Overview

Comprehensive Description

Orectolobus halei Whitley, 1940 ZBK

(Figs. 4-6, Table 1-2)

Material examined

Holotype . SAMA 2883 mm TL female (cast), type locality: St. Vincent Gulf, South Australia . Lost according to Eschmeyer (CD-Rom, 1998).

Neotype (designated herein). AMS I 43628-002, 1700 mm TL, mature male, longline, type locality: the Hump, 3.3 nautical miles offshore between Garie Beach and Wollongong, 34° 14S , 151° 04E , 20-35 m, 9th June 2005 , collector Charlie Huveneers and Jason Moyce.

Other specimens examined. AMS I43628-001, 1285 mm TL, female ; CSIRO H 6278- 01, 1775 mm TL, female ; CSIRO H6278-02, 1869 mm TL, mature male ; AMS I43628- 003, 1520 mm TL, immature male. All four specimens collected using longline at the Hump, 3.3 nautical miles offshore between Garie Beach and Wollongong, 34° 14S , 151° 04E , 20-35 m, 9th June 2005 , collector Charlie Huveneers and Jason Moyce. AMS I43629- 001, 1140 mm TL, immature male, setline, Merimbula 50-100m from shore, 36° 54S , 149° 57E , 10-20 m, 24th April 2005 , collector Charlie Huveneers, Shannon Corrigan and Shannon Fantham.

Diagnosis

A large species of Orectolobus with the following combination of characters: no warty tubercles on head or body; four groups of dermal lobes below and in front of eyes on each side of head; no dermal lobes on chin; nasal barbel closest to mouth branched; five to six lobes in second preorbital group (rarely four) with lobes at extremities usually longer and branched; broad branched postspiracular groups; two supraorbital knobs; base of anterior postspiracular lobe 3.28-3.69 in its distance from postorbital group, 1.36-2.36 in its distance from posterior postspiracular lobe; pelvic-fin insertion at first dorsal-fin midpoint; prepelvic length 2.40-3.13 times pelvic-anal space; pelvic-caudal space 1.04-1.25 times trunk width; teeth in upper jaw 25-28, those in medial row at symphysis rudimentary; spiral valve turns 29-32; precaudal vertebrae count 108-112. Light and dark brown coloration with nine darker brown, blotch-shaped saddles located dorsally; each saddle has conspicuous black edges.

Description

Body depressed anteriorly from snout to pelvic-fin origin, slightly firm dorsal musculature with relatively flaccid flanks; trunk depressed, broadest over midtrunk; body shape changing from depressed to compressed and tapering from pelvic-fin origin; dorsal musculature slightly elevated from flank musculature forming a small ridge from the fifth gill slit to pelvic-fin insertion, decreasing anteriorly to first dorsal-fin origin. Head broad, strongly depressed, somewhat oval in cross-section with truncate anterior when viewed from above, length 21.4 (21.0-21.8) % TL, 2.08 (2.08-2.76) times second dorsal-fin origin to anal-fin origin, height at gill level 8.5 (7.3-9.1) % TL, 1.74 (1.33-1.74) in pelvicfin midpoint to first dorsal-fin insertion; trunk width 21.7 (20.4-23.0) % TL; abdomen elongate, width 5.94 (5.26-6.34) % TL. Pectoral-pelvic space 19.3 (16.8-21.9) % TL, 0.90 (0.73-1.00) times head length; pelvic-anal space 2.10 (1.93-2.50) times anal-fin base; snout-vent length 0.99 (0.99-1.04) times vent-caudal length. Caudal peduncle absent, lower origin of caudal fin almost connected to anal-fin insertion, strongly compressed, oval in cross section at anal-caudal junction, caudal peduncle width 1.59 (1.33-1.64) in height.

