Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

Biology

Green turtles are long-lived and may take up to 59 years to reach sexual maturity (6) Undertaking tremendous feats of navigation, adults return to the same beach to breed each season, part of the population in Brazil astonishingly migrates around 2,250 kilometres across the open ocean to breed on the Ascension Islands (12). Mating tends to occur just offshore of the nesting beaches; using a curved claw on each front flipper and a flat nail at the end of the tail, males are able to grip their mates (2). Females haul out onto the beach at night and dig large nests with their back flippers beyond the high tide mark, they typically lay between 100 and 150 eggs in one nest and then proceed to cover the eggs with sand; the whole process takes around two hours (6). A single female returns to breed only once every two to five years but will lay up to nine nests in that one season (2). Incubation takes between 45 and 70 days, and temperature has been shown to determine of the sex of hatchlings; with females being produced at warmer temperatures (6). Breaking open their eggs with a special hooked 'egg tooth' that will subsequently be lost; hatchlings use their powerful front flippers to reach the surface, and then proceed to the sea (7). The soft-bodied juveniles are particularly vulnerable at this time from a variety of predators, such as ghost crabs and gulls on the beach to sharks and dolphins in the water (7). Unlike other marine turtles, adult green turtles are almost exclusively herbivorous, grazing on seagrasses and algae (8); it is assumed that juveniles are more omnivorous although the exact composition of their diet is unknown (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

WhyReef - Lifestyle

Green sea turtles lead hard and dangerous lives, and are lucky to reach adulthood. They spend most of their lives in the water, but female green sea turtles need to come on land to lay their eggs. Once they have crawled onto the beach, they dig a hole for hours until their flippers are exhausted, lay 100 to 200 eggs inside it, and then cover it up to protect the eggs from heat and predators. When the eggs hatch, the baby turtles have to crawl to the sea, but because there are so many animals that eat them, not many of them survive the trip. The lucky ones that make it to the water spend their early life trying to avoid being eaten by dolphins and sharks. Adult sea turtles spend a life of well-earned rest among seagrass beds and coral reefs.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Green turtles are one of the largest and most widespread of all the marine turtles (5). The oval carapace varies from olive to brown, grey and black with swirls and irregular patters (6), but the common name is derived from the green colour of the fat and connective tissues of this species (2). Two subspecies are currently recognised; the Pacific green turtle (Chelonia mydas agassizii) tends to be smaller than its Atlantic cousin (C. m. mydas) with a narrower carapace that may sometimes be completely black, providing the other common name of 'black turtle' to certain populations (7). The plastron, or undershell, remains a pale yellow or orange throughout life (6). Males are generally smaller than females (11), and green turtles differ in appearance from other marine turtles by the possession of a single pair of scales in front of the eyes and a serrated bottom jaw (2). The tiny black hatchlings are only around 50 millimetres long (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

A large marine turtle, reaching up to 1,200 mm in carapace length; largest Egyptian specimen is 1,190 mm. Carapace depressed, rounded, smooth; scutes juxtaposed; posterior edge without indentations; 4 coastal scutes; first marginal scute in contact with first vertebral scute. Head relatively small with a single pair of prefrontals. C. mydas differs from all other marine turtles in possessing serrations on the lower jaw, which facilitate grazing on marine grasses. Forelimbs and hind limbs have a single claw each. Males smaller, with longer tails and larger claws. Color of carapace light brown with dark streaks radiating out from a point at the posterior margin of each scute. Dorsal sides of limbs and head brown, each scale edged yellowish. All ventral sides whitish yellow.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The green turtle is the largest hard-shelled sea turtle, it has a carapace (shell) up to 1.4 m in length and can weigh a total of 180 kg. The green turtles smooth carapace, small rounded head and four pairs of scales (costal scutes) is what distinguishes it from other sea turtles. The shell of this species varies in colour from olive to brown, grey and black with swirls and irregular patterns.The green turtle is protected form international trade by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES). Populations of green turtles are in serious decline due to a number of factors. These include loss of nesting habitats, destruction of nests by poachers, propeller wounds, interaction with commercial fisheries and ingestion of marine debris, demand for their eggs and meat for human consumption.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

Green sea turtles are the most common sea turtles, and can be found in warm waters. They have been spotted in tropical waters around 139 different countries. Their body shape and paddle-shaped flippers make them excellent swimmers. They have been known to swim over 1,400 miles (2,253 km) from their feeding ground to their nesting site! They also have good memory; when the time comes to build their nests and lay their eggs, they return to the same sandy beach where they were born. No one knows how long they live, but people think they can live to be around 100 years old!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Green turtles are found in tropical and portions of subtropical oceans worldwide. They are found in the Atlantic Ocean from the eastern United States along coastal South America to South Africa. They are found throughout the Caribbean Sea and portion of the Mediterranean. They are also found throughout the warm waters of the Indian and Pacific Oceans.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Ernst, C., R. Barbour, J. Lovich. 1994. TURTLES of the United States and Canada. Washington and London: Smithsonian Institution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range

Green turtles are found in tropical waters around the globe, particularly associated with the coastline (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

The Green Turtle has a circumglobal distribution, occurring throughout tropical and, to a lesser extent, subtropical waters (Atlantic Ocean – eastern central, northeast, northwest, southeast, southwest, western central; Indian Ocean – eastern, western; Mediterranean Sea; Pacific Ocean – eastern central, northwest, southwest, western central). Green turtles are highly migratory and they undertake complex movements and migrations through geographically disparate habitats. Nesting occurs in more than 80 countries worldwide (Hirth 1997). Their movements within the marine environment are less understood but it is believed that green turtles inhabit coastal waters of over 140 countries (Groombridge and Luxmoore 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

cosmopolitan warm water
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution extends northward of the subprovince limit of Carolinian, Cape Hatteras through Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Mexico, Mediterranean Sea, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Known from Egyptian waters in both the Mediterranean and Red Sea. The only reliable evidence of nesting on the Mediterranean shores is a nest with eggs found near Zaranik, North Sinai, in the summer of 1998 (Clarke et al. 2000). A dead juvenile (carapace length 85 mm) found at Baltim could have originated from elsewhere. Dead individuals are frequently encountered throughout the Egyptian Mediterranean shoreline. In the Red Sea the species has been recorded from both the Gulfs of Suez and Aqaba, and has been reported to have nested at Ras Sharatib, south of Abu Rudeis (where some 80 females were estimated to nest),Tiran Island, Qulan Islands, Wadi El Gemal Island, Ras Banas, and Zabargad Island. Eggs and embryos from Giftun El Kebir Island referred to this species by Marx (1968), were re-identified as Eretmochelys imbricata by (Frazier and Salas 1984). The species nests sporadically along the mainland shores of the Red Sea south of Marsa Alam, where almost a hundred nests have been found between Ras Baghdadi and Marsa um El Abbas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© BA Cultnat

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Circum-global, largely within the 20°c oceanic isotherms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Distribution is pantropical in the Atlantic, Pacific, and Indian oceans. In some areas this species occurs in higher temperate latitudes due to drifting in ocean currents in conjunction with above-normal sea temperatures or as a normal life history event; young turtles regularly range as far north as New England. Major nesting activity occurs on Ascension Island, Aves Island, in Costa Rica (24,000 females nests each year at Tortuguero), and in Surinam (CSTC 1990). See Hirth (1980) for a map of major nesting beaches.

In U.S. Atlantic waters, green sea turtles occur around the U.S. Virgin Islands and Puerto Rico, where small numbers nest (islas Mona, Vieques, and Culebra, and St. Thomas, St. John, St. Croix), and a juvenile population exists in eastern portion of Puerto Rican Bank (Collazo et al. 1992), and from Texas to Massachusetts. Relatively small numbers nest in Florida, particularly in Brevard, Indian River, St. Lucie, Martin, Palm Beach, and Broward counties (CSTC 1990), mostly from Volusia County to Dade County (Ehrhart and Witherington 1992), with rare recent nesting on the Gulf Coast in Santa Rosa County (Ehrhart and Witherington 1992); important feeding areas in Florida include the Indian River, Florida Bay, Homossassa Bay, Crystal River, and Cedar Key (CSTC 1990). Rarely nests in Georgia, North Carolina, and Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa Oceania Near-East Middle-America Asia Caribbean South-America Europe Australia North-America
Distribution: Atlantic, Pacific, and Indian oceans, chiefly in the tropics.  Europe: Adriatic Sea (Croatia ?), Italy (occasional occurence [E. RAZZETTI, pers. comm.]) Turkey [Basoglu 1973], France, Portugal  Indian Ocean: Madagascar, Comoro Islands (Grande Comore, Mohélim Anjouan, Mayotte), Chagos Archipelago  Pacific: as far north as Alaska and in the   Atlantic Ocean: as far north as Great Britain, Gambia  Australia (New South Wales?, North Territory, Queensland, West Australia), Nauru?  Americas: Canada (British Columbia), USA SE Mexico (Yucatan, Baja California), Belize, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica,  Panama, Colombia [Castro,F. (pers. comm.)], Argentina  Asia: Korea, Andaman Islands, Nicobar Islands  mydas: Atlantic Ocean  agassizi: eastern Pacific Ocean, Galapagos Islands. Hawaii (USA) and Papua New Guinea;
Type locality: "l'en bouchure du Nagualated, dans le Pacifique (Guatémala)" [Embayment of Río Nagualate, Guatemala].  japonica: Indian and Western Pacific Ocean  acording to the 1994 IUCN Red List of Threatened Animals: EC/NE/NW/SE/SW/WC Atlantic, Indian Ocean eastern, Indian Ocean western, Mediterranean and Black Sea, EC/NW/SW/WC Pacific,  American Samoa, Angola, Anguilla, Antigua and Barbuda, Australia, Bahamas, Bangladesh, Belize, Benin, Brazil, British Indian Ocean Territory, Cambodia, Cameroon, Cape Verde, Chile, China, Colombia, Comoros, Congo, Cook Islands, Costa Rica, Cote d'Ivoire, Cuba, Cyprus, Djibouti, Dominica, Dominican Republic, Ecuador, Egypt, El Salvador, Equatorial Guinea, Eritrea, Federated States of Micronesia, Fiji, French Guiana, French Polynesia, Gabon, Ghana, Grenada, Guadeloupe, Guam, Guatemala, Guinea, Guinea-Bissau, Guyana, Haiti, Honduras, India, Indonesia, Iran, Israel, Jamaica, Japan, Kenya, Kiribati, Kuwait, Liberia, Madagascar, Malaysia, Maldives, Marshall Islands, Martinique, Mauritania, Mauritius, Mayotte, Mexico, Montserrat, Mozambique, Myanmar (= Burma), Netherlands Antilles, New Caledonia, Nicaragua, Nigeria, Niue, Northern Marianas, Oman, Pakistan, Palau, Panama, Papua New Guinea, Peru, Philippines, Puerto Rico, Qatar, Reunion, Sao Tome & Principe, Saudi Arabia, Senegal, Seychelles, Sierra Leone, Solomon Islands, Somalia, Sri Lanka, St Helena, St Kitts and Nevis, St Lucia, St Vincent, Sudan, Suriname, Taiwan, Tanzania, Thailand, Togo, Tokelau, Tonga, Trinidad and Tobago, Turkey, Turks and Caicos Islands, Tuvalu, US Minor Pacific Islands, USA (Washington; Western Atlantic: Maine, New Hampshire, Massachusetts,  Connecticut, New Jersey, Delaware, Maryland, Virginia, North Carolina, South Carolina, Georgia, Florida), United Arab Emirates, Vanuatu, Venezuela, Viet Nam, Virgin Islands (British), Virgin Islands (US), Western Sahara, Western Samoa, Yemen, Zaire  
Type locality: “insulas Pelagi: insularum Adscensionis" [The Pelagie Islands and Ascencion Island]; restricted to Ascension Is., see Mertens, R. & Müller, L. (1928)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Circumglobal in tropical and temperate seas and oceans

