Overview

Distribution

Native to: NW Europe (Kerney & Cameron 1979); north to Scandinavia, west to France, and east to W Russia, Ukraine, Romania (Quick 1960; Likharev & Schileyko, MS; Serlova 2006; in Sysoev & Schileyko 2009).

Non-native to: Iceland, North America (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

External: Gray on dorsum, paler at sides and white toward foot fringe, dark bands on sides of body and mantle and with yellow below stripes; slight keel formed by larger tubercles along dorsal mid-line; bell-shaped in cross-section; opaque gray-white sole; clear mucus; (Quick 1960; Kerney & Cameron 1979).

Internal: Dark ovotestis, pinkish spermoviduct, yellow atrium; long spermatheca with short, wide duct; epiphallus with swollen ring around its base; long, thin oviduct; 4 mm long spermatophore with coiled anterior part, wider behind (Quick 1960).

A. circumscriptus and A. silvaticus are similar, but no yellow, smaller, and have a wider oviduct. A. subfuscus are similar but have colored body mucus and different internal anatomy (Kerney & Cameron 1979); relative to A. silvaticus, is flatter, lighter in color, with orange/yellow stripe under dark side stripes, conical atrium, larger epiphallus with swelling at its base, thicker spermatheca duct (Wiktor 1983).

Eggs: 3 x 2 mm, yellow or light brown, translucent; clutches to 30 eggs; laid late spring to fall (Quick 1960).

Juveniles: 5 mm long at hatching, yellow-gray, with a pale dorsal keel that diminishes with age (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Medium, 40-50 mm long (Kerney & Cameron 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

A. ater is a synanthrope that inhabits "ecotones" (Chichester & Getz 1973) such as gardens, parks, wastelands, fields, cemeteries, near buildings, garbage dumps (Kerney & Cameron 1979; Wiktor 1996). Takes shelter in leaf litter and moss or under logs and rocks (Quick 1960). Does not spread far into undisturbed habitat (Chichester & Getz 1969).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Traditionally in damp areas and wet meadows adjacent to streams but recently found in small, shallow riffle areas of cold water streams in Wisconsin (Haro et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Probably feeds on fungus, "lettuce in lab" (Chichester & Getz 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Preyed upon by lampyrid beetle larvae (Schwalb 1961, in Stephenson & Knutson 1966).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Aggregations occur with during dry conditions and unfavorable temperatures (Rollo & Wellington 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arion fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTTTATTAATTCGACTAGAACTAGGTACTACGGGA---GTTCTCACAGAT---GACCAATTTTTCAATGTCATTGTGACGGCGCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTCTAATAATTGGAGGGTTTGGCAATTGAATAGTGCCGCTTTTGATTGGCGCCCCTGATATAAGATTCCCCCGAATAAATAACATAAGCTTTTGATTACTCCCTCCTTCACTACTATTATTAGTGGTGTCCAGGATAGTTGAAGGTGGGGCGGGCACCGGTTGAACAGTGTACCCTCCTCTTAGAGGTATTGTAGCACATAGGGGTGCCTCTGTAGATTTAGCTATCTTCTCATTACATTTAGCAGGAATATCCTCCATCCTTGGAGCTATTAACTTTATTACTACTATTTTTAATATACGCCCGAAATCTTTAACCTTTGAACGGCTAAGATTATTTGTGTGATCTATTTTAATTACTGTGTTCCTATTACTTCTCTCTTTGCCGGTACTGGCTGGAGCGATTACTATACTTCTGACTGATCGCAATTTTAATACAAGATTTTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arion fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arion fasciatus

Arion fasciatus, common name the Orange-banded Arion, is a species of air-breathing, completely shell-less, land slug, a terrestrial pulmonate gastropod mollusk in the family Arionidae, the round-back slugs, first described by Sven Nilsson in 1823.

Contents

Distribution

Arion fasciatus are originally from Northern Europe, but spread to other cool, wet climates, including the British Isles, Canada and the Northern United States. They originally got across the Atlantic Ocean during the colonial era. These slugs are generally found in ecotonal habitats.[2]

Description

Arion fasciatus is very similar to most slugs in almost all ways. They are hermaphroditic with a head, mantle, and foot.

These slugs have two sets of retractable tentacles on their heads. The upper pair have light sensing organs, and the lower two are used to smell. These slugs have a mantle that covers much of the top of the first third of the body, with its pneumostome located on the back right portion of the mantle.

The foot has three sections horizontally across, and in the middle, on the head, is where the mouth and radula is. The orange banded arion has a darkened stripe that extends along the entire body and mantle length on both sides of the body, and is gray, off-white, or tan, with a very light colored foot.

The Arion fasciatus is about six centimeters in length when moving, secreting a clear mucus behind it. However, when disturbed, the mucus becomes denser and stickier. A study found that the thicker mucus can prevent predation by Carabid beetles, but that this mucus becomes exhausted after three minutes of stimulation. It then takes up to a day to get mucus production up to pre-attack levels, leaving the slug susceptible to other predators.[3]

Feeding habits

A study was done on the eating habits of Arion fasciatus, which found that it does not find fresh leaves as palatable, likely because they generally feed under the leaf litter layer. This is not to say that the orange-banded arion does not eat fresh vegetable matter.

This study also found that the diet of the orange-banded arion is variable throughout the year. For example, an increase in animal material during May and June. The hypothesis is that during the colder months slugs don't move much under the leaf litter, and take in a lot of leaves where the chlorophyll as already broken down, and during the warmer months, they take advantage of the earthworms and small arthropods who have high mortality rates.[4]

References

  1. ^ Nilsson S. 1823. Historia molluscorum Sveciae terrestrium et fluviatilium breviter delineata. pp. [1-2], I-XX [= 1-20], 1-124. Lundae. (Schuboth).
  2. ^ . JSTOR 1940544. 
  3. ^ [1]
  4. ^ . JSTOR 3543711. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!