Snout short, narrowly rounded in lateral view, truncate in dorsoventral view, slightly rounded angles; preoral length 0.8 (0.8-1.2) % TL, 12.50 (8.33-12.50) in mouth width; prenarial length negligible. Eyes dorsal on head, small, slit-like, length 1.7 (1.5-1.8) % TL, 12.35 (12.35-12.99) in head length; supraorbital crest elevated over and behind eye; two knobs on supraorbital crest, posterior knob longer; weak supraorbital ridge extending above spiracle; subocular pocket 2.26-2.70 times eye length; interorbit weakly concave. Spiracles slit-like, oblique to horizontal axis, longer than eye, 1.99 (1.91-2.29) times eye length; anterior margin convex well elevated above weakly convex posterior margin; small eye spiracle space 0.4 (0.3-0.6) % TL; fold above spiracle anterior margin. Gill slits lateral on head, first three of similar length (2.2-3.0 % TL), fourth gill slit smaller, 0.94 (0.82-1.01) times third gill slit, last gill slit longest 1.17 (1.00-1.27) times first; last gill slit anterior to pectoral-fin midbase; pectoral-fin origin between second and third gill slit. Mouth subterminal, large 3.1 (2.9-3.3) % TL, horizontally expanded, broadly arched, width 10.7 (9.6-10.7) % TL, 3.47 (2.96-3.47) times its length, 4.76 (4.76- 5.26) in vent to caudal length; 0.96 (0.83-1.09) times dorsal-fin midpoint to pelvic-fin origin; upper labial furrows 4.3 (4.1-4.9) % TL, originating at ventral margin of nostrils; lower labial furrows longer 5.4 (4.6- 5.5) % TL, almost connected near symphysis of lower jaw. Nostrils small, widely separated, internarial space 5.4 (4.5-5.4) % TL, adjacent upper lip of mouth. Nasal barbel terminal on head, medial to nostrils, proboscis-like, rounded basally, tapering distally, length less than upper labial furrows; short flattened branched lobe at basal third of posterior margin; lateral nasal lobe broad, well elevated, subcircular, most expanded posteriorly.

Fang-like teeth relatively large, long and pointed, not exposed when mouth closed. Upper jaw with rudimentary symphysial tooth recessible into upper lip and flanked distally by one larger symphysial on either side. Lower jaw with three rows of enlarged symphysials, their cusps subequal in length to each other and to those at symphysis in upper jaw; tooth cusps distal to symphysis decreasing sequentially in size; tooth shape varies distally from symphysis, first two to three teeth lack cusplets, one to two cusplets from the third or fourth parasymphysial on either side of the cusp on about four to seven teeth, distal cusplets more pronounced than medial ones, three to five most distal teeth generally lack cusplets on either side of cusp; teeth formula (n = 14): upper jaw (11-12) +1 + 1 + 1 + (11-12) = (25-27); lower jaw (8-11) + 3 + (8-10) = (19-24).

Dermal lobes well developed; anterior preorbital group with three to four simple lobes, posterior lobe longest; posterior preorbital group with five to six lobes, longest lobes at extremities, anterior and second most posterior lobe longer and branched; combined distance across preorbital groups 8.3 (7.0-9.8) % TL; anterior and posterior postspiracular group with short, broader, branched single lobe, base width of anterior postspiracular lobe 1.6 (0.9-1.7) % TL, base width of posterior postspiracular lobe 1.7 (0.8-1.7) % TL; distance between prorbital group and anterior postspiracular lobe 3.5 (3.2-4) % TL, between postspiracular lobes 1.9 (1.9-2.5) % TL.

Dermal denticles small, non-imbricated, crown shield-like, weakly tricuspidate at anterior end, weak ridge on all cusps at anterior end, rounded posterior end. Clasper elongate, extending well beyond tip of pelvic fins, inner length 17.8 (16.0-17.8) % TL, 6.40 (6.40-6.55) times width at base, tip bluntly pointed; four terminal cartilages: ventral terminal, accessory terminal cartilage (or spur), dorsal terminal 2 and dorsal terminal, approximate one-to-one ratio with all terminal cartilages, end-style of axial cartilage slightly calcified and fused with dorsal terminal. When terminal cartilages of clasper are open, spear-like extension near lateral side of axial 21.1 (18.5-24.7) % clasper shaft length.

