Overview

Comprehensive Description

Orectolobus halei Whitley, 1940 ZBK

(Figs. 4-6, Table 1-2)

Material examined

Holotype . SAMA 2883 mm TL female (cast), type locality: St. Vincent Gulf, South Australia . Lost according to Eschmeyer (CD-Rom, 1998).

Neotype (designated herein). AMS I 43628-002, 1700 mm TL, mature male, longline, type locality: the Hump, 3.3 nautical miles offshore between Garie Beach and Wollongong, 34° 14S , 151° 04E , 20-35 m, 9th June 2005 , collector Charlie Huveneers and Jason Moyce.

Other specimens examined. AMS I43628-001, 1285 mm TL, female ; CSIRO H 6278- 01, 1775 mm TL, female ; CSIRO H6278-02, 1869 mm TL, mature male ; AMS I43628- 003, 1520 mm TL, immature male. All four specimens collected using longline at the Hump, 3.3 nautical miles offshore between Garie Beach and Wollongong, 34° 14S , 151° 04E , 20-35 m, 9th June 2005 , collector Charlie Huveneers and Jason Moyce. AMS I43629- 001, 1140 mm TL, immature male, setline, Merimbula 50-100m from shore, 36° 54S , 149° 57E , 10-20 m, 24th April 2005 , collector Charlie Huveneers, Shannon Corrigan and Shannon Fantham.

Diagnosis

A large species of Orectolobus with the following combination of characters: no warty tubercles on head or body; four groups of dermal lobes below and in front of eyes on each side of head; no dermal lobes on chin; nasal barbel closest to mouth branched; five to six lobes in second preorbital group (rarely four) with lobes at extremities usually longer and branched; broad branched postspiracular groups; two supraorbital knobs; base of anterior postspiracular lobe 3.28-3.69 in its distance from postorbital group, 1.36-2.36 in its distance from posterior postspiracular lobe; pelvic-fin insertion at first dorsal-fin midpoint; prepelvic length 2.40-3.13 times pelvic-anal space; pelvic-caudal space 1.04-1.25 times trunk width; teeth in upper jaw 25-28, those in medial row at symphysis rudimentary; spiral valve turns 29-32; precaudal vertebrae count 108-112. Light and dark brown coloration with nine darker brown, blotch-shaped saddles located dorsally; each saddle has conspicuous black edges.

Description

Body depressed anteriorly from snout to pelvic-fin origin, slightly firm dorsal musculature with relatively flaccid flanks; trunk depressed, broadest over midtrunk; body shape changing from depressed to compressed and tapering from pelvic-fin origin; dorsal musculature slightly elevated from flank musculature forming a small ridge from the fifth gill slit to pelvic-fin insertion, decreasing anteriorly to first dorsal-fin origin. Head broad, strongly depressed, somewhat oval in cross-section with truncate anterior when viewed from above, length 21.4 (21.0-21.8) % TL, 2.08 (2.08-2.76) times second dorsal-fin origin to anal-fin origin, height at gill level 8.5 (7.3-9.1) % TL, 1.74 (1.33-1.74) in pelvicfin midpoint to first dorsal-fin insertion; trunk width 21.7 (20.4-23.0) % TL; abdomen elongate, width 5.94 (5.26-6.34) % TL. Pectoral-pelvic space 19.3 (16.8-21.9) % TL, 0.90 (0.73-1.00) times head length; pelvic-anal space 2.10 (1.93-2.50) times anal-fin base; snout-vent length 0.99 (0.99-1.04) times vent-caudal length. Caudal peduncle absent, lower origin of caudal fin almost connected to anal-fin insertion, strongly compressed, oval in cross section at anal-caudal junction, caudal peduncle width 1.59 (1.33-1.64) in height.