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Pacific, and Indian Oceans. In the Atlantic, they occur as far north as England.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

They are called green turtles because of the color of the flesh. Chelonia mydas are one of the largest turtles ranging from 71 to 153 centimeters. They can weigh up to 205 kilograms. They have limbs that are paddle-like, which are used to swim. Their heads seem small compared to their body size. Males are larger than females and the tail is longer, extending well beyond the shell. The carapace can be olive to brown, or sometimes black, depending on the geographic location of the species. Green turtles cannot pull their heads inside of their shells. There are two sub-species which include Chelonia mydas mydas and Chelonia mydas agassizii. The common name for Chelonia mydas mydas is the Atlantic green turtle, which lives in the Atlantic ocean and has been see off the shores of Europe and North America. Chelonia mydas agassizii, or Eastern Pacific green turtle and sometimes black sea turtle because of its dark colored carapace, has been see off the coasts of Alaska, through California, and to Chile. Some features that distinguish C. m. agassizii from C. m. mydas are that the shell of C. m. agassizii is higher, the shell is narrower, the marginals are more constricted over the hind legs, and the postcentral lamina are longer relative to their width (Ernst 1994). The Pacific and Atlantic populations have been separated for millions of years.

Range mass: 0 to 0 kg.

Average mass: 205 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 122 cm

Weight: 200000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

To 153 cm carapace length
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the hawksbill in having one rather than two pairs of prefrontals and carapace scutes that do not overlap. Differs from the loggerhead and the ridleys in having the first costal not in contact with the nuchal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Chelonia mydas
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Sex unknown;
Preparation: Dry
Year Collected: 1840
Locality: No Further Locality Data, Fiji Islands, Republic of Fiji, Pacific
  • Holotype: Girard, C. & Baird, S. F. 1858. Herpetology. Prepared under the superintendence of S.F. Baird. United States Exploring Expedition during the years 1838, 1839, 1840, 1841, 1842, under the command of Charles Wilkes, U.S.N. 20: 456, plate 31, figures 1-4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Like most sea turtles, green turtles are highly migratory and use a wide range of broadly separated localities and habitats during their lifetimes (for review see Hirth 1997). Upon leaving the nesting beach, it has been hypothesized that hatchlings begin an oceanic phase (Carr 1987), perhaps floating passively in major current systems (gyres) that serve as open-ocean developmental grounds (Carr and Meylan 1980, Witham 1991). After a number of years in the oceanic zone, these turtles recruit to neritic developmental areas rich in seagrass and/or marine algae where they forage and grow until maturity (Musick and Limpus 1997). Upon attaining sexual maturity green turtles commence breeding migrations between foraging grounds and nesting areas that are undertaken every few years (Hirth 1997). Migrations are carried out by both males and females and may traverse oceanic zones, often spanning thousands of kilometers (Carr 1986, Mortimer and Portier 1989). During non-breeding periods adults reside at coastal neritic feeding areas that sometimes coincide with juvenile developmental habitats (e.g., Limpus et al. 1994, Seminoff et al. 2003).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Green sea turtles live in tropical waters all over the world. The only time they emerge from the water is when they are nesting. The only time males are not at sea is when they were first born. C. m. agassizii are sometimes found with seals and albatrosses basking on the beach (Pritchard 1967). When it is time to mate they migrate from several hundred to over a thousand miles across the ocean to where they hatched. Female green turtles use the same beaches to nest as their mothers and grandmothers.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8054 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4162 samples.

Environmental ranges
  Depth range (m): 0 - 3250
  Temperature range (°C): 2.498 - 29.497
  Nitrate (umol/L): 0.015 - 26.152
  Salinity (PPS): 22.907 - 37.161
  Oxygen (ml/l): 2.556 - 6.419
  Phosphate (umol/l): 0.033 - 1.673
  Silicate (umol/l): 0.769 - 27.080

Graphical representation

Depth range (m): 0 - 3250

Temperature range (°C): 2.498 - 29.497

Nitrate (umol/L): 0.015 - 26.152

Salinity (PPS): 22.907 - 37.161

Oxygen (ml/l): 2.556 - 6.419

Phosphate (umol/l): 0.033 - 1.673

Silicate (umol/l): 0.769 - 27.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Warm marine waters. Frequently segrass beds, which by nature are in fairly shallow, sandy, inshore habitats. Often near wadi deltas (In the Red Sea), where the fringing reef is broken and suitable sandy substrate in shallow waters is available. Generally, the availability of suitable seagrass beds is limited in the Egyption Red Sea, and apparently so in the Mediterranean as well, given the small number of records in Egyption territory. Nesting in the Red Sea has been recorded in the months of June and July. Sexual maturity reached between 12 and 50 years, depending on location and nutritional history.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeding occurs in shallow, low-energy waters with abundant submerged vegetation, and also in convergence zones in the open ocean (NMFS and USFWS 2007). Migrations may traverse open seas. Adults are tropical in distribution, whereas juveniles range into temperate waters (e.g., see Morreale and Standora, no date). Hatchlings often float in masses of marine macroalgae (e.g., Sargassum) in convergence zones. Coral reefs and rocky outcrops near feeding pastures often are used as resting areas. Inactive individuals may rest on the bottom in winter in the northern Gulf of California. Basking on beaches occurs in some areas (e.g., Hawaii).

Nesting occurs on beaches, usually on islands but also on the mainland. Sand may be coarse to fine, has little organic content; physical characteristics vary greatly in different regions. Most nesting occurs on high energy beaches with deep sand. At least in some regions, individuals generally nest at same beach (apparently the natal beach, Meylan et al. 1990, Allard et al. 1994) in successive nestings, though individuals sometimes change to a different nesting beach within a single nesting season (has switched to beach up to several hundred kilometers away) (see Eckert et al. 1989). Beach development and illumination often make beaches unsuitable for successful nesting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Adults inhabit shallow tropical feeding grounds that are often seagrass meadows, migrating from these areas to their nesting beaches not in the UK.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Young Green turtles are pelagic, coming to shallow waters when they've grown to around 20-25 cm. Juveniles and adults prefer shallow waters and reef areas.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Adults inhabit shallow feeding grounds that are often seagrass meadows, migrating from these areas to their nesting beaches (6). Once juveniles hatch, they spend an unknown number of years in the open ocean (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Adults migrate up to about 3,000 km between nesting beaches and feeding areas (e.g., between Ascension Island and the South American coast). See Balazs (1982) for a map of documented migrations between the major nesting area in Hawaii (French Frigate Shoals) and foraging areas elsewhere in the Hawaiian Islands. See Morreale and Standora (no date) for information on movements along the east coast of the United States.

Seminoff et al. (2002) documented migration between nesting area on the coast of Michoacan (Mexico; January 2000) and a feeding ground on the Sonoran coast of the Gulf of California (Mexico; September 2000).

See Mortimer and Porter (1989) for information on internesting movements at Ascension Island.

Neonates migrate far from natal beaches to foraging areas and return to natal beach to breed/nest up to 40+ years later.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Green turtles are mostly herbivorous. They spend most of their time feeding on algae in the sea and the grass that grow in shallow waters. As juveniles, they eat plants and other organisms such as: jellyfish, crabs, sponges, snails, and worms. As adults, they are strictly herbivorous (Ernst 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes"seagrass," macroalgae and other marine vegetation, and various invertebrates such as mollusks, sponges, crustaceans, and jellyfish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults are mostly herbivorous, consuming sea grasses and algae. They will also take jellyfish, salps, and sponges. Young, while in the pelagic stage, are carnivorous.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

When young, green sea turtles eat plants, jellyfish, crabs, sponges, snails, and worms. Because it eats both plants and animals, it is an omnivore when young. But when it becomes an adult, it eats only plants—seagrass, seaweeds and different types of algae—so it is an herbivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of nesting occurrences (more than 150 major and minor nesting areas in more than 80 nations worldwide).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: At 46 nesting areas worldwide, representing most but not all of the global population, the latest data indicate that approximately 109,000-151,000 females nest each year (NMFS and USFWS 2007). Assuming an average remigration interval of 3 years, this indicates an adult female population size of roughly 327,000-453,000. Assuming an equal number of adult males yields 654,000-906,000 adults for this subset of the global population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Eggs and hatchlings typically incur high mortality from various terrestrial and aquatic predators, including both vertebrates and invertebrates (e.g., crabs). Many nests are destroyed by tidal inundation and erosion. In Costa Rica, annual survivorship of adult females was 0.61; in various areas egg survivorship was 0.40-0.86 (see Iverson [1991] for a compilation of survivorship data). Humans are the most important predators on adults. See Witherington and Ehrhart (1989) for information on cold stunning in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Herbivorous, feeding largely on marine grasses and algae when adult; young carnivorous, pelagic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Turtles in the northern Gulf of California overwinter in a dormant condition. Nesting occurs generally at night. In Hawaii, green sea turtles may bask on beaches mid-morning to mid-afternoon, especially after a period of rainy weather (Whittow and Balazs 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
75 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 75 years Observations: Some anecdotal evidence suggests these animals may live beyond a century but their record longevity is largely unknown. The age at sexual maturity is also a subject of debate and could be over 20 years (John Behler and F. King 1979).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males and females mature between 10 and 24 years. The breeding season depends on the latitude. Internal fertilization takes place when the male and female copulate. This is the only time there is vocalization. Like many species, there is male competition. One male may try to bite another male who is copulating with a female. Mating occurs underwater or on the surface about one kilometer from the shore. Sometimes the female will retain enough sperm to nest several times that year. Nesting occurs every three to six years. When the female is ready to lay her eggs, she leaves the water, crawls onto the sand and starts digging for hour and hours until her flippers will not allow her to dig deeper. She then lays 100 to 200 eggs. This group of eggs is called a clutch. She covers them with sand to protect them from the sun, heat, and predators. Pacific green turtles lay fewer eggs than Atlantic green turtles. The gestation period is 40 to 72 days, depending on the location.

Average gestation period: 59 days.

Average number of offspring: 150.

