Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

General Description

A medium-sized (3.2-3.6 cm wingspan) light grey or grey-brown (rearely pink) moth with white hindwings. Markings on the forewing obsolete or nearly so, except for the orbicular spot, which is frequently outlined in part at least with dark scales, and the renifom, which is filled with dark scales in the lower half. The postmedian line is usually indicated by a series of small dark dots, and the terminal area, including the fringe, is darker than the remainder of the wing. The hindwings are shining white, with some light brown shading forming a narrow terminal band. There is some brown scaling along the veins, including the discal bar. Closely related to E. quebecensis, which has dark hindwings and longer saccular extensions (.7-.9x length of harps, vs .3-.6x in scandens). Superficially similar to both Agrotis vetusta and Platyperigea montana, which have very different types of genitalia.  Euxoa scandens belongs to the subgenus Pleonectopoda, characterized by the prominent twist or subbasal coil in the vesica of the male. There are no characters that can be used to identify females as members of the subgenus. Keys to the subgenus and species are presented in Lafontaine, 1987. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Newfoundland south to Massachusettes west to Alberta, north to the Northwest Territories and south to central Montans and central Utah. In Alberta, they have been recorded from the foothills (Nordegg) and from the southern edge of the boreal forest (Opal and Redwater) south.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Dry sandy areas; including dunes and beaches.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Sweet clover (Meliotus sp.), various vegetable crops and the leaves of young trees. (Lafontaine, 1987)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing in Alberta June to late August; main flight in the latter half of July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

There is a single brood each year. The larvae (white cutworms) are climbing cutworms. The adults come to light. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euxoa scandens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTCGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCATTAACTTTACTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCCCATAGAGGAAGATCTGTAGATCTTGCTATTTTTTCCTTGCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACCGCATTTTTATTATTATTATCTTTACCCGTTTTAGCTGGAGCTATTACAATACTTTTAACAGATCGAAATTTAAATACATCTTTCTTTGACCCTGCGGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euxoa scandens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

A common, widespread and occasional pest species; no concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!