Articles on this page are available in 1 other language: Spanish (15) (learn more)

Overview

Distribution

Geographic Range

Caiman crocodilus, the spectacled, common, or brown caiman, is a crocodilian native to northern South America, Central America, and certain parts of the Caribbean. They are native to the following countries: Brazil, Colombia, Costa Rica, Ecuador, El Salvador, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama, Peru, Suriname, Trinidad, Tobago, and Venezuela. They have been introduced into Florida, Cuba, and Puerto Rico.

Biogeographic Regions: nearctic (Introduced ); neotropical (Native )

  • Ross, C. 1989. Crocodiles and Alligators. New York, New York: Facts on File, Inc..
  • Bartlett, R., P. Bartlett. 2003. Reptiles and Amphibians of the Amazon. Gainesville, Florida: University Press of Florida.
  • Kohler, G. 2003. Reptiles of Central America. Offenbach, Germany: Herpeton.
  • Crocodile Specialist Group, 1996. "Caiman crocodilus" (On-line). Accessed November 10, 2009 at http://www.redlist.org/apps/redlist/details/46584/0.
  • University of Southern Mississippi, 2009. "“CAIMAN CROCODILUS (LINNAEUS)”" (On-line). Accessed October 21, 2009 at http://nis.gsmfc.org/nis_factsheet.php?toc_id=207#impacts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Mexico, Central and much of South America; apparently occasionally vagrant to Grenadines (Schwartz and Henderson 1991). Introduced and reproducing in south Florida (Ashton and Ashton 1985). Largest known breeding population in Florida is at Homestead Air Force Base, Dade County; breeding populations probably occur also in western Dade County; juveniles and adults have been observed in Ft. Lauderdale, Broward County; low resistance to cold probably will prevent spread of currently established populations northward to areas that experience routine freezes (Brandt and Mazzotti 1990). Introduced also in Puerto Rico and Isla de la Juventud. Recorded also in Virginia (Mitchell 1994; D'Alessandro and Ernst 1995, Herpetol. Rev. 26:212-214).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America Caribbean South-America North-America
Distribution: Brazil, Colombia, Costa Rica,  Ecuador, El Salvador, Guatemala, Honduras,  Mexico, Nicaragua, Panama, Peru (Pasco etc.),  Surinam, French Guiana, Guyana, Tobago, Trinidad,  Venezuela, Bolivia Cuba (introduced), Isla de Juventud (=Isla dePinos; introduced), Puerto Rico (introduced), Lesser Antilles (introduced ?), USA (introduced to Florida)  
Type locality: unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Spectacled caimans are small to medium-sized crocodilians generally 1.5 to 2.1 meters in length. Historically, maximum reported length was 3 m. At current levels of exploitation, few specimens exceed 2.5 m in length. Females are smaller than males. Average adults are a dull olive to nearly black in color with variable yellow or black crossbands. They have long snouts and their fourth mandibular tooth is not visible from the outside of their closed jaw. Juveniles are yellowish in color with darker bands and spots. A feature that helps to distinguish Caiman crocodilus from other, sympatric crocodilians is the presence of a bony infra-orbital bridge between the eyes. Subspecies vary in color and skull size.

Range mass: 7 to 58 kg.

Average mass: 40 kg.

Range length: 1.5 to 3 m.

Average length: 2 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 264 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spectacled caimans are found in freshwater habitats as well as some salt water habitats. Rivers and wetlands, usually slow moving water, are preferred. They are found in both deep and shallow water, as they only need enough depth to submerge their bodies.

Range elevation: 800 (high) m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Ponds, creeks, rivers, marshes, and drainage canals (Behler and King 1979); occasionally in brackish estuaries (Schwartz and Henderson 1991). In Suriname, swamp-bordered river parts usually had higher population densities than did forest-bordered river parts; most juveniles and subadults found in area with much aquatic vegetation; dispersed into inundated swamps during high water (Ouboter and Nanhoe 1988).