Average age at sexual or reproductive maturity (male)

Sex: male:
3650 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
3650 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Individual reproductive females lay 1-8 clutches per season, averaging about 90-140 eggs, at about two-week intervals usually every 2-5 years. Nesting occurs March-October in Caribbean-Gulf of Mexico region, with peak in May-June; nests in Florida May-September (Ehrhart and Witherington 1992). Nesting encompasses April-October, with a peak between mid-June and early August, in Hawaii (Niethammer et al. 1997). Eggs hatch usually in 1.5-3 months. Hatchlings emerged between early July and late December (peak mid-August to early October) in Hawaii (Niethammer et al. 1997). Females mature probably at an average age of 27 years in Florida, but growth rates and hence age of maturity may vary greatly (from perhaps fewer than 20 years to 40+ years) throughout the range (slower growth in Australia, Hawaii, and Galapagos than in Florida and West Indies region).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating and nesting takes place in the tropics from March to October in the Atlantic and Caribbean. Several males will attempt to mate with a single female. Females nest on islands and mainland beaches, and show a high degree of nest site fidelity. Nesting takes place at night. Approximately 112 eggs are laid in each clutch, and a female will clutch up to 3 times in a reproductive season. She then will not clutch again for another 2-3 years. The nesting process takes 2-3 hours.
  • Ernst and Barbour, 1989; Lutz and Musick, 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Shell alters buoyancy: green turtle
 

The shell of some sea turtles allows for different levels of buoyancy for juveniles and adults by changing shape.

     
  "Sea turtles sometimes swim on the surface; Jeanette Wyneken tells me that the flared, V-shaped bottom is characteristic of buoyant baby sea turtles, which are obligatory surface swimmers. With maturity and the shift to submerged swimming, the hull shape changes to one more characteristic of submarines." (Vogel 2003:116)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chelonia mydas

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1485-06|NC_000886|Chelonia mydas| ACTCGCTGATTCTTCTCCACCAACCATAAAGACATTGGCACTCTATACCTAATTTTCGGAGCCTGAGCAGGAATAGTCGGCACAGCACTC---AGTTTATTAATCCGCGCAGAACTAAGCCAACCAGGAACTCTTCTAGGAGAT---GACCAAATCTATAATGTCATCGTTACAGCTCATGCCTTTATTATAATCTTCTTCATAGTTATACCAATTATAATTGGTGGCTTCGGAAATTGACTTGTTCCCCTAATA---ATTGGTGCACCAGACATAGCATTTCCACGTATAAATAACATAAGCTTTTGACTCCTACCCCCTTCACTACTACTACTTCTAGCATCATCAGGAATTGAAGCAGGCGCAGGTACAGGTTGAACAGTATATCCCCCATTAGCCGGAAACCTGGCTCACGCCGGTGCTTCCGTAGACCTA---ACTATCTTCTCCCTCCACCTAGCCGGTGTATCTTCAATCTTAGGTGCCATCAACTTCATTACCACAGCAATCAACATAAAATCCCCCGCCATATCACAATACCAAACACCCTTATTTGTATGATCCGTACTAATCACAGCTGTCCTATTACTACTTTCACTTCCAGTACTCGCCGCA---GGCATTACCATACTACTTACAGACCGAAATCTAAATACAACCTTCTTCGACCCTTCAGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTTTTTGGCCACCCTGAAGTATACATCTTAATCCTTCCAGGATTTGGTATAATCTCTCACATCGTTACCTACTATGCCGGTAAAAAA---GAACCATTCGGCTACATAGGAATAGTTTGAGCAATGATATCCATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCACATATTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chelonia mydas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Species: 32
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd

Version
3.1

Year Assessed
2004

Assessor/s
Seminoff, J.A. (Southwest Fisheries Science Center, U.S.)

Reviewer/s
Crouse, D. & Pilcher, N. (Marine Turtle Red List Authority)

Contributor/s

Justification
Analysis of historic and recent published accounts indicate extensive subpopulation declines in all major ocean basins over the last three generations as a result of overexploitation of eggs and adult females at nesting beaches, juveniles and adults in foraging areas, and, to a lesser extent, incidental mortality relating to marine fisheries and degradation of marine and nesting habitats. Analyses of subpopulation changes at 32 Index Sites distributed globally (Figure 1, Table 1; see link to additional information below) show a 48% to 67% decline in the number of mature females nesting annually over the last 3–generations.

Assessment Procedure: In accord with the IUCN criterion that Red List Assessments focus on the number of mature individuals (IUCN 2001a), this assessment measures changes in the annual number of nesting females. Because reliable data are not available for all subpopulations, the present report focuses on 32 Index Sites (Figure 1, Table 1; see link to additional information below). These Index Sites include all of the known major nesting areas as well as many of the lesser nesting areas for which quantitative data are available. Despite considerable overlap at some foraging areas, each is presumed to be genetically distinct (Bowen et al. 1992, Bowen 1995) except for the Turtle Islands of Malaysia (Sabah) and Philippines (Moritz et al. 1991). These two Index Sites are, however, treated independently because of the different management practices exercised by the two governments and the resultant differences in subpopulation trends. Selection of the 32 Index Sites was based on two primary assumptions: (1) they represent the overall regional subpopulation trends and (2) the number of individuals among Index Sites in each region is proportional to the actual population size in that region. Any regional inconsistencies in this proportion may result in a biased global population estimate.

It should be noted that a major caveat of using the number of nesting females to assess population trends is that this data type provides information for the proportion of the adult females that nest in any given year, not the total adult female population. However, when monitored over many years, this index can be reliable for assessing long-term population trends (Meylan 1982, Limpus 1996). In the case of green turtles, which display high inter-annual variability in magnitude of nesting (Limpus and Nichols 1987, Broderick et al. 2001a), using short-term or single-season data sets could misrepresent the actual mean number of nesters over a longer timeframe. To alleviate this potential source of error, we used multiple-year data sets whenever available. However, when single-season datasets represented the only quantitative information for a given time period, these data were used as long as they were in accord with qualitative information from other references.

Because data on annual number of nesting females are not always available, we also used data on number of nests per season, annual hatchling production, annual egg production and annual egg harvest. When these proxies were used, we converted units to number of nesting females based on a constant figure of 100 eggs/nest and three nests/season/female, unless otherwise noted. These conversions were based on the assumptions that (1) the mean number of eggs/nest and nests/female/season differ insignificantly through time, and (2) efforts to monitor nesting female activity and egg production are consistent through time. When using egg harvest data, we also assumed that harvest effort was consistent during all years for which data are available and 100% of the eggs were harvested in any given year. We believe these assumptions are accurate, but their absolute validation is very difficult. Qualitative information does, however, suggest that they are reasonable assumptions. For example, in the case of historic egg harvest, the same group of people usually harvested the eggs at a particular nesting beach each year, and they typically took every egg they could find (e.g., Parsons 1962, Pelzer 1972).

In the present assessment, population abundance estimates are based on raw data, linear extrapolation functions, and exponential extrapolation functions. In most subpopulations, more than one trajectory was exhibited over the 3–generation interval; changes in subpopulation size are thus often based on a combination of raw data and extrapolations. If no change is believed to have occurred outside the time interval for which published abundance data are available, the raw data were used to determine the change in population size. However, when it is believed that change in subpopulation abundance occurred outside the interval for which raw data were available, extrapolations we performed to determine the overall change. Linear extrapolations were used when it was believed that the same amount of change occurred each year, irrespective of total subpopulation size. Exponential extrapolations were used when it was believed that change was proportional to the subpopulation size. In cases where there is a lack of information on the specific rate of change, both linear and exponential extrapolations were used to derive population estimates. However, if extrapolations resulted in obviously false estimates, their results were discarded (see Table 5; see link to additional information below).

Generation Length. Generation length is based on the age to maturity plus one half the reproductive longevity (Pianka 1974). Although there appears to be considerable variation in generation length among sea turtle species, it is apparent that all are relatively slow maturing and long-lived (Chaloupka and Musick 1997). Green turtles exhibit particularly slow growth rates, and age to maturity for the species appears to be the longest of any sea turtle (Hirth 1997). As a result, this assessment uses the most appropriate age-at-maturity estimates for each index site. At Index Sites for which there are local age-to-maturity data, those data are used to establish generation length. When data are lacking, as they are for a majority of subpopulations, information from the closest subpopulation for which data are available are used to generate age-at-maturity estimates (Table 2; see link to additional information below).

Estimates of reproductive longevity range from 17 y to 23 y (Carr et al. 1978, Fitzsimmons et al. 1995). Data from the apparently pristine Green Turtle stock at Heron Island in Australia’s southern Great Barrier Reef show a mean reproductive life of 19 y (Chaloupka et al. 2004). Because Heron Island is the only undisturbed stock for which reproductive longevity data are available (M. Chaloupka, pers. comm.), this datum is used for all Index Sites (Table 3; follow link to additional information below). Thus, based on the range of ages-at-sexual-maturity (26 yrs to 40 yrs) and reproductive longevity from the undisturbed Australian stock (19 yr), the generation lengths used for this assessment range from 35.5 yrs to 49.5 yrs (Table 3; see link to additional information below).

Uncertainties in assessment process: As with any assessment based on historic data or small datasets, there is a great deal of uncertainty relating to the final results of this report. The sources of uncertainty are rooted in both the procedure itself as well as in the stochastic nature green of turtle biology. Both sources of uncertainty are ultimately related to a lack of information, which can be a common issue when dealing with an animal as long-lived as a Green Turtle.

First and foremost is the uncertainty related to the assumptions invoked for this assessment. For example, if, contrary to our assumption, efforts to monitor nesting female activity and egg production were not consistent through time, then our results may be biased. Similarly, our estimates may be inaccurate if harvest effort or the relative amount of eggs harvested was not consistent through time. In addition, the use of extrapolations may have resulted in erroneous estimates of population change. The potential for this increased when extrapolations were made over long time intervals, when they were based on short-term data sets, or if the start and/or end points of extrapolations were erroneous.

Uncertainty may also be tied to Green Turtle biology. In particular, the substantial variability in the proportion of a population that nests in any given year may result in inaccurate comparisons between past and present data sets. For example, if the proportion of a subpopulation’s adult female cohort nesting each year oscillates over decadal or longer time frames, then it is conceivable that our estimates of annual change in nesting numbers do not correspond to actual changes in the entire subpopulation. Moreover, if our conversion values for eggs/nest and nests/female/season are not accurate for the specific subpopulation being addressed, inaccuracies may result. Lastly, with respect to the migratory behaviour of green turtles, it is expected that each of the Index Sites included in this assessment represent a distinct subpopulation. Indeed, current genetic data support this claim, however, in the absence of complete data for all rookeries, it is possible that turtles moving back and forth between nesting areas in close proximity could have gone undetected. It is thus conceivable that a female could be counted twice. This would, of course, only be a problem when subpopulation size is based on an actual count of individual turtles visiting the beach. Although unlikely, it amounts to an additional source of uncertainty in this assessment.

Population trends. Based on the actual and extrapolated changes in subpopulation size at the 32 Index Sites, it is apparent that the mean annual number of nesting females has declined by 48% to 67% over the last three generations (Table 5; see link to additional information below). In addition, it is apparent that the degree of population change is not consistent among all Index Sites or among all regions (Tables 5 and 6; see link to additional information below). Because many of the threats that have led to these declines are not reversible and have not yet ceased, it is evident that green turtles face a measurable risk of extinction. Based on this assessment, it is apparent that green turtles qualify for Endangered status under Criteria A2bd.

The key supporting documentation is presented in the tables (see link to additional information below), and the full assessment is also available from the Marine Turtle Specialist Group web site.