Dorsal fins similar in size and shape, triangular; anterior margins oblique; apices broadly rounded, first dorsal-fin apex slightly more rounded than second dorsal-fin apex; posterior margins vertical, very slightly convex to straight; inner margin parallel originating at level of pelvic-fin rear tip; second dorsal-fin height 8.4 (7.6-9.3) % TL, 0.99 (0.69-0.99) times pelvic-fin midpoint to second dorsal-fin origin; pre-first dorsal-fin length 48.9 (48.1-50.1) % TL, pre-second dorsal-fin length 61.2 (61.2-64.7) % TL; first dorsal-fin origin forward of pelvic-fin insertion (3.5 % TL); second dorsal-fin insertion anterior to anal-fin origin (0.7-0.8 % TL).

Pectoral fin large, length 15.7 (13.4-15.7) % TL, 2.81 (2.81-3.01) times pelvic-fin inner margin length; base fleshy, anterior margin slightly convex; apex broadly rounded; posterior margin slightly convex; inner margin straight, free rear tip very broadly rounded; prepectoral length 16.2 (16.2-19.5) % TL; pectoral-pelvic space 19.3 (16.8-21.9) % TL.

Pelvic fins moderately large, length 14.9 (12.0-14.9) % TL; anterior margin straight; apex very broadly rounded; posterior margin convex; inner margin straight, free rear tip broadly rounded; origin slightly anterior to first dorsal-fin origin, insertion first dorsal-fin midpoint; prepelvic length 44.1 (44.1-46.4) % TL, 2.51 (2.40-2.68) times pelvic-anal space; pelvic-anal space 17.6 (17.1-18.7) % TL, pelvic-caudal space 22.8 (21.9-26.57) % TL, 1.05 (1.03-1.26) times trunk width.

Anal fin elongate, lobe-like, well developed, base 8.5 (7.5-8.9) % TL, 2.09 (1.55-2.20) times interdorsal space; anterior and inner margins almost parallel, anterior margin first slightly concave then slightly convex; apex very broadly rounded; posterior margin straight, much smaller than anterior margin; inner margin straight, free rear tip slightly rounded; origin slightly posterior to second dorsal-fin insertion, insertion slightly posterior to caudal-fin origin; anal-fin height 1.61 (1.45-1.85) in base length; second dorsal-fin origin to anal-fin origin 10.3 (8.2-10.3) % TL, second dorsal-fin insertion to anal-fin insertion 1.36 (1.11-1.48) times terminal caudal margin.

Caudal fin long, strongly compressed; dorsal caudal margin length 21.0 (19.1-21.6) % TL, its origin slightly anterior to anal-fin insertion; upper lobe originating as a very low ridge, slightly distinguishable; anterior margin with a deep inflexion near its origin; outer rim straight and oblique; rounded apices; terminal caudal lobe fan-like; terminal caudal margin 6.2 (5.5-6.2) % TL.

Vertebral counts (n = 7): pre-first dorsal count 54-55; pre-second dorsal count 78-80; precaudal count 108-112. Spiral valve whorl count: 29-32 (n = 32, based on discarded specimens).

Coloration

Body light and dark brown coloration with nine darker brown blotch-shaped saddles located dorsally; each saddle has conspicuous black edges followed by grayish coloration, light brown and gray freckle-like blotches between saddles; first saddle weakly visible, posterior to spiracle, anterior to second gill slit; second saddle at pectoral-fin base level, broader than long; posterior end of third saddle at pelvic-fin origin level, length similar to width, lighter brown saddle extending laterally; fourth saddle small, anterior to first dorsal -fin origin, overlapping with inflexion of first dorsal-fin; fifth saddle from first dorsal-fin midbase to slightly anterior to second dorsal-fin origin, extending laterally and ventrally below mid body, nearly connecting at ventral midline; sixth saddle from second dorsal-fin midbase to slightly anterior of caudal-fin origin, extending laterally and ventrally below mid body, nearly connecting at ventral midline; seventh saddle at origin of caudal fin, anterior to anal-fin insertion, longer than broad, extending laterally, not extending on lower lobe of caudal fin; eighth saddle on upper caudal lobe, longer than broad, extending laterally, not extending on lower lobe of caudal fin; ninth saddle slightly anterior to caudal -fin tip, extending laterally, not extending on lower lobe of caudal fin. Gray bluish blotches sometimes with black edges on saddles decreasing in number and size from fourth saddle. V-shaped pattern anterior to interorbit; white spot on posterior tip of spiracle.

