Overview

Comprehensive Description

Brief

Salt Water crocodile with a pair of ridges running from orbit to centre of snout
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Crocodylus porosus is most commonly found on the coasts of northern Australia, and the islands of New Guinea and Indonesia. It ranges west as far as the shores of Sri Lanka and eastern India, all along the shorelines and rivermouths of southeast Asia to central Vietnam, around Borneo and into the Philippines, and even out to Palau, Vanuatu, and the Solomon Islands. Saltwater Crocodiles are strong swimmers and can be found very far from land.

(Britton, 1995; Lanworn, 1972; Carr, 1972)

Biogeographic Regions: oriental (Native ); australian (Native ); indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

"Mangroves in Sunderbans and Bhitarkanika in India. Once found in Kerala, now extinct ."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Oceania Asia Australia
Distribution: Australia, Bangladesh, Brunei, Myanmar (= Burma), Cambodia, China, India (including Andaman Islands, Nicobar Islands), Indonesia (Java, Sulawesi, Komodo), Malaysia, Palau (Caroline Islands) , Papua New Guinea, Philippines, Singapore, Sri Lanka, Solomon Islands, Thailand, Vanuatu (Banks Islands), Nauru?, Micronesia, Vietnam.  
Type locality: Unknown; designated as "Ceylon" (=Sri Lanka) by Mertens (1960: 271).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Southeast Asia, Australia, Papua New Guinea, Islands of the West Pacific Ocean

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Saltwater crocodiles are the largest reptilian species alive today. Adult males can reach up to sizes of 6 to 7 meters. Females are much smaller and do not generally exceed 3 meters, with 2.5 meters considered large. The head is very large and a pair of ridges run from the eyes along the center of the snout. The scales are oval in shape and the scutes are small compared to other species. Young saltwater crocodiles are pale yellow in color with black stripes and spots on the body and tail. This coloration lasts for several years until the crocodile matures into an adult. The color as an adult is much darker, with lighter tan or gray areas. The ventral surface is white or yellow in color. Stripes are present on the lower sides of the body but do not extend onto the belly. The tail is gray with dark bands. Saltwater crocodiles have a heavy set jaw which contains up to 68, and no less than 64, teeth.

Range mass: 1000 to 1200 kg.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • Britton, A. 1995. "Species Account: C. Porosus" (On-line). Accessed March 4, 2001 at http://www.flmnh.ufl.edu/cnhc/csp_cpor.htm.
  • Kondo, H. 1970. Grolier's Amazing World of Reptiles. New York, NY: Grolier Interprises Inc.
  • Lanworn, R. 1972. The Book of Reptiles. New York, NY: The Hamlyn Publishing Group Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The Saltwater Crocodile shows a high tolerance for salinity, being found mostly in coastal waters or around rivers. It may also be found in freshwater rivers, billabongs and swamps.

Movement between habitats occurs during the wet season, when juveniles are raised in freshwater rivers. However, these juveniles are usually forced out of these areas, by dominant males who use the freshwater areas for breeding grounds, and into areas of low salinity. Males who are unable to establish a territory in the river system are either killed or forced out into the sea where they move around the coast in search of another river system.

(Britton, 1995; Pope, 1955)

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inland lakes, swamps and marshes as well as coastal brackish waters and tidal sections of rivers. Terrestial nest sites and basking areas.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

in estuaries and coastal waters
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Salt Water, Estuaries, Mangroves"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Saltwater Crocodile is a predator and has many different types of prey. When young, Crocodylus porosus is restricted to smaller prey like insects, amphibians, crustaceans and small fish and reptiles. When they become an adult, they feed on larger prey such as mud crabs, turtles, snakes, birds, buffalo, wild boar, and monkeys. When the Saltwater Crocodile hunts for food, it usually hides in the water with only the nostrils, eyes, and part of the back exposed. When the prey approaches, it lunges out of the water and attacks, usually killing its prey with a single snap of the jaws. The Saltwater Crocodile then drags the prey under the water where it is more easily consumed.