History
  • 1996
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Green turtles are an endangered species because they have so many predators--including humans. Even though a female can lay over 200 eggs in on clutch, some will not hatch, and many will be eaten. Even if they do hatch, they get eaten on their way to the water, and in the water. So only a few will survive if any. If the they do survive, they can live to be over 100 years old. Sometimes eggs are laid on a public beach. When this happens conservationists come and move them to a safer place. In the United States, green turtles are protected by the Endangered Species Act.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Uncommon, localized and declin­ing. Facing a variety of threats in Egypt, most importantly as a by-catch of commercial fishing vessels. The species along with other marine tur­tles are consumed in some Egyptian coastal cities. Loss of nesting beaches is also a problem particularly in the Red Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3B,N3N : N3B: Vulnerable - Breeding, N3N: Vulnerable - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Distributed worldwide in warm oceans; exploited heavily for meat and eggs and as a component of other products; nesting and feeding habitats are being destroyed or degraded by pollution and development; large decline over the long term, more recently possibly stable or increasing in some areas.

Environmental Specificity: Very narrow to narrow.

Other Considerations: Individuals migrate up to 2,000 km between nesting beaches and feeding areas. Hence local populations may experience negative impacts from distant threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/28/1978
Lead Region:   Southeast Region (Region 4)   
Where Listed: FL, Mexico nesting pops.

Status: Threatened
Date Listed: 07/28/1978
Lead Region:   Southeast Region (Region 4)   
Where Listed: except where endangered


Population detail:

Population location: Wherever found except where listed as endangered
Listing status: T

Population location: Breeding colony populations in FL and on Pacific coast of Mexico
Listing status: E

For most current information and documents related to the conservation status and management of Chelonia mydas , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1). Listed on Appendix I of CITES (3) and Appendices I and II of the Convention on Migratory Species (CMS or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: The Marine Turtle Specialist Group of the World Conservation Union analyzed population trends at 32 index nesting sites around the world and found a 48-65% decline in the number of mature females nesting annually over the past 100-150 years (this represents 3 generations).

In a couple dozen areas for which recent data are available, most populations were stable or increasing (19 or 23) (NMFS and USFWS 2007). These trends should be interpreted with caution because events that affected juvenile recruitment up to several decades ago may continue to affect nesting populations.

Global Long Term Trend: Decline of 30-70%

Comments: Number of subpopulations and especially population size undoubtedly have undergone a major decline over the long term.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Green turtles, like other sea turtle species, are particularly susceptible to population declines because of their vulnerability to anthropogenic impacts during all life-stages: from eggs to adults. Perhaps the most detrimental human threats to green turtles are the intentional harvests of eggs and adults from nesting beaches and juveniles and adults from foraging grounds. Unfortunately, harvest remains legal in several countries despite substantial subpopulation declines (e.g., Humphrey and Salm 1996, Fleming 2001, Fretey 2001). In addition, a number of incidental threats impact green turtles around the world. These threats affect both terrestrial and marine environments, and include bycatch in marine fisheries, habitat degradation at nesting beaches and feeding areas, and disease. Mortality associated with entanglement in marine fisheries is the primary incidental threat; the responsible fishing techniques include drift netting, shrimp trawling, dynamite fishing, and long-lining. Degradation of both nesting beach habitat and marine habitats also play a role in the decline of many Green Turtle stocks. Nesting habitat degradation results from the construction of buildings, beach armoring and re-nourishment, and/or sand extraction (Lutcavage et al. 1997). These factors may directly, through loss of beach habitat, or indirectly, through changing thermal profiles and increasing erosion, serve to decrease the quantity and quality of nesting area available to females, and may evoke a change in the natural behaviors of adults and hatchlings (Ackerman 1997). The presence of lights on or adjacent to nesting beaches alters the behavior of nesting adults (Witherington 1992) and is often fatal to emerging hatchlings as they are attracted to light sources and drawn away from the water (Witherington and Bjorndal 1990). Habitat degradation in the marine environment results from increased effluent and contamination from coastal development, construction of marinas, increased boat traffic, and harvest of nearshore marine algae resources. Combined, these impacts diminish the health of coastal marine ecosystems and may, in turn, adversely affect green turtles. For example, degradation of marine habitats has been implicated in the increasing prevalence of the tumor-causing Fibropapilloma disease (George 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Major threats, which vary throughout the range, include degradation of nesting habitat, including beach lighting, which may disorient hatchlings and/or nesting females; human predation on nesting females and turtles in foraging areas (e.g., for meat and use in commericial products); collection of eggs for human consumption; predation on eggs and hatchlings by raccoons, dogs, etc.; mortality in fishing gear and other entangling debris; collisions with power boats; contact with chemical pollutants; and epidemic outbreaks of fibropapilloma or "tumor" infections (Mitchell 1991, Ehrhart and Witherington 1992, Tuato`o-Bartley et al. 1993, Losey et al. 1994, Barrett 1996, NMFS and USFWS 2007). In the north, juveniles experience periodic mortality due to cold-stunning associated with rapid temperature declines in fall. See USFWS (1998) and NMFS and USFWS (2007) for further information on certain threats, including beach erosion, beach armoring, beach nourishment, artificial lighting, beach cleaning, increased human presence, recreational beach equipment, exotic dune and beach vegetation, nest loss to abiotic factors, predation, poaching, and disease.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Though green sea turtles have lived on Earth for 150 million years—since before the time of dinosaurs—they are now endangered and their population is decreasing! Many people like to eat them and hunt them for shells and leather. Sometimes they are accidentally caught and killed by the fishing industry that is trying to catch other fish. Green sea turtles are on the endangered species list, and there are many projects to try and protect them. One is the Sea Turtle Restoration Project.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Green turtles are overharvested in many areas for both their meat and eggs (8). The meat is highly prized and the cartilage underneath the plastron (known as 'calipee') is used in the production of turtle soup (2). In addition, as with other marine turtles, these reptiles are accidentally caught in bycatch of the fishing industry (8). One of the most worrying threats in recent years has been an increase in fibropapillomas; fibrous tumours that can grow on almost any part of a turtles body, impeding movement or sight, and often leading to death (6). Very little is known about the disease, which is believed to be a virus, and its prominence varies amongst different populations, although there may be a link with coastal areas of heavy human use (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Green turtles have been afforded legislative protection under a number of treaties and laws (e.g., Navid 1982, Humphrey and Salm 1996, Fleming 2001, Fretey 2001). Among the more globally relevant designations are those of Endangered by the World Conservation Union (IUCN; Baillie and Groombridge 1996, Hilton-Taylor 2000); Annex II of the SPAW Protocol to the Cartagena Convention (a protocol concerning specially protected areas and wildlife); Appendix I of CITES (Convention on International Trade in Endangered Speciesof Wild Fauna and Flora); and Appendices I and II of the Convention on Migratory Species (CMS). A partial list of the International Instruments that benefit green turtles includes the Inter-American Convention for the Protection and Conservation of Sea Turtles, the Memorandum of Understanding on the Conservation and Management of Marine Turtles and their Habitats of the Indian Ocean and South-East Asia (IOSEA), the Memorandum of Understanding on ASEAN Sea Turtle Conservation and Protection, the Memorandum of Agreement on the Turtle Islands Heritage Protected Area (TIHPA), and the Memorandum of Understanding Concerning Conservation Measures for Marine Turtles of the Atlantic Coast of Africa.
As a result of these designations and agreements, many of the intentional impacts directed at sea turtles have been lessened: harvest of eggs and adults has been slowed at several nesting areas through nesting beach conservation efforts and an increasing number of community-based initiatives are in place to slow the take of turtles in foraging areas. In regard to incidental take, the implementation of Turtle Excluder Devices has proved to be beneficial in some areas, primarily in the United States and South and Central America (National Research Council 1990). However, despite these advances, human impacts continue throughout the world. The lack of effective monitoring in pelagic and near-shore fisheries operations still allows substantial direct and indirect mortality, and the uncontrolled development of coastal and marine habitats threatens to destroy the supporting ecosystems of long-lived green turtles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Pattern of nesting on natal beach may inhibit natural recolonization of breeding sites of decimated populations.

Preserve Selection and Design Considerations: Local foraging populations may consist of individuals from widely separated nesting populations. For example, mtDNA data indicate that a foraging population of juveniles from Hutchinson Island, Florida, consisted of individuals from Costa Rica, United States and Mexico, and Aves Island (Venezuela and Surinam; another population of juveniles from the Bahamas represented Costa Rica, United States and Mexico, Aves Island and Suriname, and Ascension Island and Guinea Bissau (Bass and Witzell 2000). Thus the success of preserves for foraging juveniles may depend on cooperative international management (Bass and Witzell 2000).

Management Requirements: Frazer (1992) emphasized the primary need for clean and productive marine and coastal environments; installation of turtle excluder devices in shrimp trawl nets and use of low pressure sodium lighting on beaches were suggested as appropriate sea turtle conservation technologies, whereas headstarting, captive breeding, and hatcheries were regarded as ineffective at best. "Head-starting" and broad-scale nest translocation remain unproven as effective management measures (Ehrhart and Witherington 1992). See Bjorndal (1982) for several papers containing management and research recommendations and discussion of conservation issues.

See NMFS (Federal Register, 19 December 1996, pp. 66933-66947) for recent amendments to regulations pertaining to the use of turtle excluder devices along the Gulf and Atlantic coasts of the southeastern U.S. See NMFS (1993) for recent shrimp trawling regulations for an area off the coast of North Carolina (allow tow-time limits as an interim alternative to the use of turtle excluder devices).

If beach lighting cannot be eliminated, low pressure sodium vapor lights may be the least disruptive to nesting turtles (Witherington 1992).

A recovery plan is available; see Marine Turtle Recovery Team (1984). See also recovery plans for U.S. Pacific and east Pacific populations (NMFS 1998) .

[Move to GPROTNEED: Ehrhart and Witherington (1992) emphasized the need to protect nesting areas in southern Brevard and northern Indian River counties in southeastern Florida.]

Biological Research Needs: Better information is needed on demography, migrations, and developmental requirements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Foraging, developmental, and nesting habitat need protection from from any type of human activity. Purchase of turtle products should be discouraged.

See "Recovery plan for U.S. Pacific populations of the green turtle (Chelonia mydas)" and "Recovery plan for U.S. Pacific populations of the east Pacific green turtle (Chelonia mydas)."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The green turtle is protected form international trade by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). A number of conservation projects around the world work to protect nesting areas from disturbance (6). The increasing prevalence of fibropapillomas is an extremely worrying phenomenon and scientists are working hard to understand this disease.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

According to "The Official World Wildlife Fund Guide to Endangered Species of North America," in some areas of the world such as the Caribbean, Mexico, and South America, green sea turtles are an important source of food for humans. They are captured and their meat is used for turtle soup (Behler, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Adults and eggs are harvested for human consumption in many areas, also for skins and oil for the leather and cosmetics trade. See Mack et al. (1982) for information on commercial exploitation. See Luxmoore and Canin (1985) for information on international trade in shell in the late 1970s and early 1980s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green sea turtle

"Chelonia" redirects here. It is also the name of the superorder uniting turtles, tortoises and terrapins (Testudines) with the "proto-turtle" Australochelys.