Underneath of head, trunk, abdomen and snout uniformly pale yellow, mouth and labial furrows with dark brown spots extending between posterior dermal lobe preorbital groups. Tail with three darker brown stripes on the flanks.

Pectoral fins green brown with blotches, underneath yellow at base, increasing brown color towards posterior margins, slight light brown blotches and white freckles; pelvic fins brown gray with blotches, underneath yellow at base, increasing brown color towards posterior margins, slight light brown blotches and white freckles; anal fin green brown, similar to tail coloration; dorsal fins brown, darker brown where saddles occur, green gray blotches/spots; caudal fin green brown, darker brown where saddles occur.

Remarks

Orectolobus halei ZBK was previously synonymized with O. ornatus due to the similarity in morphology and color pattern. Whitley (1940) first mentioned this species as a subspecies of O. ornatus and only described it as differing from O. ornatus “in color pattern and the form of the tentacles around the head”. The holotype, lodged at the South Australian Museum, Adelaide (SAMA), has been missing since at least 1997. The designation of a neotype is required due to the following. First, the previous description was so incomplete as to make it impossible to reliably distinguish O. ornatus from O. halei ZBK . Secondly, there currently is a significant problem of misidentification between those two species within the targeted fishery for wobbegong sharks. Lastly, declining catches of wobbegong sharks strongly argue for a reliable means of identifying the target species.

Orectolobus halei ZBK can be distinguished from O. ornatus by several measurements (Table 1) and the two species also differ in 11 specific ratios (Table 2).

Orectolobus halei ZBK , which is regionally sympatric with S. tentaculatus , O. maculatus , O. wardi ZBK , O. hutchinsi , and two undescribed species of Orectolobus off WA, can be distinguished from these species by the combination of the number of dermal lobes, color pattern and the absence of tubercles. Orectolobus hutchinsi has slender unbranched postspiracular lobes (broad and branched in O. halei ZBK and O. maculatus ) and a distinctive yellowish brown upper body coloration with well-defined, darker brown saddles containing paler markings that lacks whitish rings and blotches (unlike O. ornatus and O. maculatus ) (Last et al., 2006). Sutorectus tentaculatus has large rounded tubercles on both the head and body, not present in the adults of other members of the family Orectolobidae . Orectolobus maculatus has six to ten dermal lobes, O. wardi ZBK has unbranched nasal barbels, whereas O. halei ZBK has five dermal lobes and branched nasal barbels. Orectolobus wardi ZBK has a simple color pattern with fewer dark spots, while O. maculatus and O. halei ZBK have a more elaborate pattern of variegated spots and saddles. Orectolobus maculatus has white O- shaped spots and white blotches that are absent in O. halei ZBK .

Size

To at least 2060 mm TL; males mature at 1684-1819 mm TL, females mature at 1605- 1871 mm TL (Huveneers unpublished data).

Distribution

Temperate Australia , from Southport ( 27° 06S , 153° 26E ), Qld , to Norwegian Bay ( 22° 54S , 113° 59E ), WA . Southern records to Flinders Island ( 40° 19S , 147° 48E ), Bass Strait .