Snout short, narrowly rounded in lateral view, truncate in dorsoventral view, slightly rounded angles; preoral length 0.8 (0.8-1.2) % TL, 12.50 (8.33-12.50) in mouth width; prenarial length negligible. Eyes dorsal on head, small, slit-like, length 1.7 (1.5-1.8) % TL, 12.35 (12.35-12.99) in head length; supraorbital crest elevated over and behind eye; two knobs on supraorbital crest, posterior knob longer; weak supraorbital ridge extending above spiracle; subocular pocket 2.26-2.70 times eye length; interorbit weakly concave. Spiracles slit-like, oblique to horizontal axis, longer than eye, 1.99 (1.91-2.29) times eye length; anterior margin convex well elevated above weakly convex posterior margin; small eye spiracle space 0.4 (0.3-0.6) % TL; fold above spiracle anterior margin. Gill slits lateral on head, first three of similar length (2.2-3.0 % TL), fourth gill slit smaller, 0.94 (0.82-1.01) times third gill slit, last gill slit longest 1.17 (1.00-1.27) times first; last gill slit anterior to pectoral-fin midbase; pectoral-fin origin between second and third gill slit. Mouth subterminal, large 3.1 (2.9-3.3) % TL, horizontally expanded, broadly arched, width 10.7 (9.6-10.7) % TL, 3.47 (2.96-3.47) times its length, 4.76 (4.76- 5.26) in vent to caudal length; 0.96 (0.83-1.09) times dorsal-fin midpoint to pelvic-fin origin; upper labial furrows 4.3 (4.1-4.9) % TL, originating at ventral margin of nostrils; lower labial furrows longer 5.4 (4.6- 5.5) % TL, almost connected near symphysis of lower jaw. Nostrils small, widely separated, internarial space 5.4 (4.5-5.4) % TL, adjacent upper lip of mouth. Nasal barbel terminal on head, medial to nostrils, proboscis-like, rounded basally, tapering distally, length less than upper labial furrows; short flattened branched lobe at basal third of posterior margin; lateral nasal lobe broad, well elevated, subcircular, most expanded posteriorly.

Fang-like teeth relatively large, long and pointed, not exposed when mouth closed. Upper jaw with rudimentary symphysial tooth recessible into upper lip and flanked distally by one larger symphysial on either side. Lower jaw with three rows of enlarged symphysials, their cusps subequal in length to each other and to those at symphysis in upper jaw; tooth cusps distal to symphysis decreasing sequentially in size; tooth shape varies distally from symphysis, first two to three teeth lack cusplets, one to two cusplets from the third or fourth parasymphysial on either side of the cusp on about four to seven teeth, distal cusplets more pronounced than medial ones, three to five most distal teeth generally lack cusplets on either side of cusp; teeth formula (n = 14): upper jaw (11-12) +1 + 1 + 1 + (11-12) = (25-27); lower jaw (8-11) + 3 + (8-10) = (19-24).

Dermal lobes well developed; anterior preorbital group with three to four simple lobes, posterior lobe longest; posterior preorbital group with five to six lobes, longest lobes at extremities, anterior and second most posterior lobe longer and branched; combined distance across preorbital groups 8.3 (7.0-9.8) % TL; anterior and posterior postspiracular group with short, broader, branched single lobe, base width of anterior postspiracular lobe 1.6 (0.9-1.7) % TL, base width of posterior postspiracular lobe 1.7 (0.8-1.7) % TL; distance between prorbital group and anterior postspiracular lobe 3.5 (3.2-4) % TL, between postspiracular lobes 1.9 (1.9-2.5) % TL.

Dermal denticles small, non-imbricated, crown shield-like, weakly tricuspidate at anterior end, weak ridge on all cusps at anterior end, rounded posterior end. Clasper elongate, extending well beyond tip of pelvic fins, inner length 17.8 (16.0-17.8) % TL, 6.40 (6.40-6.55) times width at base, tip bluntly pointed; four terminal cartilages: ventral terminal, accessory terminal cartilage (or spur), dorsal terminal 2 and dorsal terminal, approximate one-to-one ratio with all terminal cartilages, end-style of axial cartilage slightly calcified and fused with dorsal terminal. When terminal cartilages of clasper are open, spear-like extension near lateral side of axial 21.1 (18.5-24.7) % clasper shaft length.