The Green sea turtle (Chelonia mydas), also known as green turtle, black (sea) turtle, or Pacific green turtle,[3] is a large sea turtle of the family Cheloniidae. It is the only species in the genus Chelonia.[4] Its range extends throughout tropical and subtropical seas around the world, with two distinct populations in the Atlantic and Pacific Oceans.[5] Their common name derives from the usually green fat found beneath their carapace (upper shell).

The green sea turtle is a sea turtle, possessing a dorsoventrally flattened body covered by a large, teardrop-shaped carapace and a pair of large, paddle-like flippers. It is usually lightly colored, although parts of the carapace can be almost black in the eastern Pacific. Unlike other members of its family, such as the hawksbill sea turtle and loggerhead sea turtle, C. mydas is mostly herbivorous. The adults commonly inhabit shallow lagoons, feeding mostly on various species of seagrasses.[6]

Like other sea turtles, they migrate long distances between feeding grounds and hatching beaches. Many islands worldwide are known as Turtle Island due to green sea turtles nesting on their beaches. Females crawl out on beaches, dig nests and lay eggs during the night. Later, hatchlings emerge and walk into the water. Those that reach maturity may live to age 80 in the wild.[5]

C. mydas is listed as endangered by the IUCN and CITES and is protected from exploitation in most countries. It is illegal to collect, harm or kill them. In addition, many countries have laws and ordinances to protect nesting areas. However, turtles are still in danger because of several human practices. In some countries, turtles and their eggs are hunted for food. Pollution indirectly harms turtles at both population and individual scales. Many turtles die caught in fishing nets. Also, real estate development often causes habitat loss by eliminating nesting beaches.

Contents

Taxonomy

Female returning to the sea after nesting in Redang Island, Malaysia

The green sea turtle is a member of the tribe Chelonini. A 1993 study clarified the status of genus Chelonia with respect to the other marine turtles. The carnivorous Eretmochelys (hawksbill), Caretta (loggerhead) and Lepidochelys (Ridley) were assigned to the tribe Carettini. Herbivorous Chelonia warranted their status, while Natator (flatback) was further removed than previously believed.[7]

The species was originally described by Linnaeus in 1758 as Testudo mydas.[8] In 1868, Bocourt named a particular species of sea turtle as Chelonia agassizii (Chelonia agassizi is a commonly cited misspelling of this taxon).[9] This "species" was referred to as the "black sea turtle".[10] Later research determined the "black sea turtle" was not genetically distinct from C. mydas, and thus taxonomically not a separate species.[11] These two "species" were then united as Chelonia mydas and were given subspecies status. C. mydas mydas referred to the originally described population, while C. mydas agassizi referred only to the Pacific population.[12][13] This subdivision was later determined to be invalid and all species members were then designated Chelonia mydas.[4] The oft-mentioned name C. agassizi remains an invalid junior synonym of C. mydas.

The species' common name does not derive from any particular green external coloration of the turtle. Its name comes from the greenish color of the turtles' fat, which is only found in a layer between their inner organs and their shell.[14] As a species found worldwide, the green turtle is called differently in some languages and dialects. In the Hawaiian language, honu is used to refer to this species.[15]

Description

Its appearance is that of a typical sea turtle. C. mydas has a dorsoventrally flattened body, a beaked head at the end of a short neck, and paddle-like arms well-adapted for swimming.[16] Adult green turtles grow to 1.5 metres (5 ft) long.[17] The average weight of mature individuals is 68–190 kg (150–420 lb) and the average carapace length is 78–112 cm (31–44 in).[18] Exceptional specimens can weigh 315 kg (690 lb) or even more, with the largest known C. mydas having weighed 395 kg (870 lb) and measured 153 cm (60 in) in carapace length.[19]

Drawing of turtle carapace and plastron showing respectively, vertebral, costal, marginal, and supracaudal and intergular, gular, pectoral, abdominal, humeral, femoral, anal, axillary (anterior inframarginal) and ingiunal (posterior inframarginal) shields
Scalation of carapace and plastron

Anatomically, a few characteristics distinguish the green turtle from the other members of its family. Unlike the closely related hawksbill turtle, the green turtle's snout is very short and its beak is unhooked. The sheath of the turtle's upper jaw possesses a denticulated edge, while its lower jaw has stronger, serrated, more defined denticulation. The dorsal surface of the turtle's head has a single pair of prefrontal scales. Its carapace is composed of five central scutes flanked by four pairs of lateral scutes. Underneath, the green turtle has four pairs of inframarginal scutes covering the area between the turtle's plastron and its shell. Mature C. mydas front appendages have only a single claw (as opposed to the hawksbill's two), although a second claw is sometimes prominent in young specimens.[20]

The carapace of the turtle has various color patterns that change over time. Hatchlings of C. mydas, like those of other marine turtles, have mostly black carapaces and light-colored plastrons. Carapaces of juveniles turn dark brown to olive, while those of mature adults are either entirely brown, spotted or marbled with variegated rays. Underneath, the turtle's plastron is hued yellow. C. mydas limbs are dark-colored and lined with yellow, and are usually marked with a large dark brown spot in the center of each appendage.[5][21]

Distribution

The range of C. mydas extends throughout tropical and subtropical oceans worldwide. There are two major subpopulations, the Atlantic and the eastern Pacific subpopulations. Each population is genetically distinct, with their own set of nesting and feeding grounds within the population's known range.[5]

Map showing turtle distribution with concentrations at entrance to Persian Gulf, East African coast, East and West South African coasts, Northern Australia, and Indonesia, with lesser concentrations in Caribbean, Western African coast, Red Sea, India, and Oceania.
C. mydas distribution, the red circles are known major nesting sites. Yellow circles represent minor nesting locations.

Atlantic subpopulation

Photo of swimming turtle at twilight
Swimming in a Mexican coral reef

Chelonia mydas can generally be found throughout the entire Atlantic Ocean. Individuals have been spotted as far north as Canada in the western Atlantic, and the British Isles in the east. The subpopulation's southern range is known until past the southern tip of Africa in the east and Argentina in the western Atlantic. The major nesting sites can be found on various islands in the Caribbean, along the eastern shores of the continental United States, the eastern coast of the South American continent and most notably, on isolated North Atlantic islands.

In the Caribbean, major nesting sites have been identified on Aves Island, the U.S. Virgin Islands, Puerto Rico, and Costa Rica. In recent years there are signs of increased nesting in the Cayman Islands.[22] One of the region's most important nesting grounds is in Tortuguero in Costa Rica.[23] In fact, the majority of the Caribbean region's C. mydas population hails from a few beaches in Tortuguero.[24] Within United States waters, minor nesting sites have been noted in the states of Georgia, North Carolina, South Carolina, and all along the east coast of Florida. Hutchinson Island in particular is a major nesting area in Florida waters. Notable locations in South America include secluded beaches in Suriname and French Guiana.[25] In the Southern Atlantic Ocean, the most notable nesting grounds for Chelonia mydas are found on the island of Ascension,[16] hosts 6,000–13,000 turtle nests.[26][27][28]

In contrast with the sporadic distribution of nesting sites, feeding grounds are much more widely distributed throughout the region. Important feeding grounds in Florida include Indian River Lagoon, the Florida Keys, Florida Bay, Homosassa, Crystal River, and Cedar Key.[16][29]

Indo-Pacific subpopulation

Photo of turtle swimming towards surface with diver in background
About to break the surface for air at Kona, Hawaii

In the Pacific, its range reaches as far north as the southern coast of Alaska and as far south as Chile in the east. The turtle's distribution in the western Pacific reaches north to Japan and southern parts of Russia's Pacific coast, and as far south as the northern tip of New Zealand and a few islands south of Tasmania. The turtles can be found throughout the Indian Ocean.[30]

Significant nesting grounds are scattered throughout the entire Pacific region, including Mexico, the Hawaiian Islands including O'ahu's Turtle Bay,[31] the South Pacific, the northern coast of Australia, and Southeast Asia. Major Indian Ocean nesting colonies include India, Pakistan, and other coastal countries. The east coast of the African continent hosts a few nesting grounds, including islands in the waters around Madagascar.[30]

Photo of turtle walking on beach
Heading for the ocean on a beach at the Pu'uhonua o Honaunau National Historical Park

Nesting grounds are found all along the Mexican coast. These turtles feed in seagrass pastures in the Gulf of California.[32] Green turtles belonging to the distinct Hawaiian subpopulation nest at the protected French Frigate Shoals some 800 kilometers (500 mi) west of the Hawaiian Islands.[15] In the Philippines, green turtles nest in the Turtle Islands along with closely related hawksbill turtles.[33] Indonesia has a few nesting beaches, one in the Meru Betiri National Reserve in East Java.[34] The Coral Sea has nesting areas of world significance.[35] The Great Barrier Reef has two genetically distinct populations; one north and one south. Within the reef, twenty separate locations consisting of small islands and cays were identified as nesting sites for either population of C. mydas. Of these, the most important is on Raine Island.[36][37] Major nesting sites are common on either side of the Arabian Sea, both in Ash Sharqiyah, Oman, and along the coast of Karachi, Pakistan. Some specific beaches there, such as Hawke's Bay and Sandspit, are common to both C. mydas and L. olivacea subpopulation. Sandy beaches along Sindh and Balochistan are nesting sites. Some 25 kilometers (16 mi) off the Pakistani coast, Astola island is another nesting beach.[6][38][39]

On 30 December 2007, fishermen, using a hulbot-hulbot (a type of fishnet) accidentally caught an 80 kg (180 lb), 93 cm (37 in) and 82 cm (32 in) wide, turtle off Barangay Bolong, Zamboanga City, Philippines. December is breeding season near the Bolong beach.[40]

Ecology and behavior

Turtle swimming toward surface
Swimming, Hawaii

As one of the first sea turtle species studied, much of what is known of sea turtle ecology comes from studies of green turtles. The ecology of C. mydas changes drastically with each stage of its life history. Newly emerged hatchlings are carnivorous, pelagic organisms, part of the open ocean mininekton. In contrast, immature juveniles and adults are commonly found in seagrass meadows closer inshore as herbivorous grazers.