Eggs are laid in a mounded nest of soil and vegetation (Behler and King 1979), at times some distance from water (Schwartz and Henderson 1991). In Brazil, nested in forest and on floating grass mats (Campos 1993). In Costa Rica, nested in forest adjacent to rivers or canals (Allsteadt 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Spectacled caimans are carnivorous generalists. Prey items change as they grow from smaller to larger caimans. Prey can include insects, snails, shrimp, crabs, fish, lizards, snakes, turtles, birds, and mammals. Spectacled caimans have at least 105 prey items reported in their diet. Cannibalism can occur, especially under drought conditions, when many caimans of different sizes are concentrated in small areas. However this species can be surprisingly unaggressive and tolerant of temporarily dense concentrations during the dry season.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; terrestrial non-insect arthropods; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Insectivore , Eats non-insect arthropods, Molluscivore , Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats fish, amphibians, reptiles, small birds and mammals, snails, crabs and other crustaceans, and insects; diet may shift seasonally and ontogenetically (Behler and King 1979, Herpetologica 49:108).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Spectacled caimans are predators of aquatic invertebrates, fish, and other aquatic and shoreline vertebrates. In their native range they are important members of riparian shoreline and aquatic communities. Where spectacled caimans have been introduced outside of their normal range, spectacled caimans may have unpredictable, perhaps deleterious effects on prey species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

During nesting time, tegu lizards (Tupinambis sp.) can destroy up to 80% of caiman nests in some places. Coatis (Nasua narica) and foxes also raid nests. Juveniles are eaten by large fish, wading birds, large snakes, and other crocodilians. Adult spectacled caimans are able to defend themselves from most potential predators, except humans.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Caiman crocodilus preys on:
Arapaima gigas

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurrences but the actual number is unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Presumably over 10,000 individuals rangewide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Under certain favorable conditions, up to 80+ caimans observed per stream km in Suriname; relatively sedentary; for individuals relocated after intervals of up to 1 year, greatest movement was 3 km (Ouboter and Nanhoe 1988).

In Brazil, flooding of nests and predation were the major mortality agents of eggs (Campos 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Spectacled caimans use taste, touch, sound, and visual senses for social and reproductive communication. The ability to detect vibrations in the water may aid in prey detection.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Some weeks after courtship and copulation, with internal fertilization, females lay their oval, hard-shelled eggs in a newly made mound of leaf litter and other vegetation. Once the eggs are laid, the female will cover the nest. Females, and sometimes males, guard their eggs against nest predators. Temperature influences sex determination during incubation. An average nest temperature of 30 degrees C will produce mostly females and 34 degrees will produce mostly males. After an incubation period of 65 to 104 days the babies will hatch out of their eggs and move to the nearest water, with some help from their parents. Once the juveniles have hatched, they will stay near their parents for about 1.5 years. Juveniles then grow to adult size at around 1.2 to 1.4 meters in length. Once juveniles reach minimum adult size, they are able to reproduce. If they survive long enough, they can continue to grow until reaching a size that may exceed 2.4 meters.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is very little known about the lifespan of Caiman crocodilus. The longest known lifespan in the wild was estimated at about 60 years old. However, 30 to 40 years might be more normal. The average captive lifespan is 20 years, with a minimum record of 24 years.

Range lifespan

Status: wild:
60 (high) years.

Range lifespan

Status: captivity:
24 (high) years.

Typical lifespan

Status: wild:
30 to 40 years.

Average lifespan

Status: captivity:
20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating typically occurs in the wet season from April to August, depending on local climatic conditions. Males can breed with multiple females and females can breed with multiple males. Courtship behavior involves prospective mates swimming together, rubbing backs, bellowing, touching snouts, circling each other, and bubble-blowing. Both sexes use these behaviors to attract their mates. After a female mates with a male she will build a nest in the males territory. There, the male and female will guard the nest, eggs, young, once they are hatched.

Mating System: polygynandrous (promiscuous) ; cooperative breeder

Spectacled caimans reach sexual maturity at sizes of about 1.2 meters for females and 1.4 meters for males, corresponding to from 4 to 7 years old. Social status affects growth rate and reproduction. Some younger, smaller caimans will be unable to mate because of social stress because of the presence of larger, more dominant caimans. Courtship and copulation occurs between May and August. Eggs are laid from July to November, depending on local climatic conditions. Females lay from 10 to 30 eggs. Incubation usually requires between 65 and 104 days. Sex is determined by temperature in the nest about midway through incubation. The decomposing vegetation in the nest, which may be a meter high and 2 meters in diameter, may help retain temperatures at the proper level. After hatching, the parents may excavate the juveniles from the nest and help them out of the eggshell. Once emerged, juveniles stay near their parents for approximately 1.5 years, receiving some protection from predators.

Breeding interval: Spectacled caimans breed for about four months during the wet season each year.