(Britton, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Crocodylus porosus preys on:
Lutrogale perspicillata

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Average lifespan

Sex: male

Status: captivity:
41.7 years.

Average lifespan

Status: captivity:
8.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Saltwater Crocodile breeds during the wet season which falls between the months of November and March. Despite the fact that the Saltwater Crocodile is normally found in saltwater areas, breeding grounds are established in fresh water. Males mark out their territory and become defensive if another male tries to enter.

Females reach sexual maturity at around 10 to 12 years old. Males, on the other hand, do not reach sexual maturity until the age of 16 years.

The female crocodile normally lays 40 to 60 eggs, but she can lay up to 90 eggs. The eggs are placed in mounded nests made from plant matter and mud and then buried. Since the eggs are laid during the wet season, the nests must be elevated to prevent loss due to floods.

The male does not stay until the eggs are hatched, but the female stays and protects the nest from predators and humans. After incubation for 90 days, the offspring are hatched, although this time varies with nest temperature. Sex determination is directly related to nest temperature. Males are produced around 31.6 degrees Celsius. If this temperature is increased or decreased just a little, females will be produced. The female unearths the eggs when she hears the chirping sounds the offspring make after they hatch. She then assists the offspring into the water by carrying them in her mouth and tends to them until they learn how to swim.

Range number of offspring: 40 to 90.

Range age at sexual or reproductive maturity (female): 10 to 12 years.

Average age at sexual or reproductive maturity (male): 16 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus porosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGAACATTAATCGTTGACTATTTTCCACTAACCACAAAGATATCGGCACCTTATATTTTATTTTCGGCGCCTGAGCTGGAATAGTAGGCACAGCCATAAGCCTATTAATTCGGACAGAGCTCAGCCAGCCTGGTCCATTCATAGGGGATGACCAAATTTATAATGTCATTGTCACAGCACATGCCTTTATCATAATTTTCTTTATAGTTATACCGATCATGATCGGCGGATTTGGAAATTGGCTACTCCCACTAATAATCGGAGCACCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCATTTACCCTACTTCTCTCCTCAGCCTTTATTGAAACTGGAGCTGGCACCGGATGAACAGTCTACCCGCCCCTAGCTGGAAACCTAGCCCACGCCGGACCATCAGTAGACTTGACCATCTTCTCCCTCCACCTTGCTGGAGTATCATCCATTCTTGGAGCAATTAACTTTATTACCACGGCCATTAATATGAAACCCCCAGCAATATCACAACAACAGACGCCTCTTTTCGTATGGTCTATTCTAGTTACAGCCGTTCTCCTACTGCTCTCACTACCAGTCCTAGCTGCAGGAATTACCATGTTACTCACTGATCGAAACCTGAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATACCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTCATCCTACCAGGGTTTGGAATAATCTCCCATGTAATCACCTTCTACTCAAGTAAAAAAGAACCATTTGGCTACATAGGAATAGTCTGAGCCATGATATCAATCGGCTTTCTCGGATTCATCGTCTGAGCCCACCACATATTTACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACAATAATTATCGCCATCCCCACCGGCGTAAAAGTGTTCAGCTGATTAGCCACTATTTACGGAGGAGTAGTGAAATGACAAGCCCCCATGCTCTGAGCACTCGGCTTCATTTTCTTATTCACAGTCGGAGGACTAACAGGAATTGTACTAGCTAACTCATCACTAGACATTATTCTACACGATACCTACTACGTAGTAGCCCACTTCCACTATGTACTATCTATGGGGGCAGTATTCGCCATCATAAGCGGATTCACTCACTGGTTCCCACTATTTACAGGATTTACCCTCCACCACACATGAACAAAAATCCAATTCATAATCATATTCACGGGTGTAAACCTAACCTTCTTCCCACAACACTTCCTGGGCCTGTCAGGGATACCACGACGATATTCCGACTACCCAGATGCATATGCCCTCTGAAATATAATCTCCTCAATCGGATCGTTAGTTTCCATAGTATCAGTCGTCCTGCTCACATTTATTGTATGAGAGGCATTTTCATCAAAACGAAAAGTCCAAGTGCCTGAAATAGCAAGTACAAACGTAGAATGACTAAACAACTGCCCACCGTCATACCACACCTACGAAGAGCCAGTCTTTGTTCAAGTACGAAAAAAACTAACATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus porosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Although the population of saltwater crocodiles is not stable everywhere, it is in no immediate danger. However, in some countries where the crocodile once thrived, it is now rare or extirpated. Habitat loss associated with coastal development and intensive hunting for hides has drastically reduced populations throughout much of the range. In Sri Lanka and Thailand, habitat destruction is so rapid that the saltwater crocodile has been virtually unseen, with only two saltwater crocodiles being sighted in 1999. In southern Vietnam, where the species once thrived by the thousands, there are but an estimated 100 crocodiles alive in the wild. This is due to the rapid degradation of habitat and the poaching of the animal for leather products. The global population will not be stable until all the countries which have habitats that support the saltwater crocodile have laws that prevent poaching, and programs that create reserves.