Habitat

Green sea turtles move across three habitat types, depending on their life stage. They lay eggs on beaches. Mature turtles spend most of their time in shallow, coastal waters with lush seagrass beds. Adults frequent inshore bays, lagoons and shoals with lush seagrass meadows. Entire generations often migrate between one pair of feeding and nesting areas.[16]

Turtles spend most of their first five years in convergence zones within the open ocean.[6][41] These young turtles are rarely seen as they swim in deep, pelagic waters.[42][43]
Green sea turtles typically swim at 2.5–3 km/h (1.6–1.9 mph).[44]

Predators

Only human beings and the larger sharks feed on C. mydas adults. Specifically, tiger sharks (Galeocerdo cuvier) hunt adults in Hawaiian waters.[45] Juveniles and new hatchlings have significantly more predators, including crabs, small marine mammals and shorebirds.[5] In Turkey, their eggs are vulnerable to predation by red foxes and golden jackals.[46]

Life cycle

Photo of newly hatched turtle held in human hand
Hatchling

Green sea turtles migrate long distances between feeding sites and nesting sites; some swim more than 2,600 kilometres (1,600 mi) to reach their spawning grounds. Mature turtles often return to the exact beach from which they hatched. Females usually mate every two to four years. Males, on the other hand, visit the breeding areas every year, attempting to mate.[47] Mating seasons vary between populations. For most C. mydas in the Caribbean, mating season is from June to September.[16] The French Guiana nesting subpopulation nests from March to June.[25] In the tropics, green turtles nest throughout the year, although some subpopulations prefer particular times of the year. In Pakistan, Indian Ocean turtles nest year-round, but prefer the months of July to December.[38]

Green sea turtles mating is similar to other marine turtles. Female turtles control the process. A few populations practice polyandry, although this does not seem to benefit hatchlings.[48] After mating in the water, the female moves above the beach's high tide line, where she digs a hole with her hind flippers and deposits her eggs. Clutch size depends on the age of the female and species, but can range between 100 and 200. She then covers the nest with sand and returns to the sea.[5]

At around 45 to 75 days, the eggs hatch during the night, and the hatchlings instinctively head directly into the water. This is the most dangerous time in a turtle's life. As they walk, predators, such as gulls and crabs, feed on them. A significant percentage never make it to the ocean. Little is known of the initial life history of newly hatched sea turtles.[16] Juveniles spend three to five years in the open ocean before they settle as still-immature juveniles into their permanent shallow-water lifestyle.[42][43] It is speculated that they take twenty to fifty years to reach sexual maturity. Individuals live up to eighty years in the wild.[5] It is estimated that only 1% of hatchlings reach sexual maturity.[49]

Each year on Ascension Island in the South Atlantic, C. mydas females create 6,000 to 15,000 nests. They are among the largest green turtles in the world; many are more than a metre in length and weigh up to 300 kilograms (660 lb).[50]

Breathing and sleep

Sea turtles spend almost all their lives submerged, but must breathe air for the oxygen needed to meet the demands of vigorous activity. With a single explosive exhalation and rapid inhalation, sea turtles can quickly replace the air in their lungs. The lungs permit a rapid exchange of oxygen and prevent gases from being trapped during deep dives. Sea turtle blood can deliver oxygen efficiently to body tissues even at the pressures encountered during diving. During routine activity, green and loggerhead turtles dive for about four to five minutes, and surface to breathe for one to three seconds.

Turtles can rest or sleep underwater for several hours at a time, but submergence time is much shorter while diving for food or to escape predators. Breath-holding ability is affected by activity and stress, which is why turtles quickly drown in shrimp trawlers and other fishing gear.[20]

Importance to humans

Black-and-white photo of several turtles set on their backs
Harvested green turtles on a wharf at Key West, Florida

Historically, the turtles' skin was tanned and used to make handbags, especially in Hawaii.[15] Ancient Chinese considered the flesh of sea turtles a culinary delicacy, including and especially C. mydas.[51] Particularly for this species, the turtle's calipee, fat and cartilage are sought as ingredients for making turtle soup.[14]

In Java, Indonesia, sea turtle eggs were a popular delicacy. However, the turtle's flesh is regarded as ḥarām or "unclean" under Islamic law (Islam is Java's primary religion). In Bali, turtle meat was a prominent feature at ceremonial and religious feasts. Turtles were harvested in the remotest parts of the Indonesian archipelago.[52] Bali has been importing sea turtles since the 1950s, as its own turtle supplies became depleted.[53] The mostly Hindu Balinese do not eat the eggs, but sell them instead to local Muslims.

Commercial farms, such as the Cayman Turtle Farm in the West Indies, once bred them for commercial sale of turtle meat, turtle oil (rendered from the fat), turtle shell, and turtle leather made from the skin. The farm's initial stock was in large part from "doomed" eggs removed from nests threatened by erosion, flooding, or in chemically hostile soil.[54] The farms held as many as 100,000 turtles at any one time. When the international markets were closed by regulations that did not allow even farm-bred turtle products to be exported internationally, the surviving farm became primarily a tourist attraction, supporting 11,000 turtles.[55] Inintially started as Mariculture Ltd., then Cayman Turtle Farm Ltd and subsequently branded Boatswain's Beach, in 2010 the farm's brandname was changed to Cayman Turtle Farm: Island Wildlife Encounter.[56]

Sea turtles are integral to the history and culture of the Cayman Islands. When the islands were first discovered by Christopher Columbus in 1503, he named them "Las Tortugas" because of the abundance of sea turtles in the waters around the islands.[57] Many of the earliest visitors came to the Cayman Islands to capture the turtles as a source of fresh meat during long voyages. The Green Turtle is a national symbol displayed as part of the Coat of Arms of the Cayman Islands, which also forms part of the national flag of the Cayman Islands. The country's currency uses a turtle as the watermark in its banknotes.[58] A stylised sea turtle nicknamed "Sir Turtle" is the mascot of the national airline Cayman Airways[59] and is part of the livery of its aircraft.

Conservation

In recent decades, sea turtles have moved from unrestricted exploitation to global protection, with individual countries providing additional protection, although serious threats remain unabated.

Threats

Human action presents both intentional and unintentional threats to the species' survival. Intentional threats include continued hunting and egg harvesting. More dangerous are unintentional threats, including boat strikes, fishermen's nets that lack turtle excluder devices, pollution and habitat destruction. Chemical pollution may create tumors;[60] effluent from harbors near nesting sites may create disturbances; and light pollution may disorient hatchlings. Habitat loss usually occurs due to human development of nesting areas. Beach-front construction, land "reclamation" and increased tourism are examples of such development.[5][6] An infectious tumor-causing disease, fibropapillomatosis, is also a problem in some populations. The disease kills a sizeable fraction of those it infects, though some individuals seem to resist the disease.[15][61][62] Because of these threats, many populations are in a vulnerable state.

A poached green turtle in Costa Rica

Pacific green turtle’s foraging habitats are poorly understood and mostly unknown.[63] These foraging grounds are most likely along the coast of Baja California, Mexico and southern California,[64] in which these turtle’s have a high risk of incidental capture by coastal fisheries. The main mortality factor for these turtles is the shrimp trawlers in Mexico, in which many of these turtles go undocumented.[64] The only foraging area that has been identified is the San Diego Bay, but it is heavily polluted with metals and PCBs.[64] These contaminants have a negative effect on the ocean environment, and have been shown to cause lesions and sometimes mortality.[64] Green turtles also are threatened by entanglement and ingestion of plastic.[64] In San Diego Bay, an adult green turtle was found dead with monofilament netting tightly packed in its esophagus.[64]

Global initiatives

The International Union for the Conservation of Nature (IUCN) has repeatedly listed green sea turtles in its Red List under differing criteria. In 1982, they officially classified it as an endangered species.[65] The 1986,[66] 1988,[67] 1990,[68] 1994,[69] and the landmark 1996 edition of the IUCN Red List, retained the listing.[70]

In 2001, Nicholas Mrosovsky filed a delisting petition, claiming some green turtle populations were large, stable and in some cases, increasing. At the time, the species was listed under the strict EN A1abd criteria. The IUCN Standards and Petitions Subcommittee ruled that visual counts of nesting females could not be considered "direct observation" and thus downgraded the species' status to EN A1bd—retaining the turtle's endangered status.[71]

In 2004, the IUCN reclassified C. mydas as endangered under the EN A2bd criteria, which essentially states the wild populations face a high risk of extinction because of several factors. These factors include a probable population reduction of more than 50% over the past decade as estimated from abundance indices and by projecting exploitation levels.[72]

On 3 May 2007, C. mydas was listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) as a member of the family Cheloniidae.[73] The species was originally listed on Appendix II in 1975. The entire family was moved to Appendix I in 1977, with the exception of the Australian population of C. mydas. In 1981, the Australian population joined the rest. It is therefore illegal to import, export, kill, capture or harass green turtles.[74]

The Mediterranean population is listed as critically endangered.[5][14] The eastern Pacific, Hawaiian and Southern California subpopulations are designated threatened. Specific Mexican subpopulations are listed as endangered. The Florida population is listed as endangered. The World Wide Fund for Nature has labeled populations in Pakistan as "rare and declining".[39]

Country-specific initiatives

At the Osaka Aquarium, profile photo of turtle resting on bottom

In addition to management by global entities such as the IUCN and CITES, specific countries around the world have undertaken conservation efforts.

The traditional uses of turtle on Bali were once deemed sustainable, but have been questioned considering greater demand from the larger and wealthier human population. The harvest was the most intensive in the world.[52] In 1999, Indonesia restricted turtle trade and consumption because of the decreasing population and threat of a tourist boycott. It rejected a request made by Bali Governor I Made Mangku Pastika in November 2009 to set a quota of 1,000 turtles to be killed in Hindu religious ceremonies. While conservationists respect the need for turtles in rituals, they wanted a smaller quota.[75]

Ecotourism is one initiative in Sabah, Malaysia. The island of Pulau Selingan is home to a turtle hatchery. Staff people place some of the eggs laid each night in a hatchery to protect them from predators. Incubation takes around sixty days. When the eggs hatch, tourists assist in the release of the baby turtles into the sea.[76] In the United States, the U.S. Fish and Wildlife Services and National Marine Fisheries Service classify C. mydas as a threatened species under the Endangered Species Act,[77] rendering it a federal offense to capture or kill an individual turtle. The Hawaiian subpopulation has made a remarkable comeback and is now one focus of ecotourism and has become something of a state mascot. Students of Hawaii Preparatory Academy on the Big Island have tagged thousands of specimens since the early 1990s.[15] In the United Kingdom the species is protected by a Biodiversity Action Plan, due to excess harvesting and marine pollution.[78] The Pakistani-branch of the World Wide Fund for Nature has been initiating projects for secure turtle hatching since the 1980s. However, the population has continued to decline.[6]

In the Atlantic, conservation initiatives have centered around Caribbean nesting sites. The Tortuguero nesting beaches in Costa Rica have been the subject of egg-collection limits since the 1950s. The Tortuguero National Park was formally established in 1976, in part, to protect that region's nesting grounds.[23] On Ascension Island, which contains some of the most important nesting beaches, an active conservation program has been implemented.,[79] Karumbé has been monitoring foraging and developmental areas of juvenile green turtles in Uruguay since 1999.[80]

Cayman Turtle Farm located in Grand Cayman in the northwest Caribbean Sea is the first farm to have achieved the second generation of Green Sea turtles bred, laid, hatched, and raised in captivity.[81] Since its beginning in 1968, the farm has released over 31,000 turtles into the wild,[82] and each year more captive-bred turtles are released into the Caribbean Sea from beaches around the island of Grand Cayman.[83] Captive-bred turtles released from the farm as hatchlings or yearlings with "living tags," have now begun to return to nest on Grand Cayman as adults.[84] [85] On February 19, 2012 the farm released the first 2nd-generation captive-bred Green Sea turtle equipped with a Position Tracking Transponder - PTT (also known as a satellite tag).[86] In addition, the farm provides turtle meat products to the local population for whom turtle has been part of the traditional cuisine for centuries. In so doing, the farm curtails the incentive to take turtles from the wild,[87] which over the years in addition to the Cayman Turtle Farm's release of captive-bred turtles has enabled an increase in the number of turtles sighted in the waters around the island of Grand Cayman and nesting on its beaches.[88]