  • Charlie Huveneers (2006): Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284, 29-51: 32-43, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:CCA40A52-BD36-420A-BE62-56E3873CE064
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Banded Wobbegong is an Australian endemic, recorded from warm temperate eastern Australia with confirmed reports from Moreton Bay, Queensland, and likely reports from Hervey Bay southwards to Flinders Island, Tasmania, and northwest to Norwegian Bay, Western Australia (Last and Stevens 2009).Previous sources (Last and Stevens 1994, Compagno 2001) show that the global distribution of this species (formerly known as the Ornate WobbegongO. ornatus) includes Indonesia, Papua New Guinea, and Japan. However, wobbegongs (family Orectolobidae) from these areas are either misidentified Ornate Wobbegongor other undescribed species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: off Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Temperate Australia from Queensland to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Banded Wobbegongoccurs inshore on the continental shelf to at least 195 m depth (J. Chidlow, pers. comm., 2011) and appears to prefer clear water reefs (Kuiter 1993), being often found in clearer water than the closely related Spotted Wobbegong (O. maculatus)(Lieske and Myers 1994).The Banded Wobbegong is a common inshore bottom-dwelling shark of continental waters, found in bays, on macroalgal rocky reef areas, coral reefs (including lagoons and reef flats, reef faces, and reef channels), and around offshore islands (Compagno 2001).This nocturnal species rests on the bottom during the day in caves, under ledges on reefs, and in trenches, undertaking nocturnal excursions away from resting areas.In a study in Port Stephens, New South Wales (NSW), the sympatric Ornate Wobbegongwas shown to prefer sponge gardens, artificial structures, and barren boulder habitats with a high topographic complexity and crevice volume (Carraro and Gladstone 2006). However, the Ornate Wobbegongdid not seem to select habitat on the basis of prey availability, therefore habitat selection may be related to predator avoidance (Carraro and Gladstone 2006).A survey of wobbegongs showed evidence of site attachment with divers observing individual sharks in exactly the same positions over consecutive dives (Ecology Lab 1991).

The Banded Wobbegongwas previously believed to mature at about 175 cm total length (TL) (Last and Stevens 1994, Compagno 2001) due to confusion with the Ornate Wobbegong. Further studies estimated the length at which 50% of the population is mature at about 175 cm TL in NSW waters (Huveneers et al. 2007) and 182 cm TL in Western Australian waters (Chidlow 2003). Gestation lasts about 1011 months with parturition occurring during SeptemberOctober (Huveneers et al. 2007). The species is lecithotrophic viviparous (Huveneers et al. 2007, 2011) with a litter size ranging from 1747 (mean 31.6) and a size at birth of about 28 cm TL (Huveneers et al. 2011). Maximum length is at least 206 cm TL, with reports to 290 cm TL requiring confirmation (Last and Stevens 2009).

Growth parameters were estimated from 253vertebraecollected off New South Wales and Victoria. Taking into account biologically meaningful estimations of L and k, the model with the best fit to the data was thelogistic growth function, and estimated growth parameters were: 212 cm TL for L and 0.20 for k, and the maximum number of growth bands was 27 (Huveneerset al.2013).Verification and validation undertaken using edge and marginal increment analyses, as well as chemical marking of captive and wild wobbegongs, suggested that growth band deposition in orectolobids is more likely to be linked to somatic growth than seasonality (Huveneerset al.2013).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus halei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATAGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCCCACGCCGGAGCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAACCCTCCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus halei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Huveneers, C., Pollard, D.A., Gordon, I., Flaherty, A.A. & Pogonoski, J.

Reviewer/s
Walls, R.H.L. & Kyne, P.M.

Contributor/s

Justification
The Banded Wobbegong (Orectolobus halei) is an Australian endemic species. Previous records from Papua New Guinea, Indonesia, and Japan are either misidentified Ornate Wobbegong (O. ornatus) or a different species of wobbegong. The Banded Wobbegongis a biologically sensitive species, site-attached within its relatively shallow water range (0195 m depth), and caught in commercial and recreational fisheries as a target species and as bycatch. In New South Wales (NSW), wobbegong (unspecified species) catch combining all fishing methods and fisheries declined by more than 50% between 1997-1998 and 2007-08, after which it stabilised to around 20 tonnes. This led to all three species of wobbegong occurring in NSW, includingthe Banded Wobbegong, to be regionally listed as Vulnerable. However, fishing effort reported as the number of days fished also declined between 1990-91 and 2008-09, resulting in the catch rate being relatively constant around 15 kg per fishing days from 1990-91 until 2009. Fishing effort and ensuing catch rate should, however, be used with caution because it is coarsely reported as the number of days fished and does not account for the number of hooks used or soak times. Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. New management regulations in May 2008 introduced a daily limit of six wobbegongs. A minimum size limit of 180 cm total length forthe Banded Wobbegongimplemented between 2008 and 2013 protected juveniles. Although the minimum size limit is no longer applicable, wobbegongs are no longer targeted to the same extent as they used to because of the trip limit implemented in 2008. In addition, further investigation of the NSW fishing catches and effort revealed that catch per unit effort did not decrease as thought in the previous assessment. Wobbegongs are not targeted and catches are low in other Australian states (Western Australia, Queensland, South Australia, and Victoria). As a result, there is no evidence to infer or suspect population decline ofthe Banded Wobbegong, and current catches are relatively low, resulting in a listing ofLeast Concern.