A number of such programs have been begun to ensure that C. porosus will not become extinct. In India, a restocking program was introduced in Bhitarkinaka National Park. More than 1,400 saltwater crocodiles were released, with approximately 580 surviving. The population has now become moderately stable at around 1,000 total crocodiles in India. In Burma, crocodile farms are controlling the breeding and conservation of crocodiles. The Australian management program is the world's leader in conservation of the saltwater crocodile. This program focuses its attention on educating the public on precautions to take if they encounter a crocodile, thus discourage unnecessary killing. Crocodile farms were opened to maintain a breeding population, and national sanctuaries have been established, ensuring an undisturbed habitat. Yearly population counts are conducted, monitoring the number of saltwater crocodiles in Australia, making sure that the population does not become dangerously low. In New Papua Guinea, programs that ensure an undisturbed habitat stabilize the population. The Papua New Guinean management system involves a combination of wild cropping, egg and hatchling harvest, and ranching. (Britton, 1995; Carr, 1972)

The IUCN rates the species as a whole as "Low Risk." The U.S. Fish and Wildlife Service rates the Australian population of this species as "Threatened," does not rate the population in Papua New Guinea, and rates the populations in other countries as "Endangered." Saltwater crocodiles from Australia, Indonesia, and Papua New Guinea are included in Appendix II of the CITES treaty, which limits international trade. Members of the species from all other countries are listed in Appendix I, which means they may not be traded internationally.

US Federal List: endangered; threatened

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/18/1979
Lead Region: Foreign (Region 10) 
Where Listed: except Australia & Papua New Guinea

Status: Threatened
Date Listed: 06/24/1996
Lead Region: Foreign (Region 10) 
Where Listed: Australia


Population detail:

Population location: Australia
Listing status: T

Population location: Entire, except Papua New Guinea and Australia
Listing status: E

For most current information and documents related to the conservation status and management of Crocodylus porosus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I (except the populations of Australia, Indonesia and Papua New Guinea, which are included in Appendix II).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The Saltwater Crocodile can be a very dangerous animal to encounter, and humans are attacked and killed by this species every year. Many of these attacks could be prevented by increased awareness and education.

(Britton, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The hide of the Saltwater crocodile is considered very valuable. Many people will pay large amounts of money to have crocodilian products, and Saltwater Crocodile leather products are the most prized. Farms are run for this specific purpose. The crocodile is raised until it is ready to be skinned for leather products. This is a contrversial topic as many people do not find it fit to kill the crocodiles to obtain a small amount of the hide, while the rest of the crocodile is thrown aside.

(Lanworn, 1972)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!