Dorsal fins similar in size and shape, triangular; anterior margins oblique; apices broadly rounded, first dorsal-fin apex slightly more rounded than second dorsal-fin apex; posterior margins vertical, very slightly convex to straight; inner margin parallel originating at level of pelvic-fin rear tip; second dorsal-fin height 8.4 (7.6-9.3) % TL, 0.99 (0.69-0.99) times pelvic-fin midpoint to second dorsal-fin origin; pre-first dorsal-fin length 48.9 (48.1-50.1) % TL, pre-second dorsal-fin length 61.2 (61.2-64.7) % TL; first dorsal-fin origin forward of pelvic-fin insertion (3.5 % TL); second dorsal-fin insertion anterior to anal-fin origin (0.7-0.8 % TL).

Pectoral fin large, length 15.7 (13.4-15.7) % TL, 2.81 (2.81-3.01) times pelvic-fin inner margin length; base fleshy, anterior margin slightly convex; apex broadly rounded; posterior margin slightly convex; inner margin straight, free rear tip very broadly rounded; prepectoral length 16.2 (16.2-19.5) % TL; pectoral-pelvic space 19.3 (16.8-21.9) % TL.

Pelvic fins moderately large, length 14.9 (12.0-14.9) % TL; anterior margin straight; apex very broadly rounded; posterior margin convex; inner margin straight, free rear tip broadly rounded; origin slightly anterior to first dorsal-fin origin, insertion first dorsal-fin midpoint; prepelvic length 44.1 (44.1-46.4) % TL, 2.51 (2.40-2.68) times pelvic-anal space; pelvic-anal space 17.6 (17.1-18.7) % TL, pelvic-caudal space 22.8 (21.9-26.57) % TL, 1.05 (1.03-1.26) times trunk width.

Anal fin elongate, lobe-like, well developed, base 8.5 (7.5-8.9) % TL, 2.09 (1.55-2.20) times interdorsal space; anterior and inner margins almost parallel, anterior margin first slightly concave then slightly convex; apex very broadly rounded; posterior margin straight, much smaller than anterior margin; inner margin straight, free rear tip slightly rounded; origin slightly posterior to second dorsal-fin insertion, insertion slightly posterior to caudal-fin origin; anal-fin height 1.61 (1.45-1.85) in base length; second dorsal-fin origin to anal-fin origin 10.3 (8.2-10.3) % TL, second dorsal-fin insertion to anal-fin insertion 1.36 (1.11-1.48) times terminal caudal margin.

Caudal fin long, strongly compressed; dorsal caudal margin length 21.0 (19.1-21.6) % TL, its origin slightly anterior to anal-fin insertion; upper lobe originating as a very low ridge, slightly distinguishable; anterior margin with a deep inflexion near its origin; outer rim straight and oblique; rounded apices; terminal caudal lobe fan-like; terminal caudal margin 6.2 (5.5-6.2) % TL.

Vertebral counts (n = 7): pre-first dorsal count 54-55; pre-second dorsal count 78-80; precaudal count 108-112. Spiral valve whorl count: 29-32 (n = 32, based on discarded specimens).

Coloration

Body light and dark brown coloration with nine darker brown blotch-shaped saddles located dorsally; each saddle has conspicuous black edges followed by grayish coloration, light brown and gray freckle-like blotches between saddles; first saddle weakly visible, posterior to spiracle, anterior to second gill slit; second saddle at pectoral-fin base level, broader than long; posterior end of third saddle at pelvic-fin origin level, length similar to width, lighter brown saddle extending laterally; fourth saddle small, anterior to first dorsal -fin origin, overlapping with inflexion of first dorsal-fin; fifth saddle from first dorsal-fin midbase to slightly anterior to second dorsal-fin origin, extending laterally and ventrally below mid body, nearly connecting at ventral midline; sixth saddle from second dorsal-fin midbase to slightly anterior of caudal-fin origin, extending laterally and ventrally below mid body, nearly connecting at ventral midline; seventh saddle at origin of caudal fin, anterior to anal-fin insertion, longer than broad, extending laterally, not extending on lower lobe of caudal fin; eighth saddle on upper caudal lobe, longer than broad, extending laterally, not extending on lower lobe of caudal fin; ninth saddle slightly anterior to caudal -fin tip, extending laterally, not extending on lower lobe of caudal fin. Gray bluish blotches sometimes with black edges on saddles decreasing in number and size from fourth saddle. V-shaped pattern anterior to interorbit; white spot on posterior tip of spiracle.

