Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Brief Summary

The worm lizard Bipes biporus is an amphisbaenian, a type of elongate burrowing reptile that is often pink and wormlike in appearance. Bipes is the only amphisbaenian genus with limbs; in particular, members of this genus have small but well developed forelimbs. This genus is also the only squamate taxon in which the forelimbs are better developed than the hind limbs. As a species, B. biporus always has five digits on each limb, its head is blunt, and it burrows in sandy desert soils on the peninsula of Baja, California. Its tail is short and autotomic, although once it is lost it will not regenerate. This species exhibits no external sexual dimorphism. Like other amphisbaenians, its skin is marked with ringlike annuli, contributing to its wormlike appearance.

Bipes biporus is a generalist predator that preys primarily on invertebrates, especially arthropods. This species lives in self-constructed tunnels in the soil and, although it typically resides close to the surface, it rarely emerges from underground. As a result, its most likely predators are snakes, which are well suited to enter and navigate its underground burrow systems. Bipes biporus is active year-round, due in part to its capacity for behavioral thermoregulation. This species moves primarily by lateral undulation and concertina locomotion, techniques common among fully limbless reptiles, although it may use its forelimbs to assist in locomotion. Reproduction in this species is oviparous and biennial, with females laying small clutches of one to four eggs every other year.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Baja California peninsula of Mexico, where it ranges from extreme southwestern Baja California State through western Baja California Sur, to the Isthmus of La Paz and the western Cape Region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bipes biporus occurs on the western half of the peninsula of Baja, California, bordered on the east by the Peninsular Ranges. This species’ range extends from the southern tip of the peninsula at Cabo San Lucas to the northern edge of the Vizcaíno Desert and Magdalena Plain (Papenfuss 1982, Grismer 2002).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Middle-America
Distribution: Mexico (W Baja California Sur)  
Type locality: ‘‘Cape San Lucas, Lower California’’ (= Baja California, Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Due in part to poor external differentiation between the head and the rest of the body, morphological studies of amphisbaenians tend to focus not on head anatomy but on the number of annuli, or rings of juxtaposed rectangular scales that encircle the body and tail. Bipes biporus has two dorsal annuli per vertebra, for a total of 242-261 dorsal annuli “from the first postoral annulus up to and including the dorsal annulus above the ventral annulus bearing the preanal pores” (Papenfuss 1982). There are 89-109 fewer ventral annuli than dorsal annuli, and this number does not appear to be proportional to the number of dorsal annuli. The lateral annuli, defined as the dorsal annuli above the cloacal region “between the dorsal annulus above the preanal pores and the first complete caudal ring posterior to the cloaca” (Papenfuss 1982), number 2-6 in this species, and may occur in different numbers on the left and right sides of the same individual. Individuals with non-autotomized tails have 24-31 caudal annuli, which are the annuli between the posterior end of the cloaca and the last annulus with regular segments. The midbody annuli of this species contain 27-32 dorsal segments and 24-30 ventral segments, and the tail comprises 9.5-10.5% of the total body length (Papenfuss 1982).

Individual Bipes biporus in the Vizcaíno Desert at the northern end of this species’ range tend to have significantly fewer dorsal and ventral annuli than those in more southern localities like La Paz. While this difference could be influenced by genetic factors, it is more commonly thought to be a response to an environmental gradient, as temperature has been shown in closely related species to affect the number of vertebrae in an individual, which could influence annuli counts (Papenfuss 1982).

