Overview

Distribution

Geographic Range

Arion ater is a terrestrial slug, common in England and the Pacific Northwest. (BBC 2000).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Native to: British Isles, N and central Europe, Iceland, Russia (Quick 1960).

Non-native to: North America (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Although thought to be shell-less snails, Arion ater do have disc-type shells embedded in their mantle. This is surrounded by a fleshy oval tissue on their back. Slugs move about via a foot that, when flexed, allows the slug to control its movement.

Most Arion ater are orange when hatched, have a "straw" coloration until aproximately one inch in length, and eventually take on a black coloration. Typical slugs are about six inches long at maturity. (Branley 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

External: Largest Arion slug; varies greatly in color from black (northerly or mountain forms) to brown, red, orange or gray (southerly or cultivated land forms); foot fringe tends to be redder than body, with darker transverse lines; gray sole; large skin tubercles; big pneumostome; sticky body mucus may be clear or yellow; can form a hemisphere when contracted (Quick 1960; Kerney & Cameron 1979).

Internal: Ring at base of epiphallus where it enters the atrium; short free oviduct is surrounded by genital retractor; ligula (internal folds) in upper atrium; 18 mm long spermatophore, with serrations along its length and tapered at ends (Quick 1960; Kerney & Cameron 1979).

Atrial ligula is much smaller than in A. rufus (Quick 1960).

Juveniles: Sometimes have lateral bands; 10 mm long and pale yellow or greenish at hatching, gaining pigmentation as they age (Quick 1960; Kerney & Cameron 1979).

Eggs: 5 x 4 mm; opaque; turn pearly white to brown with age; up to 150 eggs per clutch (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

100-150 mm long extended (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Arion ater prefer grassy fields and crops of vegetation. Strictly terrestrial, they typically live in moist, cool soil (Long 1999).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grasslands, forests, hedges, gardens, wastelands, bogs; to 1800 m altitude (Quick 1960; Kerney & Cameron 1979). Microhabitat is mostly living plants, with some occupying bare soil or dead plants and logs when available (Cameron 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Arion ater spend most of their time eating. This is done with an enclosed radula that contains transverse rows of sharp teeth. The slug's diet consists mostly of fungi and plants, but is occasionally supplemented by worms, insects, decaying vegetation, and feces. Slugs feed mostly at night when conditions are cool and moist (Long 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Omnivorous. Feed on dead and live plants, dead animals, and feces (Graham 1955; Chatfield 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Preyed upon by lampyrid beetle larvae (Schwalb 1961, in Stephenson & Knutson 1966).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Not aggressive (Rollo & Wellington 1979). Aggregations of A. ater occurs during dry conditions and unfavorable temperatures (Rollo & Wellington 1981).

For defense, A. ater may contract its body and rock from side to side (Kerney & Cameron 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating

Slugs, like snails, are hermaphrodites. It can fertilize itself, but prefers a mate. The slug then lays eggs about 5 mm in diameter. The eggs are usually laid in dark and damp areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Emma Kent

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Although Arion ater are hermaphroditic, they do engage in cross-fertilization when a mate is available. After copulation, the slug may lay 20-50 eggs in crevices made in soil or in the cracks of decaying wood. These eggs typically hatch in six weeks (BBC 2000).

Key Reproductive Features: simultaneous hermaphrodite; sexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arion ater

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTCTTTTAATTCGCTTAGAGTTAGGAACAACTGGT---ATTTTAACTGAC---GATCAATTTTTTAATGTTATCATTACCGCACACGCTTTTGTGATAATTTTTTTTATGGTTATGCCTTTAATAATTGGGGGGTTTGGTAATTGAATAGTGCCCTTACTTATCGGGGCCCCCGATATGAGATTTCCTCGTATAAATAATATAAGATTTTGATTATTACCGCCATCTTTACTTTTACTTATTTGTTCTAGTATAGTAGAAGGAGGAGCTGGAACAGGTTGAACAGTGTACCCACCACTGAGAGGAGCCTTAGCACATAGCGGAGCTTCAGTTGACTTAGCAATTTTTTCGTTACATTTAGCTGGTATATCTTCTATTTTAGGAGCAATTAATTTTATTTCTACTATTTTTAATATGCGCCCCCAAGCCCTAACATTGGAGCGTATAAGCTTATTTGTTTGATCCATTTTGATTACGGTTTTCTTACTACTACTGTCTTTACCTGTATTGGCTGGAGCTATTACCATATTATTAACTGACCGTAATTTTAATACTAGATTTTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Arion ater

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This species is given no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Slugs are often a nuisance to horticulturists because of their choice of diet. Lettuce is a crop that is heavily damaged by slugs. Any sort of vegetation is at risk to slug damage. Arion ater is considered to be among the most destructive of the slugs (Long 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In general, slugs are crucial to a healthy ecosystem. They work to recycle decaying food and fecal matter that is then processed back through the soil. Without slugs working in such a manner, soil could potentially lose many of its nutrients (Nickel 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black slug

The black slug also known as black arion, European black slug, or large black slug, scientific name Arion ater, is a species of large land slug, a terrestrial slug in the family Arionidae, the roundback slugs.