Breeding season: Spectacled caimans breed from May through August.

Range number of offspring: 10 to 40.

Average number of offspring: 22.

Range gestation period: 65 to 104 days.

Range birth mass: 46 to 55 g.

Average time to independence: 1.5 years.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Average age at sexual or reproductive maturity (female): 6 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

After copulation, females, sometimes assisted by males, build a nest out of leaf litter. Females lay their eggs in the nest and then cover it with more leaf litter. Females, and occasionally males, guard the nest from predators until they hear the babies call with grunt-like squeaks. Females then help uncover eggs and break the shells open to get the juveniles out. At that point, juveniles stay near their mother, and sometimes within the male parent's territory, for around 1.5 years for additional protection from predators. The parents may incidentally provide some food scraps for the juveniles but, for the most part, juvenile caimans catch food for themselves. After about 1.5 years with their parents, juveniles disperse from their parent's territory. In some situations, young caimans remain closer to their parents for longer periods.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the Venezuelan llanos, nests in the wet season, mid-August to late October; eggs hatch late December-early January (see Fitch 1982, Thorbjarnarson 1994). In Costa Rica, nested during early wet season; eggs hatched in September and October; typically, parent caimans opened nests to release young; flooding was a major cause of embryonic mortality (Allsteadt 1994). Clutch size averages usually about two dozen. and Henderson (1991), incubation lasts about 75 days; female (and male?) remains in vicinity of nest throughout incubation. Sex of hatchlings is determined by incubation temperature. In Costa Rica, siblings often remained together for over 1.5 years (Allsteadt 1994). In Venezuela, males and females attained sexual maturoty in about 7 years, though small mature males may not have reproduced because of social factors); an average of 54% of adult-size females nested annually, with reproductive output increasing with size (Thorbjarnarson 1994). In central Amazonia, Brazil, females probably reached sexual maturity at between five and six years of age (Magnusson and Sanaiotti, Copeia 1995:498-501).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caiman crocodilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCGCTGATTCTTCTCCACAAACCACAAAGACATTGGCACCCTCTACTTTATCTTCGGAACCTGGGCCGGAATAGTAGGAACAGCACTTAGCCTCCTCATCCGAACAGAACTAAGCCAGCCCGGACCCCTCCTGGGAGAC---GACCAAATCTACAACGTAATTGTTACCGCCCACGCTTTCATTATAATCTTTTTTATAGTAATACCCGTCATGATCGGCGGATTTGGAAACTGACTCCTCCCCTTAATAATTGGAGCCCCAGACATGGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCTTTCACACTACTGCTTGCCTCCTCTTGCATTGAAGCAGGAGCTGGAACAGGATGAACCGTCTACCCCCCTCTAGCCGGAAACCTAGCTCACGCCGGACCATCCGTAGACTTAACAATCTTCTCACTACATCTTGCCGGAGTATCCTCTATCCTAGGAGCAATCAACTTCATTACAACAGCCATCAACATAAAACCCCCAGCCATATCCCAATACCAAACACCACTATTTGTTTGATCTGTCTTAATCACAGCCGTACTCCTCTTGCTAGCCCTACCGGTACTAGCCGCTGGAATTACTATACTACTCACAGACCGAAACTTAAACACAACTTTCTTTGACCCTGCGGGAGGAGGAGACCCTATCCTATACCAACACCTTTTCTGATTCTTTGGCCACCCCGAAGTTTATATTCTCATCCTACCAGGATTCGGAATCATCTCACACGTGGTCACTTACTACTCAGGTAAAAAAGAACCATTCGGCTATATAGGAATAGCTTGAGCTATAATATCTATTGGATTCCTAGGATTCATCGTCTGAGCTCACCACATGTTTACCGTTGGAATAGACGTTGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caiman crocodilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

Justification
Probably numbers in the millions, widely distributed throughout range, although locally depleted or extirpated in some localities.

History
  • 1988
    Threatened
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Threatened
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In 1986 and 1988 spectacled caimans were listed by the United States Fish and Wildlife Service as a threatened species. This was due to increased hunting pressure on their populations. Caimans are heavily harvested for their skins to make leather products. The pet and curio trade has also had some degree of responsibility for local population declines. Spectacled caiman populations are still relatively stable in some parts of their range, although they are severely depleted or extirpated in many local areas, especially near human population centers.