History
  • 2009
    Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A phylogeographic study showed no evidence of subpopulations (Corrigan 2009), butthe Ornate Wobbegongpopulation was previously considered to be juveniles ofthe Banded Wobbegong(Huveneers 2007). There is no information available on the overall population size or structure of this species, but based on catch data from various Australian fisheries there is no reason to believe the population is declining (see Threats section for more detail).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commercial fishing is probably the main threat to this species in eastern Australian waters. Observed site fidelity in wobbegongs is likely to increase their susceptibility to fishing pressure. On an Australia-wide basis, wobbegongs are commonly caught in trawls, beach seines, gillnets, lobster pots and traps, by hook-and-line, and also by spearfishing.

In New South Wales, threewobbegongspecies (Spotted Wobbegong, Ornate Wobbegong,and Banded Wobbegong) are taken in the Ocean Trap and Line Fishery (OTL), in the fish and prawn sectors of the Ocean Trawl Fishery, and very few in the Estuary General Fishery. The majority of commercial wobbegong catches occur in the OTL Fishery, where they have historically been taken as both a target species by setline methods and as byproduct by other methods (NSW Department of Primary Industries, unpubl. data). The New South Wales total catch of wobbegongs,combining all fishing methods and fisheries, has declined from about 120 tonnes in 1990-91 to about seven tonnes in 2008-09 after which catches stabilized and have remained around 20 tonnes up to 2013-2014. As a result, the previous assessment in 2007 listed the Spotted and Banded Wobbegongs as Vulnerable regionally (for New South Wales) because of a 55% decline in catches in less than a decade (Pease and Grinberg 1995, NSW Department of Primary Industries, unpubl. data). However, fishing effort reported as the number of days fished also declined between 1990-91 and 2008-09, resulting in catch rate being relatively constant, around 15 kg per fishing day from 1990-91 until 2009. Catch rates after 2009 increased to about 70 kg per day, but are not directly comparable to values prior to 2009 as catch reporting changed from monthly to daily summaries in July 2009. Prior to July 1997, catches from other jurisdictions landed in New South Wales were also included. Fishing effort and ensuing catch rate should, however, be considered with caution because it is coarsely reported as the number of days fished and does not account for the number of hooks used or soak time. Additionally, the historical aggregation of the wobbegong species in catch data until July 2009 is a further complicating factor. Based on species-specific reporting from July 2009, catches of the Banded Wobbegongranged from 62-93 kg per fishing day (mean 80.5 kg) and 8.9-12.3 tonnes per year(mean 10.9 tonnes), showing no declines.

Wobbegongs are not targeted in Queensland, but have been recorded in low numbers in the bycatch of prawn trawl fisheries (Kyne et al.2002). Small wobbegongs are sometimes caught by crab pots in Southeast Queensland and Moreton Bay, but are usually discarded (J. Stead, pers. comm., 2007).

In South Australia,wobbegongsare infrequently sold at the Adelaide Fish Market. Commercial catches of wobbegong are small ranging ~0.5-4 tonnes, with the highest yearly catch being in the mid 1980s (A. Tsolos, pers. comm., March 2015). In southern Australia, a small number of wobbegongs are taken within the Southern and Eastern Scalefish and Shark Fishery (SESSF). Estimated mean annual catch of the Banded Wobbegongin the SESSF during 2000-06 was 638 kg (Walker and Gason 2007).