Bipes biporus has a nonretractable tongue with filamentous papillae. The dorsal surface of the tongue is covered with diagonal rows of lingual scales, which have smooth posterior edges. The skull includes nasal, frontal, and parietal bones, as well as a single, large premaxillary bone. There are no postorbital or squamosal bones in this species. The pterygoid lacks teeth, and the marginal dentition is pleurodont. The forelimbs of this species are large and molelike, with five well-developed, claw-bearing digits. While this species has a well-developed pectoral girdle, it lacks clavicles and an interclavicle. Its pelvic girdle is reduced, and it lacks hind limbs. Tail autotomy occurs in this species and all other members of the family Bipedidae. Members of the genus Bipes can lose their tail only once, as there is a single point, anterior to the transverse processes of a particular caudal vertebra within ten caudal annuli of the cloaca, at which intravertebral autotomy can occur. After autotomy, the tail heals but is not regenerated. Tail autotomy is less frequent in B. biporus than in the other two members of its genus, but in each of these species tail loss appears to increase with age. Juveniles of this species are light pink in color, turning to white as adults. Bipes biporus exhibits no external sexual dimorphism (Papenfuss 1982).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Bipes biporus is small to moderate in size. Adults of this species average 190-210 mm in snout-vent length (SVL) and may reach 240 mm in total length. In general, the tail of this species comprises about 9.5-10.5% of the total body length (Papenfuss 1982, Grismer 2002).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The genus Bipes is easily identified, as it is the only amphisbaenian genus to possess external limbs. Bipes biporus in particular can be distinguished from its congeners by the number of claws (B. biporus has five, B. canaliculatus has four, and B. tridactylus has three) and the number of preanal pores located on the flanks (B. biporus has two, while its congeners each have at least six). Tail length can also be a useful diagnostic character: within the genus Bipes, the tail of B. biporus is the shortest, the tail of B. tridactylus is the longest, and the tail of B. canaliculatus is of intermediate length (Papenfuss 1982, Grismer 2002).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 8568
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21325
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Bipes biporus
Catalog Number: USNM 21324
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Lectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21323
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21322
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21321
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21320
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21317
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 21316
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Bipes biporus
Catalog Number: USNM 12599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1882
Locality: La Paz, Baja California Sur, Mexico
  • Paralectotype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.; Syntype: Cochran, D. M. 1961. United States National Museum Bulletin. (220): 110.; Cope, E. D. 1894. American Naturalist. 28: 436, figure 5a-e.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This fossorial species requires areas with sandy soils with abundant leaf litter; it is rarely seen on the surface. The general habitat in its area of distribution is dryland and desert, with xeric shrub vegetation. Animals are often collected close to fenceposts, and populations are believed to be able to survive in moderately disturbed landscapes. They construct an elaborate system of burrows just below the surface, usually centered on stands of vegetation.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bipes biporus inhabits sandy, compact soil, such as that found in the Vizcaíno Desert and Magdalena Plain of Baja, California. Individuals construct shallow tunnel systems which typically occur within the top 4 cm of sand; indeed, Papenfuss (1982) found 165 of 253 individuals sampled within the top 2.5 cm of soil, although they have been observed as deep as 15 cm below the surface. Within its genus, B. biporus tends to burrow closer to the surface than B. canaliculatus or B. tridactylus (Papenfuss 1982). This species may prefer to burrow close to stands of vegetation, and it is thought to be tolerant of moderate habitat disturbance (Hollingsworth and Frost 2007).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bipes biporus is a generalist arthropodivore, preying most commonly on ants and termites but also eating a wide variety of other terrestrial and fossorial invertebrates. This species consumes both soft- and hard-bodied invertebrates with body sizes smaller than its gape, and the stomach contents of different individuals have been observed to contain both large numbers of small prey and small numbers of large prey. While it is likely that B. biporus bites its prey as a means of capture or ingestion, evidence that it can chew or bite off pieces of larger prey items is scarce (Kearney 2003a).

Bipes biporus rarely leaves its burrows, and this subterranean lifestyle allows it to avoid many predators that would have to enter or excavate its burrows in order to reach it. Snakes are this species’ most likely predators because their body form allows them to enter and navigate its burrows with relative ease. Some mammalian predators may be able to reach this species’ burrows by digging, but it likely avoids most of them by burrowing deep underground at night (Kearney 2003a).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Based on a collection of 103 adults and 168 juveniles of this species, Papenfuss (1982) estimated that, although male and female Bipes biporus are about equally common at the juvenile stage, the ratio of adult females to adult males appears to be approximately two to one. The causes of this gender imbalance remain unknown, but could include differential mortality, sampling bias, or a skewed primary sex ratio.

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Tunnel Construction

Bipes biporus constructs its own burrows, digging at first by alternately extending and flexing its forelimbs. After creating an initial opening in the substrate, its folds its limbs into grooves behind the pectoral girdle, and completes the rest of the burrow by using the strongly ossified head to compress the soil into tunnel walls through a series of dorsal and ventral strokes (Dial et al. 1987).

Thermoregulation

Burrowing species like B. biporus were once thought to have little capacity for thermoregulation because they derive their body temperature from the ambient soil, and indeed the closely related B. tridactylus appears unable to thermoregulate behaviorally. However, research has shown that B. biporus regulates its body temperature by moving between tunnel segments that vary in temperature depending on depth, soil composition, and sun exposure. Papenfuss (1982) found that, especially during the early morning, this species is most likely to be found in shallow tunnels under sunlit patches of ground, retreating deeper into the ground once the near-surface temperature exceeds its preferred body temperature. This behavioral thermoregulation likely contributes to the ability of this species to remain active year-round, by burrowing down into cooler, moister soils in hot, dry summers, or by remaining near the warmer soil surface in cool winters (Papenfuss 1982, Dial et al. 1987).