Underneath of head, trunk, abdomen and snout uniformly pale yellow, mouth and labial furrows with dark brown spots extending between posterior dermal lobe preorbital groups. Tail with three darker brown stripes on the flanks.

Pectoral fins green brown with blotches, underneath yellow at base, increasing brown color towards posterior margins, slight light brown blotches and white freckles; pelvic fins brown gray with blotches, underneath yellow at base, increasing brown color towards posterior margins, slight light brown blotches and white freckles; anal fin green brown, similar to tail coloration; dorsal fins brown, darker brown where saddles occur, green gray blotches/spots; caudal fin green brown, darker brown where saddles occur.

Remarks

Orectolobus halei ZBK was previously synonymized with O. ornatus due to the similarity in morphology and color pattern. Whitley (1940) first mentioned this species as a subspecies of O. ornatus and only described it as differing from O. ornatus “in color pattern and the form of the tentacles around the head”. The holotype, lodged at the South Australian Museum, Adelaide (SAMA), has been missing since at least 1997. The designation of a neotype is required due to the following. First, the previous description was so incomplete as to make it impossible to reliably distinguish O. ornatus from O. halei ZBK . Secondly, there currently is a significant problem of misidentification between those two species within the targeted fishery for wobbegong sharks. Lastly, declining catches of wobbegong sharks strongly argue for a reliable means of identifying the target species.

Orectolobus halei ZBK can be distinguished from O. ornatus by several measurements (Table 1) and the two species also differ in 11 specific ratios (Table 2).

Orectolobus halei ZBK , which is regionally sympatric with S. tentaculatus , O. maculatus , O. wardi ZBK , O. hutchinsi , and two undescribed species of Orectolobus off WA, can be distinguished from these species by the combination of the number of dermal lobes, color pattern and the absence of tubercles. Orectolobus hutchinsi has slender unbranched postspiracular lobes (broad and branched in O. halei ZBK and O. maculatus ) and a distinctive yellowish brown upper body coloration with well-defined, darker brown saddles containing paler markings that lacks whitish rings and blotches (unlike O. ornatus and O. maculatus ) (Last et al., 2006). Sutorectus tentaculatus has large rounded tubercles on both the head and body, not present in the adults of other members of the family Orectolobidae . Orectolobus maculatus has six to ten dermal lobes, O. wardi ZBK has unbranched nasal barbels, whereas O. halei ZBK has five dermal lobes and branched nasal barbels. Orectolobus wardi ZBK has a simple color pattern with fewer dark spots, while O. maculatus and O. halei ZBK have a more elaborate pattern of variegated spots and saddles. Orectolobus maculatus has white O- shaped spots and white blotches that are absent in O. halei ZBK .

Size

To at least 2060 mm TL; males mature at 1684-1819 mm TL, females mature at 1605- 1871 mm TL (Huveneers unpublished data).

Distribution

Temperate Australia , from Southport ( 27° 06S , 153° 26E ), Qld , to Norwegian Bay ( 22° 54S , 113° 59E ), WA . Southern records to Flinders Island ( 40° 19S , 147° 48E ), Bass Strait .

  • Charlie Huveneers (2006): Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284, 29-51: 32-43, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:CCA40A52-BD36-420A-BE62-56E3873CE064
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Orectolobus halei is an Australian endemic wobbegong.

Orectolobus halei has been recorded from warm temperate eastern Australia with confirmed reports from Moreton Bay, Queensland and likely reports from Hervey Bay southwards to Port Phillip Bay (38°14'S, 144°39'E), Victoria and north-westwards to Norwegian Bay (22°54'S), Western Australia (J. Chidlow, unpub. data). However, records from the southern coast of Australia and Western Australia need to be verified (P.R. Last pers. comm. 2007).