US Federal List: threatened

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Wide range in the subtropical and tropical regions of the New World; introduced and established in Florida; probably declining in many areas from due to habitat loss/degradation and excessive exploitation by humans, but supporting documentation is not available for most areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Comments: Trend is unknown, presumably declining in areas experiencing wetland losses and excessive human exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Endangered by persistent hunting in the Caatinga of northeastern Brazil (Olmos and Souza 1991). Also in Brazil, threatened by destruction of floating grass mats by introduced water buffalo; caiman uses mats for nesting (Campos 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I (Caiman crocodilus apaporiensis) and Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: At least several protected occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Spectacled caimans are potentially dangerous to humans and pets, and they occasionally attack livestock. Their smaller size compared to other crocodilians makes them less of a threat. They become shy and avoid humans in areas where they are frequently hunted. Spectacled caimans have been introduced outside their natural range, such as in southern Florida, and possible negative effects on local naive wildlife are in need of study.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Within their native range, spectacled caimans are usually the most abundant crocodiles and are the most heavily harvested species by humans for the hide industry.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: In 1979, santioned trade exceeded 500,000 skins, essentially all of which resulted from hunting of wild populations (Magnuson 1984). See Thorbjarnarson (1999) for a discussion of the limits to sustainable use of crocodilians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spectacled Caiman

Spectacled Caiman!<-- This template has to be "warmed up" before it can be used, for some reason -->

Teleostomi

The spectacled (White or common) caiman (Caiman crocodilus) is a crocodilian reptile found in much of Central and South America. It lives in a range of lowland wetland and riverine habitat types and can tolerate salt water as well as fresh; due in part to this adaptability it is the most common of all crocodilian species. Males of the species are generally between 2 and 2.5 meters, while females are smaller, usually around 1.4 meters[1]. The species' common name comes from a bony ridge between the eyes, which gives the appearance of a pair of spectacles[2]. They have been known to change color. During colder weather the black pigment, found within their skin cells, will expand making them darker[3].

Contents

Reproduction

The Spectacled Caiman will reach sexual maturity any where from 4 to 7 years. Usually the more dominant individuals will mature more quickly[4]. They will gather and mate during the dry season. After mating season ends the females will build nests out of dense vegetation. The size of the nest varies depending on the resources available to the female [5]. Each female can lay up to forty eggs[6]. The larger females have recently been found to lay eggs that are larger than the eggs smaller females lay [7]. Most Caimans will nest during the wet season. It is very unusual to see a Caiman nest during any winter months. The temperature is too low for the eggs[8].

Temperature is important to the developing eggs. Females will build their nests in a way that insulates them from extreme temperature changes. The nests are made of vegetation. as the vegetation decays the nests produce heat which can keep the eggs about five degrees warmer than if they were insulated by mud alone[9]. Temperature not only incubates the eggs, but also determines the sex of the developing Caiman. Caiman do not possess the genes necessary to determine sex. They depend on temperature. When the temperature inside the nest is approximately 31 degrees Celsius, or lower, the Caiman will become male. However, when the temperature is approximately 32 degrees Celsius or higher they become female[10]. Young Caiman do not hatch with the dark green coloring of their parents. They are yellow with black spots. This coloration will eventually fade away[11].

Spectacled caiman have strongly protective maternal behaviour. They raise their young in crèches, one female taking care of her own as well as several others' offspring [12]. They will take care of their young for the first two to four months after the eggs hatch. This is the time it takes for the floods of the wet season to subside[13].


Conservation: Problems and Solutions

This species benefits from over-hunting of competitive species who ocupy the same home range. This allows them access to resources normally would have been lost to these other species[14]. Their skin is not wanted for leather production because their skin contains osteoderms. The only skin on their body which does not contain osteoderms are their sides. Therefore hunting of this species is relatively low[15]. In most countries hunting this species is legal. Venezuela permits hunting every fall providing the number of kills does not exceed 150,000 for that season[16]. The skin that is salvageable, will be harvested. It is commonly found sold in the American market, sometimes mislabeled asAlligator mississippiensis[17].

There are about four million Common Caiman found in Venezuela. Recent surveys show that the population is expected to continue to increase[18]. This is an example of how well the species is able to adapt[19]. However, it is difficult to determine how well the species is doing on a global scale since populations are not doing well in other countries including Peru[20] and El Salvador. Despite being commonly mistaken as this species, the incredibly large population of caiman living within the Brazilian Pantanal, are a separate species, the Yacare Caiman. More up-to-date surveys are required for clarification, and to examine the interactions between the different subspecies. Further taxonomic work would make control measures easier to implement, as currently identification of different subspecies can be difficult. The major threat to this species and its subspecies is currently illegal hunting. Smuggling rings operating through Thailand and Singapore are extremely damaging to individual populations, and greater control measures and more effective legislation are needed.