Locomotion

Bipes biporus appears to move primarily by lateral undulation and concertina locomotion, although it is also capable of rectilinear movement (Gans 1978). Concertina locomotion, which is characterized by alternate extension and re-bending of S-shaped body coils from a momentarily stationary base, is found in many other reptiles and may be the most basal type of limbless reptilian locomotion. However, B. biporus and its congeners are unique among reptiles in that they combine concertina locomotion with alternate flexion and extension of the limbs. The limbs are extended to fix or stabilize the anterior portion of the body, and flexed to propel it forward. Concertina locomotion also seems to be energetically inexpensive for B. biporus, as the intensity of muscle contraction is sufficiently low that aerobic metabolism alone can replenish the oxygen consumed by this process (Dial et al. 1987).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Like the other two members of its genus, Bipes biporus is oviparous and lays eggs in small clutches of one to four. The mean clutch size per female is approximately two. Most female B. biporus reach sexual maturity around the age of 45 months, at a snout-vent length of approximately 185 mm. The female reproductive cycle in this species is likely biennial; that is, individual females reproduce only every other year. Eggs are laid in July, and hatchlings 90-109 mm in total length emerge in late September, during or just before the beginning of the rainy season (Papenfuss 1982).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Bipes biporus is one of three species in the genus Bipes; its two congeners are B. tridactylus and B. canaliculatus. This genus is in the family Bipedidae, whose phylogenetic placement relative to the three other amphisbaenian families remains controversial. A traditional morphological phylogeny placed the Bipedidae as the most basal amphisbaenian family, sister to all other amphisbaenians, which are united by the loss of external limbs (Kearney 2003b, Macey et al. 2004).

However, recent molecular studies have suggested an alternative phylogeny. A phylogenetic tree based on the two nuclear genes c-mos and RAG-1 placed the limbless family Rhineuridae as the most basal lineage, followed by Blanidae, with Bipedidae sister to the most derived families Amphisbaenidae and Trogonophidae (Kearney and Stuart 2004). Macey et al. (2004) derived a similar tree from complete mitochondrial DNA sequences. Thus, while morphological phylogenies tend to identify Bipedidae as the most basal amphisbaenian family, molecular data consistently place Rhineuridae as the sister group to all other amphisbaenians, with Bipedidae in a more derived position, sister to the clade formed by Trogonophidae plus Amphisbaenidae (Kearney 2003b, Kearney and Stuart 2004, Macey et al. 2004).

The molecular phylogeny yields two evolutionary hypothesis with respect to the evolution of limblessness in amphisbaenians. If Bipedidae, the only family with limbs, is not the most basal amphisbaenian family, then either limb loss must have occurred three times independently in amphisbaenians, or limb loss occurred just once basally, and limbs were re-evolved in the genus Bipes. Kearney and Stuart (2004) suggest that the first hypothesis, that limbs were lost repeatedly, is the more plausible of the two because there is no empirical evidence for the evolutionary regaining of whole limbs in tetrapods, whereas limb loss and reduction are relatively common in other reptile lineages. However, the second hypothesis, that Bipes re-evolved its forelimbs from a limbless ancestor, is not at all impossible. All other limb-reduced squamates first lose the forelimbs, then the hindlimbs. The genus Bipes is unique in that it is the only taxon for which the forelimbs are better developed than the hindlimbs, suggesting that the re-evolution of forelimbs in Bipes may have been possible (Kearney and Stuart 2004).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

The middle ear of most amphisbaenians consists of two elements: an osseous columella (or stapes) and a cartilaginous extracolumella, which connect to form a rod that conducts sound vibrations to the cochlear fluids. However, unlike most other species, the sound-receiving surface is not a specialized tympanic membrane but rather a particular area of skin. In Bipes biporus, this system is functionally identical to those of other amphisbaenians. however unlike in other amphisbaenians, in which the columella connects to the skin by an extracolumella made of bone or cartilage, the columella of this species is connected by fibrous tissue to the nuchal constriction, a deep fold of skin on the neck (Wever and Gans 1972).