In the Pacific, green sea turtles nest on the motu (islets) in the Funafuti Conservation Area, a marine conservation area covering 33 square kilometers (12.74 square miles) of reef, lagoon and motu on the western side of Funafuti atoll in Tuvalu.[89]

See also

Notes

  1. ^ Green sea turtle, IUCN Red List
  2. ^ Chelonia mydas, Reptile Database
  3. ^ Swash, A. & Still, R. (2005) Birds, Mammals, and Reptiles of the Galápagos Islands. Second Edition. Hampshire, UK:WildGuides Ltd. p.116.
  4. ^ a b "Chelonia mydas". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173833. Retrieved 21 February 2007. 
  5. ^ a b c d e f g h i "Green Sea Turtle (Chelonia mydas)". National Geographic - Animals. National Geographic Society. 2005-12-29. http://www3.nationalgeographic.com/animals/reptiles/green-turtle.html. Retrieved 2007-02-21. 
  6. ^ a b c d e "Green Sea Turtle - Chelonia mydas japonica". Turtles of Pakistan. Wildlife of Pakistan. 2003. http://www.wildlifeofpakistan.com/ReptilesofPakistan/greenseaturtle.htm. Retrieved 2007-02-21. 
  7. ^ Bowen, Brian W.; William S. Nelson and John C. Avise (1993-06-15). "A Molecular Phylogeny for Marine Turtles: Trait Mapping, Rate Assessment, and Conservation Relevance". Proceedings of the National Academy of Sciences of the United States of America (National Academy of Sciences) 90 (12): 5574–5577. doi:10.1073/pnas.90.12.5574. PMC 46763. PMID 8516304. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=46763. 
  8. ^ "Testudo mydas". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=208662. Retrieved 23 February 2007. 
  9. ^ "Chelonia agassizi". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=655934. Retrieved 23 February 2007. 
  10. ^ "Chelonia agassizii". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=202103. Retrieved 23 February 2007. 
  11. ^ Karl, Stephen H.; Brian W. Bowen (1999). "Evolutionary Significant Units versus Geopolitical Taxonomy: Molecular Systematics of an Endangered Sea Turtle (genus Chelonia)". Conservation Biology (Blackwell Synergy) 13 (5): 990–999. doi:10.1046/j.1523-1739.1999.97352.x. http://www.blackwell-synergy.com/doi/abs/10.1046/j.1523-1739.1999.97352.x. Retrieved 2007-09-09. 
  12. ^ "Chelonia mydas agassizi". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=208663. Retrieved 23 February 2007. 
  13. ^ "Chelonia mydas mydas". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173834. Retrieved 23 February 2007. 
  14. ^ a b c "green turtle". Marine Turtles. Marine Conservation Society. 2007. Archived from the original on 2007-08-22. http://web.archive.org/web/20070822011514/http://www.mcsuk.org/marineworld/turtles/green+turtle. Retrieved 2007-08-30. 
  15. ^ a b c d e Glick, Daniel (September 2005). "Back from the Brink". The Smithsonian Magazine (Smithsonian Institution): 54–55. http://www.smithsonianmag.com/issues/2005/september/brink.php?page=1. Retrieved 2007-08-31. 
  16. ^ a b c d e f "Green sea turtle (Chelonia mydas)". North Florida Field Office. United States Fish and Wildlife Service. 2005-12-29. http://www.fws.gov/northflorida/SeaTurtles/Turtle%20Factsheets/Green-Sea-Turtle.htm. Retrieved 2007-02-21. 
  17. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  18. ^ [1]
  19. ^ "Species Fact Sheet: Green Sea Turtle". Caribbean Conservation of jackass & Sea Turtle Survival League. Caribbean Conservation Corporation. 2005-12-29. http://www.cccturtle.org/green.htm. Retrieved 2007-02-22. 
  20. ^ a b "Green Sea Turtle". MarineBio.org. 2007-05-21. http://marinebio.org/species.asp?id=51. Retrieved 2007-09-02. 
  21. ^ Boulenger, G. A. (1890). The Fauna of British India, including Ceylon and Burma. Reptilia and Batrachia.. London: Taylor & Francis. pp. 541. ISBN 0548968489. 
  22. ^ Connolly, Norma (2 June 2011). "More turtles nesting in Cayman". Caymanian Compass. http://www.compasscayman.com/caycompass/2011/06/02/More-turtles-nesting-in-Cayman/. "(Quoted Ebanks-Petrie, Gina and Blumenthal, Janice of the Department of the Environment, Cayman Islands)" 
  23. ^ a b Bjorndal, Karen A.; Jerry A. Wetherall, Alan B. Bolten and Jeanne A. Mortimer (February 1999). "Twenty-Six Years of Green Turtle Nesting at Tortuguero, Costa Rica: An Encouraging Trend". Conservation Biology 13 (1): 126–134. doi:10.1046/j.1523-1739.1999.97329.x. 
  24. ^ Lahanas, P. N.; K. A. Bjorndal, A. B. Bolten, S. E. Encalada, M. M. Miyamoto, R. A. Valverde, and B. W. Bowen (1998). "Genetic composition of a green turtle (Chelonia mydas) feeding ground population: evidence for multiple origins" (PDF). Marine Biology (Springer-Verlag) 130: 345–352. doi:10.1007/s002270050254. http://accstr.ufl.edu/publications/Lahanas_et_al_1998_MarBiol.pdf. Retrieved 2007-09-01. 
  25. ^ a b Girondot, Marc; Jacques Fretey (1996). "Leatherback Turtles, Dermochelys coriacea, Nesting in French Guiana, 1978-1995". Chelonian Conservation Biology 2: 204–208. http://www.ese.u-psud.fr/epc/conservation/Publi/texte/AE_CCB96.html. Retrieved 2007-09-14. 
  26. ^ Seminoff, Jeffrey A.; et al. (2002) (PDF). IUCN 2002 Red List Global Status Assessment: Green Turtle (Chelonia mydas). of the World Conservation Union (IUCN). p. 93. http://www.seaturtle.org/PDF/Seminoff_2002_IUCNList.pdf. 
  27. ^ Godley, Brendan J.; Annette C. Broderick and Graeme C. Hays (February 2001). "Nesting of green turtles (Chelonia mydas) at Ascension Island, South Atlantic". Biological Conservation 97 (2): 151–158. doi:10.1016/S0006-3207(00)00107-5. 
  28. ^ Broderick, Annette C.; Brendan J. Godley and Graeme C. Hays (2001). "Monitoring and conservation of marine turtles of Ascension Island: a sustainable resource". Interim Report to Foreign and Commonwealth Office Environment Fund for the Overseas Territories. p. 13. 
  29. ^ Audubon, Maria R. (1897/1986). Audubon and His Journals: Dover Publications Reprint. New York: Scribner's Sons. pp. 373–375. ISBN 978-0486251448. 
  30. ^ a b Caribbean Conservation Corporation (1961). Green turtle nesting sites (Map). Cartography by Center for Marine Conservation. http://www.cccturtle.org/sea-turtle-information.php?page=green. Retrieved 2007-08-31. 
  31. ^ Campaign to Protect Turtle Bay (HI).
  32. ^ Seminoff, Jeffrey A.; Javier Alvarado, Carlos Delgado, Jose Luis Lopez, Gabriel Hoeffer (June 2002). "First Direct Evidence of Migration by an East Pacific Green Seaturtle from Michoacan, Mexico to a Feeding Ground on the Sonoran Coast of the Gulf of California". The Southwestern Naturalist (Southwestern Association of Naturalists) 47 (2): 314–316. doi:10.2307/3672922. JSTOR 3672922. 
  33. ^ "Ocean Ambassadors - Philippine Turtle Islands". Coastal Resource & Fisheries Management of the Philippines. OneOcean.org. http://www.oneocean.org/ambassadors/track_a_turtle/tihpa/pti.html. Retrieved 2007-02-06. 
  34. ^ (PDF) Indonesian Sea Turtle Conservation. Yayasan, Indonesia: World Wide Fund for Nature, Indonesia. p. 4. http://assets.panda.org/downloads/brochureturtlecop7indonesiacbd.pdf. Retrieved 2007-09-16. 
  35. ^ C.Michael Hogan. 2011. Coral Sea. Encyclopedia of Earth. Eds. P.Saundry & C.J.Cleveland. National Council for Science and the Environment. Washington DC
  36. ^ Dobbs, Kirstin (2007) (PDF). Marine turtle and dugong habitats in the Great Barrier Reef Marine Park used to implement biophysical operational principles for the Representative Areas Program. Great Barrier Marine Park Authority. ISBN 978-1-876945-58-9. http://www.gbrmpa.gov.au/__data/assets/pdf_file/0007/18799/rap_turtle_and_dugong_bop.pdf. 
  37. ^ Tucker, Anton D.; Mark A. Read (September 2001). "Frequency of Foraging by Gravid Green Turtles (Chelonia mydas) at Raine Island, Great Barrier Reef". Journal of Herpetology (Society for the Study of Amphibians and Reptiles) 35 (3): 500–503. doi:10.2307/1565970. JSTOR 1565970. 
  38. ^ a b Butler, E.; A. Astola (1877). "A summer cruise in the Gulf of Oman". Stray Feathers 5: 283–304. 
  39. ^ a b Groombridge, Brian; Aban Marker Kabraji and Abdul Latif Rao (1988). "Marine Turtles in Baluchistan (Pakistan)". Marine Turtle Newsletter 42: 1–3. http://www.seaturtle.org/mtn/archives/mtn42/mtn42p1.shtml. Retrieved 2007-08-30. 
  40. ^ Abs-Cbn Interactive, Green sea turtle caught in Zamboanga.
  41. ^ "Green Turtle (Chelonia mydas)". Fisheries: Office of Protected Resources. U. S. National Oceanographic Atmospheric Administration. 2007. http://www.nmfs.noaa.gov/pr/species/turtles/green.htm. Retrieved 2007-09-02. 
  42. ^ a b Reich, Kimberly J.; Karen A. Bjorndal & Alan B. Bolten (2007-09-18). "The ‘lost years’ of green turtles: using stable isotopes to study cryptic lifestages". Biology Letters 6 (in press): 712–4. doi:10.1098/rsbl.2007.0394. PMC 2391226. PMID 17878144. http://www.journals.royalsoc.ac.uk/content/k1l8072271716750/. Retrieved 2007-09-20. 
  43. ^ a b Brynner, Jeanna (2007-09-19). "Sea Turtles' Mystery Hideout Revealed". LiveScience (Imaginova Corp.). http://www.livescience.com/animals/070919_sea_turtle.html. Retrieved 2007-09-20. 
  44. ^ The navigational feats of green sea turtles migrating from Ascension Island investigated by satellite telemetry P. Luschi, G. C. Hays, C. Del Seppia, R. Marsh, and F. Papi, Proc. R. Soc. Lond. B (1998)
  45. ^ "Hawaiian Green Sea Turtle". Midway Atoll National Wildlife Refuge. 2002-09-05. Archived from the original on 2007-08-16. http://web.archive.org/web/20070816031529/http://www.fws.gov/midway/wildlife/turtle.html. Retrieved 2007-09-02. 
  46. ^ Predation on green turtle Chelonia mydas nests by wild canids at Akyatan beach, Turkey by L. Brown and D. W. Macdonald, Biological Conservation, Volume 71, Issue 1, 1995, pp. 55-60.