The Banded Wobbegongis a small component of the bycatch of the Western Australian temperate demersal gillnet and demersal longlinefisheries. The species, along with other wobbegong species occurring within the region, isprimarily caught by demersal gillnets off the southern and lower west coasts of Western Australia.Wobbegongs (unspecified species) were historically also caught by a few vessels using demersal longlines in the same fishery until the use of that gear was restricted in 2006. Fisheries-dependent surveys of southwest Western Australian fisheries reported thatthe Banded Wobbegongconstituted 1.2-1.3% and 0.5% of total elsamobranch catch from gillnet and longline gear, respectively (McAuley and Simpfendorfer 2003, Joneset al.2010). The Western Australian temperate demersal gillnet and demersal longlinefisheries mean annual wobbegong catch is about 40 tonnes per year(range 28-68 tonnes) between 1999 and 2014 and does not show any sign of decline(Department of Fisheries WA Fishery Status Report 1998-99 to 2013-14, e.g., Braccini et al. 2014). Although wobbegong catches are generally not reported to species level, small wobbegongs (<150 cm) are selectively discarded alive (Chidlowet al.2007, R. McAuley, pers. comm.) due to low flesh recovery rates from smaller individuals. Thus, the Banded Wobbegongand the Spotted Wobbegong arebelieved to be a major component of those aggregated catches. If discarded, post-release survival of orectolobid species is thought to be high. Smaller orectolobids also occur in commercial rock lobster pots throughout temperate coastal Western Australian waters (Chidlowet al.2007). However, as all sharks and rays are now commercially protected throughout WA, wobbegongs cannot generally be retained by State-managed commercial fishing vessels unless they are operating in the managed shark fishery.

The National Recreational and Indigenous Fishing Survey (Henry and Lyle 2003) reported that 5,174 wobbegongs (all species combined) were caught and kept by recreational fishers in southern Australian states during the survey time period (May 2000 to April 2001), comprising 1,944 from New South Wales, 999 from Queensland, 252 from South Australia, and 1,978 from Western Australia. The retained catch of wobbegongs by recreational fishers off the west coast of Australia has been estimated at approximately 1,000 animals per year(Sumner and Williamson 1999),while the estimated annual catch during 2011-12 by Western Australian recreational fishing from boat licence holders was 1,535 wobbegongs, with 20% or 304individuals retained (Ryanet al.2013).




Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Until late 2006, there were no management strategies specifically regulating the wobbegong commercial fishery in New South Wales. The only regulation in place was a recreational bag limit of two wobbegongs per day (later reduced to zero in September 2007) and a commercial gear limit of no more than ten lines each with a maximum of six hooks when setlining within three nautical miles of the coast. There were no gear limits outside three nautical miles, but as of 2008, amendments to the share management plans instated a maximum of 1,200 hooks and 30 traps per endorsement holder. Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. New South Wales Department of Primary Industries also recommended that fishers in the OTL and Lobster fisheries have in their codes of practice to release wobbegongs less than 130 cm TL caught in fish traps. Since July 2007, the use of wire trace, or other trace made of metal type materials, is prohibited to decrease instances of gut-hooking.

As a result of the observed decline in New South Wales wobbegong catches, and following a study of the biology and ecology of orectolobids in New South Wales (Huveneers 2007), new management regulations were introduced in May 2008 for the three species of wobbegong for the Lobster and OTL fisheries, including a daily limit of six wobbegongs and a minimum size limit of 180 cm TL for the Ornate Wobbegongand the Banded Wobbegong, and 130 cm TL for the Spotted Wobbegong. The similar minimum size limit forthe Ornate Wobbegongandthe Banded Wobbegongwas selected due to potential difficulties for fishers to differentiate the two species and was based on the size at maturity ofthe Banded Wobbegong. In April 2010, amendments to the Lobster and OTL Share Management Plans intended for the six carcass trip limit to remain in place, but the minimum size limit lapsed with the fishing closure in May 2013. In March 2011, amendments to the Ocean Trawl Share Management Plan provided for the same six carcass trip limit as the Lobster and OTL fisheries (V. Silberschneider, pers. comm., February 2015).