Previous sources (Last and Stevens, 1994; Compagno, 2001) show that the global distribution of O. halei (formerly known as O. ornatus) includes Indonesia, Papua New Guinea, and Japan. However, wobbegongs from these areas are either misidentified O. ornatus or different undescribed species of wobbegongs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean: off Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Temperate Australia from Queensland to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Orectolobus halei is a common inshore bottom-dwelling shark of continental waters that is found in bays, on macroalgae-covered rocky reef areas, coral reefs (including lagoons and reef flats, reef faces, and reef channels), and around offshore islands (Compagno 2001). In a study in Port Stephens, NSW, a sympatric species of wobbegongs (O. ornatus) was shown to prefer sponge gardens, artificial structures and barren boulders habitats with a high topographic complexity and crevice volume (Carraro and Gladsone 2006). However, O. ornatus did not seem to select habitat on the basis of prey availability and habitat selection may therefore be related to predator avoidance (Carraro and Gladsone 2006). O. halei occurs inshore on the continental shelf to at least 195 m depth (J. Chidlow unpub. data) and appears to prefer clear-water reefs (Kuiter 1993). It is often found in clearer water than the closely related O. maculatus (Lieske and Myers 1994).

A survey on wobbegongs shows evidence of site-attachment with divers observing individual sharks in exactly the same positions over consecutive dives (The Ecology Lab, 1991). Furthermore, O. halei has been recorded within the same area for over 2.5 years (Huveneers et al. 2006; Huveneers unpub. data), and a sympatric species of wobbegong (O. ornatus) has been re-sighted within a 75 hectares area for a period of over 211 days suggesting site fidelity (Carraro and Gladstone 2006).

Compagno (2001) describes this shark as a nocturnal species that rests on the bottom during the day in caves, under ledges on reefs, and in trenches and that undertakes nocturnal excursions away from resting areas. As a primarily nocturnal feeder, it preys on bottom invertebrates and fishes (Last and Stevens 1994). Compagno (2001) cites the prey of O. ornatus and O. halei as bony fishes, sharks, rays, cephalopods and crustaceans. A NSW study found elasmobranchs (including O. ornatus), osteichthyes (reef, benthic and a few pelagic fishes, and moray eels) and cephalopods as prey items (Huveneers et al. 2007a), and only teleosts and cephalopods in a WA study (Chidlow 2003 - misidentified as O. ornatus). No crustaceans were found in the stomachs of O. halei caught in the NSW or WA study. Sampled sharks were, however, mostly large juveniles and adults (> 140 cm TL), and it is possible that crustaceans are part of neonates or small juveniles diet.

O. halei (misidentified as O. ornatus) was previously believed to mature at about 175 cm TL (Last and Stevens 1994, Compagno 2001). Further studies confirmed this and estimated L50 at about 175 cm TL in NSW waters (Huveneers et al. 2007b) and 182 cm TL in WA waters (Chidlow 2003). Similar to O. ornatus and O. maculatus, O. halei as a triennial reproductive cycle with follicles taking two years to enlarge before ovulation. During the first year, follicles remain small, then grow rapidly during the second year prior to ovulation during November. Gestation lasts about 10–11 months with parturition occurring during September–October (Huveneers et al. 2007b). O. halei is lecithotrophic viviparous (Huveneers et al. 2007b) with a litter size ranging from 30–45 and a size-at-birth of about 35 cm TL (R. Brislane pers. comm.). Maximum length is about 290 cm TL (Last and Stevens 1994).

Age and growth of O. halei was attempted but could not be verified or validated (Chidlow 2003; Huveneers 2007). Furthermore, different age estimations for wobbegongs were obtained if using whole vertebrae or thin cut sections (Huveneers 2007). Juvenile captive O. halei of about 120 cm TL grew about 12 cm TL year-1 (Huveneers 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus halei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATAGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCCCACGCCGGAGCATCAGTCGATTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACTATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAACCCTCCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus halei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Huveneers, C. Pollard, D., Gordon, I., Flaherty, A. & Pogonoski, J.