According to the Crocodilian Species List: "Thesubspecies C. c. apaporiensis is under severe threat in Colombia. Feral populations of C. crocodilus are creating problems for other species of crocodilians and native wildlife, however. These populations have become established in three countries. The introduced population in Cuba is thought to have been primarily responsible for the dramatic decline and probable disappearance of Crocodylus rhombifer from the Isla de la Juventud."[21]


Conservation programs are utilized in many countries. The most common form of conservation is the use of cropping, or manually the reducing numbers of several wild, and abundant species. Long-term effects have yet to be discovered, more surveys have been recommended[22]. There are also Farming or ranching programs, however, they seem to be more expensive and possibly less effective[23].

Diet

Caimans eat a variety of invertebrates (insects, crustaceans, mollusks). The larger caimans will eat fish and water snails[24]. Older animals are capable of taking larger, mammalian prey (e.g. wild pigs). Observations show that as conditions become drier, caimans stop feeding. In areas where this species has become depleted, fish populations have also shown a decline. Until recently, it was thought that the Caiman crocodilus would over eat the fish and snail populations[25]. Some sugest that they control piranha numbers. However, Piranha's have not been found to be a normal meal [26]. TheC. yacare does demonstrate this particular dietary preference. In reality, it is likely that C. crocodilus is very much a generalist and adaptive predator, given its ecological success. They are virtually harmless to humans, although they may bite if harassed.

References

  1. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  2. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  3. ^ Alderton, D."Common Caiman Caiman crocodilus.'Crocodiles and Alligators of the World.Facts on File.inc. 1998. 131-135.
  4. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  5. ^ Magnusson, W.E. Vliet, K.A. Pooley, A.C. and Whitaker, R. "Reproduction." Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989. 118-124.
  6. ^ Alderton, D."Common Caiman Caiman crocodilus.'Crocodiles and Alligators of the World.Facts on File.inc. 1998. 131-135.
  7. ^ Campos, Z. Magnusson, W. Saniotti, T. and Coutinho,M. "Reproductive trade-offs in Caiman crocodilus and Caiman crocodilus yacare: implications for size related management quotas"Herpetological Journal.Vol. 18 Issue 2. April 2008. 91.
  8. ^ Magnusson, W.E. Vliet, K.A. Pooley, A.C. and Whitaker, R. "Reproduction." Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989. 118-124.
  9. ^ Magnusson, W.E. Vliet, K.A. Pooley, A.C. and Whitaker, R. "Reproduction." Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989.121.
  10. ^ Lang, J.W. "Sex Determination."Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989. 120.
  11. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  12. ^ Life in Cold Blood: Giants
  13. ^ Magnusson, W.E. Vliet, K.A. Pooley, A.C. and Whitaker, R. "Reproduction." Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989. 124.
  14. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  15. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  16. ^ Alderton, D."Common Caiman Caiman crocodilus.'Crocodiles and Alligators of the World.Facts on File.inc. 1998. 131-135.
  17. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  18. ^ Alderton, D."Common Caiman Caiman crocodilus.'Crocodiles and Alligators of the World.Facts on File.inc. 1998. 131-135.
  19. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  20. ^ Alderton, D."Common Caiman Caiman crocodilus.'Crocodiles and Alligators of the World.Facts on File.inc. 1998. 131-135.
  21. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  22. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  23. ^ Britton, A. "Caiman Crocodilus (Linnaeus, 1758). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_ccro.htm.2009.
  24. ^ Ross,C.A. and Magnusson, W. E. "Living Crocodilians."Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989.58-73.
  25. ^ Ross,C.A. and Magnusson, W. E. "Living Crocodilians."Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989.58-73.
  26. ^ Ross,C.A. and Magnusson, W. E. "Living Crocodilians."Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989.58-73.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Busack and Pandya (2001) examined geographic variation in morphology in Caiman crocodilus and found basis for the recognition of subspecies, and they concluded that C. yacare should not be regarded as a subspecies of C. crocodilus. See Densmore and White (1991) for a phylogeny of the Crocodylia based on molecular data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!