Measurements of cochlear potential suggest that B. biporus has high auditory sensitivity relative to other amphisbaenians, which may be masked in some studies because this species’ auditory apparatus is located differently with respect to the head than in most other amphisbaenians. The auditory system of B. biporus seems to be most effective at sensing aerial sounds, especially those originating posterior to the head (Wever and Gans 1972).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Amphisbaenians are known to have novel mitochondrial genomic features. In particular, in addition to some unusual gene orders and repeats, Bipes biporus has an abnormal stem and loop structure between trnN and trnC, where light-strand replication is initiated. This structure has been associated with mitochondrial genomic rearrangement in other vertebrates (Macey et al. 2004).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Bipes biporus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGATTCTTCTCAACAAACCACAAAGACATCGGCACGCTGTACCTGTTGTTTGGCGCTTGAGCCGGAGCAGCTGGCACCGCCCTCAGCCTCCTAATTCGTGCCGAACTGGGCCAACCCGGCGCATTACTTGGAAAT---GACCAAATCTACAACGTCGTAGTAACCGCTCACGCATTCGTAATAATTTTCTTCATGGTCATACCAATTATAATCGGCGGGTTTGGAAACTGGCTCGTTCCCCTAATAATTGGCGCCCCAGATATAGCCTTTCCACGCATGAACAACATGAGCTTCTGACTGCTGCCACCATCACTACTGCTGCTGCTTGCTTCTGCCGGAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTGTACCCGCCACTGGCCGGAAACTTAGCACACGCCGGCCCATCCGTCGACCTGACCATCTTCTCGCTACACCTCGCCGGAGTGTCTTCAATCCTCGGTGCCATCAACTTCATCACCACCTGTATCAACATAAAACCACCACAAATATCACAGTACCAAACACCATTGTTTGTGTGGTCAGTTCTAATCACAGCCGTACTCCTCCTACTCTCTCTCCCCGTACTGGCCGCTGGTATTACAATACTACTCACCGACCGCAATATTAACACCTCATTCTTCGACCCATCAGGGGGCGGAGATCCCATCCTATACCAACACTTGTTTTGATTCTTTGGACACCCAGAAGTATATATCCTAATTCTCCCGGGCTTCGGGATAATCTCTCATATCGTAACCTATTACGCAGGAAAAAAAGAACCTTTTGGCTACATAGGCATGGTCTGAGCCATATTATCAATTGGCTTTCTCGGATTCATCGTATGGGCCCATCATATATTCACCGTAGGAATAGACGTAGACACCCGCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bipes biporus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hollingsworth, B. & Frost, D.R.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The IUCN Red List (2007) categorizes this species as Least Concern “in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category” (Hollingsworth and Frost 2007).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is probably a relatively abundant species, but it is secretive and is not often encountered. Papenfuss (1982) collected 2,719 specimens in an extensive study of the species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of this species are stable (Hollingsworth and Frost 2007).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be few major threats to the species, but in some places it is probably negatively by expanding intensive agriculture. Animals may be killed when encountered because of misidentification as snakes, and a fear that they attack humans. There is some collecting of animals, possibly for the pet trade, but this is believed to have a minimal impact on populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although Bipes biporus currently faces few major threats, its populations may be adversely affected by the expansion of intensive agricultural practices. Individuals may be killed due to misidentification as snakes, or due to popular yet unfounded fears that B. biporus will attack or parasitize humans. This species is also collected for use in the pet trade, but that is believed to have only minimal effects on its populations (Hollingsworth and Frost 2007).

Public Domain

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in the large Vizcaíno Biosphere Reserve, and in some other protected areas. It is protected by national legislation, with the NOM (2003) listing this species under the Pr category (special protection).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mexican mole lizard

The Mexican mole lizard (Bipes biporus), commonly known as the five-toed worm lizard, ajolote, or simply as Bipes, is a species of amphisbaenian, which is endemic to Baja California, Mexico. It is one of four species of amphisbaenians that have legs. Also it is one of only two non-extinct genera of reptiles to have only front limbs, with Jarujinia bipedalis.[citation needed] It should not be confused with the axolotl, a salamander (Ambystoma mexicanum), which is usually called ajolote in Spanish.

Description[edit]

They are pink, lizard-like reptiles, 18–24 cm (7.1–9.4 in) snout-to-vent length and 6–7 mm (0.24–0.28 in) in width, that live for one to two years. Their skin is closely segmented to give a corrugated appearance, and like earthworms, their underground movement is by peristalsis of the segments. The forelegs are strong and paddle-like, while the hindlegs have disappeared, leaving behind only vestigial bones visible in X-rays.

Reproduction[edit]

This species is oviparous and the females lay one to four eggs in July. The species only breeds underground. The eggs hatch after two months.

Geographic range[edit]

The Mexican mole lizard is found only in Baja California, Mexico.

Behavior[edit]

Like all other amphisbaenians, this burrowing species only surfaces at night or after heavy rain.

Diet[edit]

It is an opportunist carnivore and eats ants, termites, ground-dwelling insects, larvae, earthworms, and small animals including lizards. It usually pulls its prey down to the ground to start its meal.


References[edit]

  1. ^ Stejneger, L., and T. Barbour. 1917. A Check List of North American Amphibians and Reptiles. Harvard University Press. Cambridge, Massachusetts. 125 pp. (Bipes biporus, p. 72.)

Further reading[edit]

  • Cope, E.D. 1894. On the Genera and Species of Euchirotidæ. American Naturalist 28: 436-437. (Euchirotes biporus)
  • Stebbins, R.C. 2003. A Field Guide to Western Reptiles and Amphibians, Third Edition. The Peterson Field Guide Series. Houghton Mifflin. Boston and New York. xiii + 533 pp. ISBN 0-395-98272-3 (paperback). (Bipes biporus, pp. 428-429 + Plate 55 + Map 200.)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!