Reviewer/s
Stevens, J.D. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
The wobbegongs Orectolobus ornatus and O. maculatus were assessed for the 2003 Red List of Threatened Species. Recent studies, however, have provided new biological and ecological information while previous taxonomic uncertainties in New South Wales (NSW), Australia have now been resolved, elevating O. halei to species level (previously believed to be the adult form of O. ornatus).

The Banded Wobbegong (Orectolobus halei) is an Australian endemic species. Previous records from Papua New Guinea, Indonesia and Japan are either misidentified Ornate Wobbegongs (O. ornatus) or a different species of wobbegong. O. halei is a biologically vulnerable species, site-attached within its relatively shallow water range (0–195 m) and caught in commercial and recreational fisheries as a target species and as bycatch. Historic catch data are aggregated between wobbegong species, but serious declines (>50% between 1990/1991–1999/2000) for O. ornatus, Spotted Wobbegong (O. maculatus) and O. halei are documented for the east coast (NSW). Catches have since stabilized, however species-specific catch-per-unit-effort data are unavailable due to inaccurate reporting of fishing effort and aggregation of wobbegong species in catch records. Until late 2006, there were no management strategies specifically regulating the wobbegong commercial fishery in NSW. Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. Furthermore, a minimum size limit of 180 cm TL and a maximum trip limit of either six or 12 wobbegongs (including O. maculatus and O. ornatus) will also be implemented and is pending approval by the NSW Fisheries minister. Given the targeted wobbegong fishery, documented decline in catches and previous lack of management regulations, O. halei is classified as Vulnerable in NSW. Wobbegongs are not targeted and catches are low in other Australian states (Western Australia, Queensland, South Australia, and Victoria). However, given that localised depletion is possible due to wobbegong’s slow reproductive cycle (triennial) and long residency within small geographical areas, and that O. halei is caught across its range, O. halei is classified as Near Threatened globally at present. Records of this species from the southern coast of Australia and Western Australia need to be verified, and if this species proves to be more restricted in distribution than currently known; this assessment may need to be revisited. More information is needed on catch composition, fishing effort, age and growth and population structure to develop stock assessments and demographic analyses for use in future conservation and management decisions. Monitoring of catches will also be required due to the recent management regulations that have been introduced in NSW limiting fishing pressure on wobbegongs. Reassessment might then be required in light of this new information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No evidence of subpopulations. However, as stated above, O. halei population was previously considered the adult of O. ornatus. A genetic study looking at orectolobid phylogeny and phylogeorgaphy and assessing potential stock structure is currently being undertaken (S. Corrigan pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Commercial fishing is probably the main cause of the decline of this species in eastern Australia. Furthermore, observed site fidelity is likely to increase wobbegong’s susceptibility to fishing pressure. On an Australia-wide basis, wobbegong sharks are commonly caught in trawls, beach seines, gillnets, lobster pots and traps, by hook-and-line, and also by spearfishing. The flesh is now highly regarded as food, but in the past has generally been of only limited commercial value. Historically, the attractive skin has been used as decorative leather (Last and Stevens, 1994). However, it is unknown if this practice is still occurring.

In New South Wales, three Orectolobus species (O. maculatus, O. ornatus and O. halei) are taken in the Ocean Trap and Line Fishery (OTL), in the fish and prawn sectors of the Ocean Trawl Fishery, and very few in the Estuary General Fishery. The majority of commercial wobbegong catches occur in the OTL Fisheries, where they have historically been taken as both a target species by setline methods and as by-product by other methods (NSW Department of Primary Industries, unpub. data). Serious declines have been observed in NSW, demonstrating the vulnerability of this species to exploitation. The NSW total catch of wobbegongs (genus Orectolobus), combining all fishing methods and Fisheries, has declined from about 120 tonnes in 1990/1991 to about 55 tonnes in 1999/2000, representing a decrease of about 55% in less than a decade (Pease and Grinberg 1995, NSW Department of Primary Industries, unpub. data). However, catches have since stabilised, and range 55–73 tonnes during 1998/1999–2003/2004. Fishing effort is mostly unknown and inaccurate because it has only been reported as the number of days fished. Additionally, the historical aggregation of the wobbegong species in catch data is a further complicating factor. Species-specific catch-per-unit-effort, required to obtain a more accurate estimation of wobbegong catches, is therefore unavailable. Although the strong decline in catches should be of concern for the resilience of wobbegongs to strong fishing pressure, the number of fishers landing wobbegongs has also decreased from about 520 in 1990/1991 to about 250 in 2003/2004 (NSW Department of Primary Industries, unpub. data).

