTTAGTTGGGACTGCTTTAAGTCTTCTAATTCGGGCTGAGCTCGGACAGCCAGGAGCCTTATTAGGTGAT---GACCAACTATACAATGTAATTGTTACAGCTCATGCATTTGTTATAATTTTCTTTTTAGTTATGCCCATGATAATTGGTGGTTTCGGAAATTGACTAGTGCCATTAATACTAGGAGCTCCTGATATAGCTTTTCCTCGATTAAATAATATAAGATTTTGACTTTTACCTCCTGCTCTCCTTTTACTACTTTCGTCAGCGGCCGTTGAAAGTGGAGTAGGTACAGGATGGACAGTTTATCCCCCTCTAGCTGGAAATCTAGCACATGCTGGTGGATCTGTAGATTTAGCTATTTTTTCTTTACACTTAGCTGGTGTTTCCTCTATTTTAGGAGCGGTTAATTTTATTACTACAATTATTAATATGCGGTGACGAGGAATACAGTTTGAGCGACTCCCACTCTTTGTATGATCAGTTAAGATTACTGCTGTGTTGTTGTTACTTTCTCTACCTGTTTTAGCTGGAGCCATTACAATGCTTCTTACAGATCGTAACTTCAATACTGCATTCTTTGATCCTGCGGGAGGTGGGGATCCAATTTTGTACCAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Strombus alatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Strombus alatus

Strombus alatus, common name the "Florida fighting conch" is a species of medium-sized warm-water sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.

Contents

Distribution

This conch occurs in the Western Atlantic Ocean from North Carolina throughout Florida and the Gulf of Mexico, Louisiana, Texas and the east coast of Mexico.[1][2]

Description

The shell can be as large as 112 millimetres (4.4 in).[1][3]

This species is closely similar to Strombus pugilis, the West Indian fighting conch, which has a more southerly range. Strombus alatus shells have less prominent subsutural spines and a slightly more projected outer lip. Some scientists have treated the two as distinct species; others as subspecies.[4] In an extensive study of the Stromboidea in 2005, Simone provisionally treated these as distinct species, but observed that "no spectacular morphological difference was found [and] all related differences, even those of the genital system, can be regarded as extreme of variation of a single, wide distributed, variable species."[5]

Phylogeny

Fossil Strombus alatus
from Caloosahatchee Formation, Sarasota, Florida, USA

A cladogram based on sequences of nuclear histone H3 gene and mitochondrial cytochrome-c oxidase I (COI) gene showing phylogenetic relationships of (32 analyzed) species in the genus Strombus and Lambis, including Strombus alatus, was proposed by Latiolais et al. (2006):[6]

Habitat

The minimum recorded depth for this species is 0 m; the maximum recorded depth is 183 m.[3]

References

  1. ^ a b "Malacolog ver. 4.1.1". The Academy of Natural Sciences. http://www.malacolog.org/search.php?nameid=2190. Retrieved 2009-09-30.
  2. ^ Perry, H.; Larsen, K. (2004). "Strombus alatus Gmelin, 1791 Florida Fighting Conch". A Picture Guide to Shelf Invertebrates from the Northern Gulf of Mexico. http://www.gsmfc.org/seamap/picture_guide/Gastropods/strombus%20alatus.pdf. Retrieved 27 June 2010.
  3. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  4. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 142.
  5. ^ Simone (2005): Comparative Morphological study of representatives of the three families of Stromboidea and the Xenophoroidea (Mollusca, Caenogastropoda), with an assessment of their phylogeny, p. 169.
  6. ^ a b Latiolais J. M., Taylor M. S., Roy K. & Hellberg M. E. (2006). "A molecular phylogenetic analysis of strombid gastropod morphological diversity". Molecular Phylogenetics and Evolution 41: 436-444. doi:10.1016/j.ympev.2006.05.027. PDF.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!