Contents

Description

The size of the slug varies from 10 to 15 cm. Maturity is reached at about 2.5 cm.[3]

The color of the black slug is generally black, but the colouration is very variable and this slug can even be white. The general trend is for a darker pigmentation the farther north the species is found. The classification of brown-coloured and rust-coloured "black" slugs is somewhat disputed; the brown variation is sometimes considered to be a separate species, Arion rufus (Red Slug).[3] Young specimens of black slug do have a brown colour, which is later lost if and when the slug changes color to the mature state.[4]

The slug covers itself in a thick foul-tasting mucus which serves as both protection against predators as well as a measure to keep moist. It is somewhat difficult to wash off.[5]

Like other members of the family Arionidae, the black slug has a pneumostome (breathing hole) on the right side of its mantle through which it breathes. This mantle is the part which in snails secretes a shell, and in this species of slug the mantle contains a resilient protective structure of calcareous granules.[4]

Distribution

This species is found in northern Europe (including Britain) and the Pacific Northwest.[4]

This species is well-established in Washington and Oregon, and it is considered to represent a potentially serious threat as a pest, an invasive species which could negatively affect agriculture, natural ecosystems, human health or commerce. Therefore it has been suggested that this species be given top national quarantine significance in the USA.[8]

Behaviour

The black slug is mainly nocturnal and avoids exposure to sunlight. It is omnivorous,[9] eating carrion, fungi, and vegetation (living and decaying). The slug prefers moist conditions, such as lawns, making it an unwelcome sight for homeowners.[4] This moist environment is essential for the terrestrial locomotion of the slug to function.

Like all other species of the Arionidae family, the black slug is a hermaphrodite, meaning it can fertilize itself if needed, although a mate is preferred. After mating, the slug lays eggs about 5 mm in diameter. The favoured location for eggs is a dark, cold, damp place such as a compost heap.

In the past two decades, its mating with the non-native (at northern latitudes) pest species Arion vulgaris (or Spanish slug) has resulted in a more resilient hybrid exhibiting increased tolerance to cold.[10]

The mucus of the slug is highly distasteful to many animals. However, this slug does have some natural predators, including the hedgehog, badger, shrew, mole, mouse, frog, toad, snake, carnivorous beetle, and some birds.[11] When picked up or touched, the black slug will contract to a hemispherical shape and begin to rock from side to side. This defensive behaviour confuses predators, and is unique in the Arionidae family.[12]

Human use

Arion ater was used as grease to lubricate wooden axle-trees or carts in Sweden.[13] This use is documented since at least the 18th century.[13] Although Black slugs are edible (if somewhat unappetising), their consumption is inadvisable partly due to the poisons that are used to control their population in urban areas where they are considered pests, but also as they are carriers of French heartworm (Angiostrongylus vasorum).[14]

References

  1. ^ 2006 IUCN Red List of Threatened Species. <www.iucnredlist.org>. Cited 2 March 2007.
  2. ^ "Synonyms of Limax ater". AnimalBase, accessed 29 December 2010.
  3. ^ a b Arion ater at University of Paisley
  4. ^ a b c d Arion ater on Animal diversity web
  5. ^ The world of snails
  6. ^ Deutsche Namen für einheimische Schnecken und Muscheln
  7. ^ Chance Cove Provincial Park, Newfoundland
  8. ^ Cowie R. H., Dillon R. T., Robinson D. G. & Smith J. W. (2009). "Alien non-marine snails and slugs of priority quarantine importance in the United States: A preliminary risk assessment". American Malacological Bulletin 27: 113-132. PDF.
  9. ^ Svart skogssnigel - Arion ater at Natural history museum of Gothenburg
  10. ^ symposium at Canterbury Christ Church University College, Kent, UK, on 8-9 September 2003 from Malacological Society of London
  11. ^ Nickel, June 1998. The Slimy, Yet Special Slug. Natural History, 107:18.
  12. ^ The large black slug
  13. ^ a b Svanberg I. (2006). "Blacks slugs (Arion ater) as grease: a case study of technical use of Gastropods in Pre-industrial Sweden". Journal of Ethnobiology 26(2): 299-309. doi:10.2993/0278-0771(2006)26[299:BSAAAG]2.0.CO;2. PDF
  14. ^ Alan Watson Featherstone Nov 2012 - General information about the importance of European Black Slugs within the Caledonain Forest ecosystem. HTML
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!