Commercial fishing by a variety of methods is potentially threatening wobbegong species in southern Australian waters. In southern Australia, wobbegongs are taken within the Southern and Eastern Scalefish and Shark Fishery (SESSF) (AFMA logbook data unpub. data). Most of the above fisheries take these species as bycatch, and like many bycatch species they are often utilised. Retained wobbegong from the Commonwealth Fisheries ranged 2.3–5.1 tonnes between 1994 and 1999.

O. maculatus and O. halei are a component of the bycatch of a commercial shark fishery utilising demersal gill-nets that target carcharhinid whalers and other sharks along the southern and lower west coasts of Western Australia with an average total wobbegong catch between 1999 and 2006 of about 45 tonnes year-1 (range 35–68 tonnes) (Simpfendorfer and Donohue 1998, Penn 2001, McAuley and Lenanton 2003, McAuley and Gaughan 2004, Gaughan and Chidlow 2005, McAuley 2006, McAuley 2007). Smaller catches of orectolobids also occur in commercial and recreational rock lobster pots throughout temperate coastal Western Australian waters (J. Chidlow, pers. comm.).

Commercial catches of wobbegong are small in most parts of South Australia (about 0.5–2.5 tonnes) with the highest yearly catch being 3.1 tonnes in 1987/88

Wobbegongs are not targeted in Queensland. O. halei has been recorded in low numbers in the bycatch of prawn trawl fisheries (Kyne et al., 2002), whereas small wobbegongs are sometimes caught by crab pots in Southeast Queensland and Moreton Bay, but are usually discarded (J. Stead, pers. comm.).

The National Recreational and Indigenous Fishing Survey (Henry and Lyle, 2003) reported that 5,174 wobbegongs (all species combined) were caught and kept by recreational fishers in southern Australian states during the survey time period (May 2000 to April 2001), comprising 1,944 from NSW, 999 from Queensland, 252 from S.A., and 1,978 from W.A. In Western Australia, a WA Fisheries Department survey conducted in 1996–1997 between Augusta and Kalbarri, reported that up to 1,000 wobbegongs were caught and kept by recreational fishers during that period (Sumner and Williamson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
As a result of the observed decline in New South Wales wobbegong catches, a discussion paper on wobbegong sharks was produced, seeking the views of various stakeholders on the future management of commercial and recreational fishing of wobbegong sharks (NSW Fisheries 2001). However, the management plan has not been finalised and management measures have not been implemented. NSW Department of Primary Industries (NSW DPI) also requested commercial fishers to report catches for O. ornatus and O. maculatus individually. Most recently, a review of NSW Recreational Freshwater & Saltwater Fishing Rules and the Fishery Management Strategy (FMS) for NSW Trap and Line Fishery have proposed a minimum size limit of 130 cm TL for wobbegong sharks and a trip limit of 12 wobbegongs caught in fish traps (NSW DPI, 2006). The FMS has also recommended that commercial fishers report their catches of each species separately and to collect additional biological data through the observer program.

Until late 2006, there were no management strategies specifically regulating the wobbegong commercial fishery in NSW. The only regulation in place was a recreational bag limit of two wobbegongs per day (later reduced to zero in September 2007) and a commercial gear limit of no more than ten lines each with a maximum of six hooks when setlining within three nautical miles of the coast. There were no gear limits outside three nautical miles, but as of 2008, amendments to the share management plans will instate a maximum of 1,200 hooks and 30 traps per endorsement holder.

Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. NSW DPI also recommended that fishers in the Ocean Trap and Line and Lobster fisheries have in their codes of practice to release wobbegongs less than 130 cm TL caught in fish traps. Since July 2007, the use of wire trace, or other trace made of metal type materials, is prohibited to decrease instances of gut-hooking. Furthermore, a minimum size limit of 180 cm TL and a maximum trip limit of either six or 12 wobbegongs (including O. maculatus and O. ornatus) will also be implemented and is pending approval by the NSW Fisheries minister.

Site attached species may also benefit from habitat protection and suitably designed and implemented "No-take" MPAs, where all forms of harvesting or fishing are excluded. Some protection may be offered by those protected areas already being implemented for grey nurse sharks Carcharias taurus in NSW.

Australian Marine Protected Areas in which the species occurs:
Moreton Bay Marine Park, Qld
Cape Byron Marine Park, Byron Bay, northern NSW
Julian Rocks Aquatic Reserve, off Byron Bay, northern NSW
Solitary Islands Marine Park, north of Coffs Harbour, NSW
Port Stephens-Great Lakes Marine Park, north of Sydney, central NSW
Jervis Bay Marine Park, south of Sydney, NSW
Batemans Marine Park, south of Sydney, NSW
Shark Bay Marine Park, WA
Ningaloo Marine Park, WA
Jurien Bay Marine Park, WA
All Victorian marine parks
All South Australian marine parks

Possibly also occurs in the following areas:
Great Sandy Marine Park, Qld
Hamelin Pool Marine Nature Reserve, WA
Shoalwater Islands Marine Park, WA
Marmion Marine Park , WA
Muiron Islands Marine Management Area, WA
Rowley Shoals Marine Park , WA

Further protected areas might be necessary to ensure stable populations and are likely to be efficient due to the high site fidelity of wobbegong (Huveneers et al. 2006).

Recreational fishers may also have had an impact on this species in the past. An in-possession limit of two wobbegong sharks per person was introduced for recreational fishers in NSW and reduced to zero in September 2007. This new regulation may help to alleviate any adverse affects caused by recreational fishing practices.

Although a PhD project investigated the biology and ecology of wobbegong sharks, catch and effort is still poorly recorded preventing adequate stock assessments. Species-specific catches in addition to accurate effort data is required to correctly determine population status of wobbegong.

The improvement of species identification in catch records and a better understanding of biological parameters, including validation of age and growth are crucial in providing accurate data upon which to base stock assessments and demographic analyses. Outcomes from which can then be used to estimate wobbegong resilience to fishing pressure and recommend future conservation and management decisions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gulf wobbegong

The Gulf wobbegong or banded wobbegong (Orectolobus halei) is a species of carpet shark in the family Orectolobidae, found in southern Australia between Southport, Queensland and Norwegian Bay, Western Australia.[2]

O. halei is very similar to the ornate wobbegong, O. ornatus, of which it was treated as a synonym until 2006.[3] Despite this, genetic evidence suggests that O. halei is more closely related to the largely sympatric spotted wobbegong, O. maculatus, than either are to the generally more northern O. ornatus.[4]

Compared to O. ornatus, O. halei has more dermal lobes at the posterior preorbital group, a shorter pelvic fin to anal fin interspace, larger pectoral fins, a larger head and larger claspers when mature.[3] It also reaches a significantly larger size, growing to a maximum length of 2.9 metres (9.5 ft), while O. ornatus only reaches 1.17 metres (3.8 ft).[1]

Reproduction is ovoviviparous.

See also[edit]

References[edit]

  1. ^ a b Marsh, N. (2007/08). Wobbegong Update... Sportdiving 125: 66-68.
  2. ^ Clark, M. (2006). Wobbegong sharks redescribed. Practical Fishkeeping
  3. ^ a b Huveneers, C. (2006). Redescription of two species of wobbegongs (Chondrichthyes: Orectolobidae) with elevation of Orectolobus halei Whitley 1940 to species level. Zootaxa 1284: 29-51.
  4. ^ Corrigan, S., C. Huveneers, T. S. Schwartz, R. G. Harcourt, and L. B. Beheregaray (2008). Genetic and reproductive evidence for two species of ornate wobbegong shark Orectolobus spp. on the Australian east coast. Journal of Fish Biology 73: 1662–1675.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!