  47. ^ "Australian Threatened Species: Green turtle (Chelonia mydas)" (PDF) (Press release). Government of Australia. 2006. http://www.environment.gov.au/biodiversity/threatened/publications/pubs/tsd06green-turtle.pdf. Retrieved 2007-08-15. 
  48. ^ Lee, Patricia L. M.; Graeme C. Hays (2004-04-27). "Polyandry in a marine turtle: Females make the best of a bad job". Proceedings of the National Academy of Sciences 101 (17): 6530–6535. doi:10.1073/pnas.0307982101. PMC 404079. PMID 15096623. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=404079. 
  49. ^ http://news.discovery.com/animals/sea-turtle-120201.html#mkcpgn=rssnws1
  50. ^ Fowler, Stephen (2002-04-21). "About The Green Turtle on Ascension". Turtles. Ascension Island Heritage Society. http://www.heritage.org.ac/HS2right.htm. Retrieved 2007-09-16. 
  51. ^ Schafer, Edward H. (1962). "Eating Turtles in Ancient China". Journal of the American Oriental Society (American Oriental Society) 82 (1): 73–74. doi:10.2307/595986. JSTOR 595986. 
  52. ^ a b Whitten, T; Soeriaatmadja, R. E., Suraya A. A. (1996). The Ecology of Java and Bali. Hong Kong: Periplus Editions Ltd. pp. 756–760. ISBN 9625930728. 
  53. ^ Sumertha, I.N. 1974. Perikanan penyu dan cara pengelolaan di Indonesia. Dokumen. Kom. IPB 8: 1-18. Cited in Whitten, T; Soeriaatmadja, R. E., Suraya A. A. (1996). The Ecology of Java and Bali. Hong Kong: Periplus Editions Ltd. p. 757. ISBN 9625930728. 
  54. ^ Fosdick, Peggy & Sam (1994). Last chance lost?: can and should farming save the green sea turtle?. York, PA, USA: Irvin S. Naylor. pp. 73, 90, et al. 
  55. ^ Morriss, Andrew. "Survival of the Sea Turtle: Cayman Turtle Farm Starts Over". PERC Reports. Property and Environment Research Center. http://www.perc.org/articles/article825.php. Retrieved 2007-09-16. 
  56. ^ "About Us: 2010". Cayman Turtle Farm. http://www.turtle.ky/about-us. Retrieved 9 April 2012. 
  57. ^ "Turtle release set". Caymanian Compass. 23 October, 2007. http://www.compasscayman.com/caycompass/2007/10/24/Turtle-release-set/. 
  58. ^ "Fresh, new banknotes ready". Caymanian Compass. 6 April 2011. http://www.compasscayman.com/caycompass/2011/04/06/Fresh,-new-banknotes-ready/. 
  59. ^ McGowan, Cliodhna (13 May 2007). "Sir Turtle to keep flying". Caymanian Compass. http://www.compasscayman.com/caycompass/2007/05/14/Sir-Turtle-to-keep-flying/. 
  60. ^ Kessler, Rebecca (November 9, 2010). "Sea Turtle Herpes Tumors Linked to Sewage?". National Geographic News. http://news.nationalgeographic.com/news/2010/11/101108-green-sea-turtles-tumors-pollution-science-environment/. Retrieved November, 2010. 
  61. ^ Herbst, Lawrence H. (September 2000). "Marine Turtle Fibropapillomatosis: Hope Floats in a Sea of Ignorance". Proceedings of the 19th Annual Symposium on Sea Turtle Conservation and Biology 19: 39–40. NOAA Technical Memorandum NMFS-SEFSC-443. 
  62. ^ Moncada, Felix; Adela Prieto (September 2000). "Incidence of Fibropapillomas in the Green Turtle (Chelonia mydas) in Cuban Waters". Proceedings of the 19th Annual Symposium on Sea Turtle Conservation and Biology 19: 40–41. NOAA Technical Memorandum NMFS-SEFSC-443. 
  63. ^ Seminoff et al., 2002. Home range of green turtles Chelonia mydas at a coastal foraging area in the Gulf of California, Mexico. Mar Ecol Prog Ser 242: 253-265.
  64. ^ a b c d e f National Marine Fisheries Service and U.S. Fish and Wildlife Service. 1998. Recovery Plan for U.S. Pacific Populations of the East Pacific Green Turtle (Chelonia mydas). National Marine Fisheries Service, Silver Spring, MD.
  65. ^ Groombridge, B. (1982). The IUCN Amphibia-Reptilia Red Data Book, Part 1: Testudines, Crocodylia, Rhynocehapalia. Gland, Switzerland: IUCN. 
  66. ^ IUCN Conservation Monitoring Centre (1986). 1986 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK: IUCN. ISBN 2880326052. 
  67. ^ IUCN Conservation Monitoring Centre (1988). 1988 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK: IUCN. 
  68. ^ IUCN (1990). 1990 IUCN Red List of Threatened Animals. Gland, Switzerland and Cambridge, UK.: IUCN. 
  69. ^ Groombridge, B. (1994). 1994 IUCN Red List of Threatened Animals. Gland, Switzerland: IUCN. ISBN 2831701945. 
  70. ^ Groombridge, B.; Baillie (1996). 1996 IUCN Red List of Threatened Animals. Gland, Switzerland: IUCN. 
  71. ^ Red List Standards & Petitions Subcommittee (2001-10-18). "Ruling of the IUCN Red List Standards and Petitions Subcommittee on Petitions against the 1996 Listings of Four Marine Turtle Species, 18 October 2001" (PDF). International Union for Conservation of Nature and Natural Resources. http://intranet.iucn.org/webfiles/doc/SSC/RedList/MarineTurtleDecisions_18_Oct_01.pdf. Retrieved 2007-02-05. 
  72. ^ Seminoff, J.A. (2004). Chelonia mydas. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on August 31, 2007.
  73. ^ CITES (2007-05-03). "Appendices" (SHTML). Convention on International Trade in Endangered Species of Wild Flora and Fauna. http://www.cites.org/eng/app/appendices.shtml. Retrieved 2007-08-31. 
  74. ^ UNEP-WCMC. "Chelonia mydas A-301.003.002.002". UNEP-WCMC Species Database: CITES-Listed Species. United Nations Environment Programme - World Conservation Monitoring Centre. http://sea.unep-wcmc.org/isdb/CITES/Taxonomy/tax-species-result.cfm?displaylanguage=eng&Genus=Chelonia&Species=mydas&source=animals&Country=&tabname=all. Retrieved 2007-08-31. 
  75. ^ Karmini, Niniek (27 November 2009). "Indonesia rejects Bali plan for turtle sacrifices". Associated Press. Archived from the original on 27 November 2009. http://www.webcitation.org/5lbCBnXAs. Retrieved 27 November 2009. 
  76. ^ "Selingan Turtle Island". Borneo: Journey Malaysia. Dolphin Diaries Travel Sdn Bhd.. 2007. http://www.journeymalaysia.com/MI_selinganturtleisland.htm. Retrieved 2007-09-16. 
  77. ^ Endangered Species Act.
  78. ^ "Grouped Species Action Plan: Grouped plan for marine turtles". UK Biodiversity Action Plan. UK Joint Nature Conservation Committee. 2006. http://www.ukbap.org.uk/ukplans.aspx?ID=335. Retrieved 2007-09-16. 
  79. ^ "Ascension Conservation". Ascension Conservation, Wildlife. Ascension Conservation. 2007. http://www.ascensionconservation.org.ac/wildlife.htm. Retrieved 2007-09-16. 
  80. ^ Karumbé
  81. ^ "History: 1989". Cayman Turtle Farm. http://www.turtle.ky/history-history. Retrieved 9 April 2012. 
  82. ^ "Turtle release set". Caymanian Compass. 23 October, 2007. http://www.compasscayman.com/caycompass/2007/10/24/Turtle-release-set/. 
  83. ^ Fuller, Brent (18 November 2011). "Little turtles swimming for it". Caymanian Compass. http://www.compasscayman.com/caycompass/2011/11/18/Little-turtles-swimming-for-it/. 
  84. ^ Bell, Catherine; Parsons J, Austin TJ, Broderick AC, Ebanks-Petrie G, Godley GJ (25). "Some of them came home: the Cayman Turtle Farm headstarting project for the green turtle Chelonia mydas". Oryx (Fauna & Flora International) 39: 137–148. doi:10.1017/S0030605305000372. 
  85. ^ Connolly, Norma (2 June 2011). "More turtles nesting in Cayman". Caymanian Compass. http://www.compasscayman.com/caycompass/2011/06/02/More-turtles-nesting-in-Cayman/. "five turtles with tags from the Cayman Turtle Farm were observed nesting on Seven Mile Beach" 
  86. ^ Cayman Turtle Farm. "Cayman Turtle Farm Green Sea Turtle Releases". SeaTurtle.org. http://www.seaturtle.org/tracking/index.shtml?tag_id=112227. Retrieved 9 April 2012. 
  87. ^ Brammer, Jeff (16 October 2011). "What if the turtle farm went belly up?". Caymanian Compass. http://www.compasscayman.com/caycompass/blogs/whatifcolumn/What-if-the-turtle-farm-went-belly-up-/. "presenting disincentives to poachers due to the commercial availability of turtle meat" 
  88. ^ Connolly, Norma (2 June 2011). "More turtles nesting in Cayman". Caymanian Compass. http://www.compasscayman.com/caycompass/2011/06/02/More-turtles-nesting-in-Cayman. "(Quoted Ebanks-Petrie, Gina and Blumenthal, Janice of Department of the Environment, Cayman Islands)" 
  89. ^ "Tuvalu Funafuti Conservation Area". Ministry of Communication, Transport and Tourism – Government of Tuvalu. http://www.timelesstuvalu.com/tuvalu/export/sites/TTO/Attractions/funafuti_conservation_area.html. Retrieved 28 Oct. 2011. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Eastern Pacific populations of Chelonia are regarded by some authors as a distinct species, the black turtle, C. agassizii (King and Burke 1989); other authors (e.g., Ernst and Barbour 1989) retain agassizii as a subspecies of C. mydas (Kamezaki and Matsui 1995) or do not recognize it taxonomically at all (Crother et al. 2000). Phylogenetic analyses of mtDNA data by Bowen et al. (1992) yielded no evidence of matrilineal distinctiveness of agassizii. See Karl and Bowen (1999), Pritchard (1999), Grady and Quattro (1999), Shrader-Frechette and McCoy (1999), and Bowen and Karl (1999) for further debate about the taxonomic status of the black turtle.

The Australian flatback turtle, formerly known as Chelonia depressa, has been removed to its own genus, Natator (Zangerl et al. 1988, Limpus et al. 1988). MtDNA data indicate a fundamental phylogenetic split distinguishing all green turtles in the Atlantic-Mediterranean from those in the Indian-Pacific oceans (Bowen et al. 1992).

Most regional populations of Chelonia mydas are genetically distinct (Bowen et al. 1992). Florida population is characterized by unusually high mtDNA diversity (Allard et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!