In Western Australia, all sharks and rays are commercially protected under Western Australian law. This regulation essentially restricts the retention of all shark and ray products by commercial fishing vessels other than those operating in the State's managed shark fishery. Relative to the area known to be occupied bythe Banded Wobbegong, shark fishing effort (mainly demersal gillnet) is sparsely distributed and managed via time-gear input controls. For example, the Metropolitan Fishing Zone, between Lancelin and south of Mandurah, was closed to commercial line and gillnet fishing in 2007 as part of a fishing reform package to ensure sustainability of fish for the future. The managed shark fishery's catches and fishing effort are also routinely monitored through analyses of statutory daily/trip logbook data and the fishery's target stocks are subject to regular stock assessments. The use of commercial shark fishing gear (large mesh gillnets and demersal longlines) is prohibited north of 2630'S latitude to 120E longitude off the north coast, which may include the northern extent of the species' range. The use of metal snoods (gangions) is commercially prohibited throughout Western Asutralian waters (except for a small amount of demersal longline effort in the managed shark fishery and pelagic mackerel troll lines).

Site attached species such as wobbegongs may also benefit from habitat protection and suitably designed and implemented no-take zones, where all forms of harvesting or fishing are excluded (Huveneers et al. 2006, Lee 2014). Some protection may be offered by those protected areas already being implemented for the Grey Nurse Shark (Carcharias taurus)in New South Wales. This species is potentially protected in the following Australian marine protected areas, marine parks and nature reserves:

Moreton Bay Marine Park, Qld
Cape Byron Marine Park, Byron Bay, northern NSW
Julian Rocks Aquatic Reserve, off Byron Bay, northern NSW
Solitary Islands Marine Park, north of Coffs Harbour, NSW
Port Stephens-Great Lakes Marine Park, north of Sydney, central NSW
Jervis Bay Marine Park, south of Sydney, NSW
Batemans Marine Park, south of Sydney, NSW
Shark Bay Marine Park, WA
Ningaloo Marine Park, WA
Jurien Bay Marine Park, WA
All Victorian marine parks
All South Australian marine parks

Possibly also occurs in the following areas:
Great Sandy Marine Park, Qld
Hamelin Pool Marine Nature Reserve, WA
Shoalwater Islands Marine Park, WA
Marmion Marine Park , WA
Muiron Islands Marine Management Area, WA

Recreational fishers may also have had an effect on this species in the past. An in-possession limit of two wobbegong sharks per person was introduced for recreational fishers in New South Wales and reduced to zero in September 2007. This new regulation may help to alleviate any adverse effects caused by recreational fishing practices. In Western Australia, recreational fishers are subject to a daily bag limit of two sharks per person, and in Queensland, one shark per person.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gulf wobbegong

The Gulf wobbegong or banded wobbegong (Orectolobus halei) is a species of carpet shark in the family Orectolobidae, found in southern Australia between Southport, Queensland and Norwegian Bay, Western Australia.[2]

O. halei is very similar to the ornate wobbegong, O. ornatus, of which it was treated as a synonym until 2006.[3] Despite this, genetic evidence suggests that O. halei is more closely related to the largely sympatric spotted wobbegong, O. maculatus, than either are to the generally more northern O. ornatus.[4]

Compared to O. ornatus, O. halei has more dermal lobes at the posterior preorbital group, a shorter pelvic fin to anal fin interspace, larger pectoral fins, a larger head and larger claspers when mature.[3] It also reaches a significantly larger size, growing to a maximum length of 2.9 metres (9.5 ft), while O. ornatus only reaches 1.17 metres (3.8 ft).[1]

Reproduction is ovoviviparous.

See also[edit]

References[edit]

  1. ^ a b Marsh, N. (2007/08). Wobbegong Update... Sportdiving 125: 66-68.
  2. ^ Clark, M. (2006). Wobbegong sharks redescribed. Practical Fishkeeping
  3. ^ a b Huveneers, C. (2006). Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284: 29-51.
  4. ^ Corrigan, S., C. Huveneers, T. S. Schwartz, R. G. Harcourt, and L. B. Beheregaray (2008). Genetic and reproductive evidence for two species of ornate wobbegong shark Orectolobus spp. on the Australian east coast. Journal of Fish Biology 73: 1662–1675.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!